利用斑馬魚建立心臟衰竭研究之動物模式:專一心臟troponin-C蛋白表現受抑制之斑馬魚心肌功能研究

行政院國家科學委員會專題研究計畫 成果報告

利用斑馬魚建立心臟衰竭研究之動物模式:專一心臟

troponin-C 蛋白表現受抑制之斑馬魚心肌功能研究

中 華 民 國 94 年 10 月 13 日

Topic

Conditional Antisense-Knockdown of Zebrafish Cardiac Troponin C as a New Model for Dilated Cardiomyopathy

Yi-Lwun Ho, MD, PhD1*; Wei-Yuan Tsai2*, Gar-Ling Wang, 2 Yen Hung Lin,

MD1; Fong-Jou Hsieh, MD3,# and Huai-Jen Tsai, PhD2,#

Division of Cardiology1, Department of Internal Medicine and Department of

Obstetrics and Gynecology3, National Taiwan University Hospital and National

Taiwan University College of Medicine, No.7 Chung-Shan S. Road, Taipei 100,

Taiwan; Institute of Molecular and Cellular Biology2, National Taiwan University,

1 Roosevelt Road, Section 4, Taipei 106, Taiwan.

Addresses for Correspondence#: Huai-Jen Tsai, Institute of Molecular and

Cellular Biology, National Taiwan University, 1 Roosevelt Road, Section

4,Taipei 106, Taiwan. Fong-Jou Hsieh, Department of Obstetrics and

Gynecology, National Taiwan University Hospital and National Taiwan

University College of Medicine, No.7 Chung-Shan S. Road, Taipei 100, Taiwan

Abstract

Background – Mutations of cardiac troponin C (cTnC) can cause dilated

cardiomyopathy in humans. We attempted to generate a zebrafish transgenic

line that enables us to produce the antinsense RNA strand of cTnC after

induction as a new animal model for studying dilated cardiomyopathy.

Methods and Results – We constructed plasmids that the reverse

tetracycline–controlled transactivator (rtTA) was driven by the cardiac myosin

light chain 2 promoter. This heart-specific rtTA bound another bidirectional

promoter to express the green fluorescence protein (GFP) reporter gene and

to transcribe the antisense RNA of cTnC in the presence of doxycycline (Dox).

After microinjection of these constructs into one-cell fertilized eggs, we

cultured, screened, and generated a transgenic line of zebrafish (CA17) which

enabled us to express GFP and to conditionally produce the antisense RNA of

cTnC in heart after induction. When 12-h postfertilization (hpf) embryos of F2

derived from CA17 were given Dox (10 µg/ml), the expression of endogenous

cTnC mRNA was not affected until 6 days postfertilization (dpf). The heart

rates of the embryos in CA17 were significantly slower than those of embryos

in the control T03 transgenic line (only expressing the heart-specific GFP) at 6

beats/min, p < 0.01). Moreover, the various values of cardiac chambers

measured in the induced F2 embryos from CA17 were significantly greater

than those of T03 embryos; while the ventricular ejection fraction of CA17 was

lower than that of the T03 both at 6 dpf (44%±4% vs. 50%±3%, p < 0.01) and

at 12 dpf (39%±5% vs. 52%±4%, p <0.01). In addition, asynchronized atrial

and ventricular contractions were noted in a few (1.3%) F2 embryos from the

induced CA17 transgenic fish. The mortality rate of F2 adult fish of the CA17

group was significantly higher (30% vs. 0%, p < 0.001) than that of F2 adults of

the T03 group after Dox induction.

Conclusions – Using conditional expression of antisense RNA of zebrafish

cTnC, we have created a new animal model with phenotypes simulating

dilated cardiomyopathy.

Key Words: Zebrafish; Cardiac troponin C; Antisense RNA; Dilated

Contraction of the myocardium is regulated by the cardiac troponin complex.

Calcium ions bind to the regulatory sites of cardiac troponin C (cTnC) and

facilitate interactions between the actin and tropomyosin. Mutation of cTnC

can cause myocardial dysfunction.1 A cTnC mutation has been reported to

cause human familial dilated cardiomyopathy.2 Mutation analysis of the

troponin complex in dilated cardiomyopathy patients may prove valuable in the

early identification of individuals with an adverse prognosis and a high risk of

premature death. 2 However, no animal model of dilated cardiomyopathy

related to cTnC dysfunction has been reported.

The zebrafish (Danio rerio) is an excellent animal model for cardiac

research.3-5 It has a 2-chambered heart that is similar in many genetic ways to

the 3- or 4-chambered hearts of higher vertebrates.6-7 Transparent embryos

make it possible to observe the dynamic expression of heart genes in a

noninvasive manner. Embryos of zebrafish receive oxygen through diffusion.

This kind of oxygenation system allows embryos to survive for up to (at least)

1 week even with cardiac defects.8 A 1.6-kb regulatory region of the zebrafish

cardiac myosin light chain 2 gene (cmlc2) has been demonstrated to

specifically drive green fluorescent protein (GFP) expression in the heart of

myocardium-specific expression of GFP under a tetracycline (Tet)-on

conditional expression system.10 To establish a zebrafish model that is feasible

for studying dilated cardiomyopathy, we designed 2 constructs in this study.

One was an upstream plasmid which contained a cmlc2 promoter to

specifically drive the expression of a reverse Tet–controlled transactivator

(rtTA) in the heart. The other was a downstream plasmid which contained a

Tet-binding domain (TetO) and possessed a bidirectional promoter to express

the GFP reporter and to transcribe cTnC-antisense RNA. Antisense

knockdown has been widely applied both in vitro and in vivo studies to block

the translation of endogenous mRNA.11,12 After gene transfer, a germ

line-transmitted zebrafish carrying a heart-specific Tet-On system was

generated to conditionally produce the antisense RNA of the cTnC gene.

Under the impediment of the translation of the endogenous cTnC gene,

cardiac functional assays were carried out in this transgenic zebrafish after

induction.

Methods Experimental Fish

Zebrafish of the AB strain were cultured and maintained according to the

determined according to criteria described by Kimmel et al.14

Molecular Cloning of Zebrafish cTnC (Figure 1)

The primers used to clone the cDNA sequence of zebrafish cTnC were

designed on the basis of the homologous analysis of cTnC from other known

vertebrates. The complete coding region sequence of zebrafish cTnC was

amplified by polymerase chain reaction (PCR) using cTnC-SpeI-F

(TGACTAGTATGAACGACATCTACAAAGCAGC) and cTnC-PstI-R

(TGCTGCAGCTATTCCACCCCTTCATG). The PCR product was used to

construct the expression plasmid after it was cut with SpeI and PstI. cTnC

polypeptides from various vertebrates were aligned using the BCM Research

Laucher (available at http://searchlauncher.bcm.tmc.edu/) and a phylogenetic

tree was established from the Gene Data Bank of Japan website (available at

http://www.ddbj.nig.ac.jp/). The complete coding region sequence was

deposited in GenBank (ascension no.: AF434188, maintained by the NCBI).

Whole-mount in Situ Hybridization (Figure 2)

In order to determine the tissue-specific expression pattern of the cTnC we

cloned, we carried out whole-mount in situ hybridization using a

digoxigenin-labeled RNA probe as described previously.15

pICML1-rT16-1b is an upstream plasmid used to produce cardiac-specific rtTA. It was

derived from plasmid pICMLE-(-870/787),9 except that the GFP cDNA was replaced

by rtTA-M2.10 The resulting pICML1-rT16-1b consisted of the regulatory region of

cmlc2 (the -870 to –1 nt region, exon 1, intron 1, and a portion of exon 2), rtTA-M2,

and inverted terminal repeats of an adeno-associated virus. Plasmid

pBIEK-cTnC-antisense is a downstream plasmid used to produce antisense RNA of

cTnC and to express the GFP reporter gene. It was derived from plasmid pBILE,16 in

which SpeI and PstI were used to remove the luciferase gene, which was replaced by

ligation with the opposite-direction cTnC cDNA to the rtTA-dependent bidirectional

promoter, tetO (Clontech).

Gene Transfer

Fertilized eggs at the 1-cell stage were collected and microinjected with linearized

constructs of pICML1-rt16-1b and pBIEK-cTnC-antisense following a previous

study17 except that a total of 15 µg/ml of each plasmid was used. This was the

cTnC-antisense group (CA17). Meanwhile, we also microinjected linearized plasmids

of pICML1-rt16-1b and pIBIE, in which the cTnC segment was not included, to serve

as a control group (T03 group).

Transgenic Line Screening

mature fish were kept together in tanks. The heart-specific GFP expression in F1

embryos was examined under a fluorescent microscope after induction with 10 µg/ml

of Dox (Sigma) for 3 days. GFP-positive progeny were selectively bred and mated

with wild-type (wt) fish when they reached adulthood.

Induction in Embryos

Heterozygotic F2 embryos derived from the transgenic germ lines were kept in

water until 12 h post fertilization (hpf), at which time they were treated with 10

µg/ml of Dox. After induction, GFP expression was observed under a

fluorescent microscope. Fish embryos that had heart-specific GFP expression

without leaks were selected, orientated ventrally, and tilted at 45o when taking

photos using an S2Pro digital camera (FinePix) with a 10-s exposure time at

ISO 400 for image analysis of heart functions.Morphological changes of the

heart and heart rate were also examined.

Induction in Adult Fish

The 6-month-old adult fish derived from the homozygote of transgenic lines of

the cTnC-antisense line (CA17) and the control line (T03) were selected to

carry out Dox induction. Ten fish from each group were raised in a tank and

treated with 10 µg/ml Dox. In order to prevent Dox from being photodegraded,

water in the tank was replaced daily. After the induction, we observed the

fluorescent signal in fish under fluorescent microscope for 3 weeks. Extraction of Zebrafish Embryonic mRNA

The heterozygous F2 embryos derived from the CA17 and T03 groups were

treated with Dox (10 µg/ml) when they were at the 12-hpf stage. Another

negative control group consisted of those embryos derived from the CA17

transgenic line without Dox treatment. Five embryos at 6 dpf from each of

these 3 groups were selected, and their mRNAs were extracted for further

analysis.

Reverse-Transcription Polymerase Chain Reaction (RT-PCR)

In order to detect the endogenous cTnC transcription and the antisense RNA

of cTnC transcription after induction, we collected 6-dpf F2 embryos derived

from the CA17 and T03 lines. Their total RNA was extracted. All of the RT-PCR

procedures followed those of a previous study18 except that (1) in the

first-strand cDNA synthesis, we used the Oligo-dT primer to detect the

endogenous the cTnC transcription and used TnCA-RT1F primer

(CGACATCTACAAAGCAGCGGC- AG; Fig. 1C) to detect the cTnC-antisense

strand transcription; and (2) in the following PCR amplification, we used

TnCA-RT2F (GTCTCCGTCCCTCATCAGTTCCTC) (Figure 1C).

Video File Capture and Processing

The lens adaptor of a stereomicroscope was connected to a DV camera. The

LCD monitor of the camera was turned on and a connected to the computer

with Ulead video studio 7.0 system. The image was captured for 10 s and

recorded as an AVI file in the computer. Then the AVI file was converted to

bmp files sequentially according to a previously described method.19 One bmp

file contained 1 frame of cardiac motion. The cardiac motion was viewed frame

by frame to define the systolic and diastolic phases. An area with the

most-even fluorescent distribution was selected, and the region of the

fluorescent heart to be analyzed was marked. The ventricular volume was

calculated using the formula for a prolate spheroid:20 Volume = 4/3 × π × a ×

b2 where a and b are the long and short radii of the ventricle, respectively. The

cardiac ejection fraction was calculated by the following formula: (cardiac

diastolic volume – cardiac systolic volume) ÷ cardiac diastolic volume.

Statistical Analysis

All data are expressed as the mean ± standard deviation (SD). Statistical

differences among groups were obtained using the Student's t-test. It was

Results Primary Structure of Zebrafish cTnC

The complete coding sequence of zebrafish cTnC we cloned was 486 bp

(Figure 1c), which encoded a 161-amino acid polypeptide (Figure 1a). The

zebrafish cTnC polypeptide shared 90% identities with those of a mammal,

chicken, and Xenopus (Figure 1), in which 4 E-F hand calcium-binding

domains were highly conserved. On the basis of the phylogenetic tree, the

zebrafish cTnC was clustered into the cardiac/slow skeletal muscle group.

Expression of cTnC is Heart-Specific

As shown in the in situ hybridization, the transcripts of cTnC we cloned were

heart-specific (Figure 2). The cTnC transcripts were first detectable in 17-hpf

embryos, and cTnC was expressed bilaterally in heart precursory cells behind

the notochord (Figure 2a). Transcription of the cTnC gene was detected only in

the heart-tube of 24-hpf embryos (Figure 2b), in the whole heart of 48-hpf

embryos (Figure 2c), and in the mature heart of 72-hpf embryos (Figure 2d).

The intensity of the fluorescent signal expressed in the ventricle was much

stronger than that in the atrium. The reason was there is only 1 layer of

cardiomyocytes in the atrium whereas there are 2 to 3 layers of

Inducible GFP Expression in the Germ Line-Transmitting Zebrafish The 12-hpf embryos derived from F1 of the transgenic cTnC-antisense line

(CA17) and control T03 were collected and treated with 10 ug/ml Dox. The

CA17 line expressed both the GFP and the antisense mRNA of cTnC, while

the T03 line expressed the GFP only. Without Dox treatment, there was no

green fluorescent signal shown in the fish. However, after induction, the green

fluorescent signal began to appear specifically in the heart about 12 h after

treatment (Fig 4a).

Transcription of cTnC Antisense RNA in Transgenic Fish

As shown in Figure 4b, cTnC mRNA was produced by the transgenic lines of

both CA17 and T03 after induction by Dox; whereas the antisense RNA

transcribed from the cTnC gene was clearly shown in embryos derived from

CA17 transgenic fish after Dox induction. Although a very weak signal of

antisense RNA was shown prior to induction, the green fluorescent signal was

not detected. On the contrary, the antisense RNA of cTnC was not produced in

embryos derived from the T03 control transgenic line. As long as cTnC

antisense RNA was expressed in CA17 embryos, the expression of

endogenous cTnC mRNA remained the same.

At 3 dpf, heart rates of the CA17 group were slightly faster than those of the

T03 group (Figure 5). With further growth, the situation gradually reversed. The

heart rates of CA17 were significantly slower than those of the T03 at 6

(150±10 vs. 194±11 beats/min, p < 0.01) and 12 dpf (128±12 vs. 168±8

beats/min, p <0.01).

Ventricular Assessments of CA17 and T03 Zebrafish at 6 and 12 dpf End-diastolic and end-systolic diameters were significantly different between

the T03 and CA17 groups at both 6 and 12 dpf (Figure 6, Tables 1 and 2). The

ventricular ejection fraction of CA17 was lower than that of T03 transgenic fish

(44%±4% vs. 50%±3%; p < 0.01). At 12 dpf, the ventricular ejection fraction of

CA17 was even lower than that of T03 (39%±5% vs. 52%±4%; p <0.01).

Measurements from the hearts of the T03 transgenic fish were calculated to

obtain the arithmetic mean and standard deviation. The range of mean ± 2

standard deviations was defined as the normal range. Percentages of the

upper outlier for cardiac chambers and lower outlier for the ejection fraction

and heart rates in the CA17 group are presented in Table 3.

Atrial and Ventricular Asynchrony in CA17 Zebrafish

At 6 dpf, atrial and ventricular contractions were synchronized in F2 embryos

transgenic fish developed asynchronized atrial and ventricular contractions at

12 dpf (Figure 7 and supplemental video file).

Slurred Movement and Excess Mortality in cTnC-Antisense Transgenic Adult Fish after Dox Induction

After the Dox has been continuously administrated to 6-month-old fish derived

from homozygotic parents, we found that the movement of fish from CA17 was

slower than that of T03 group. Furthermore, 30% (3/10) of fish from the CA17

group had died by day 13; whereas no mortality had occurred in the T03

group.

Discussion

cTnC and cardiac troponin T mutations have been reported to cause human

familial dilated cardiomyopathy.2 The clinical manifestations include heart

failure and sudden death.2 Cardiac troponin T variants produced by aberrant

splicing of multiple exons in animals have been related to high instances of

dilated cardiomyopathy. 21 However, there has been no report of a transgenic

animal model for cTnC dysfunction. On the other hand, cTnC is the target

protein of a novel calcium sensitizer (levosimendan).22 This drug has proven to

be a well-tolerated and effective treatment for patients with severe

heart failure is worth studying.

The zebrafish heart contains 4 components (sinus venosus, atrium,

ventricle, and bulbus arteriosus). Although it has a prototypic vertebrate heart,

the zebrafish has been used to study bradycardia, heart valve formation and

cardiac regeneration.23-29 By fusing the Tet repressor and activating the

transcription domain of virion protein 16 of the herpes simplex virus,

Tet-controlled transactivator (tTA) is generated.30 A Tet-On system is further

developed by mutagenesis, substituting 4 amino acids in tTA to generate rtTA

which requires Tet for binding to the Tet operon and subsequent activation of

the downstream gene.31 For pharmacokinetic reasons, controlling genes by

means of rtTA is particularly advantageous in the study of transgenic animals.

We have successfully developed such a Tet-On system in zebrafish that

enables the transgene to specifically be expressed in the heart after

induction.10 This technique also makes it feasible for later onset of abnormal

gene expression in adult transgenic fish. Therefore, this methodology extends

the utilization of zebrafish as a model organism from congenital cardiac

disorders to acquired heart diseases.

In this study, cTnC antisense mRNA was only noted in CA17 fish induced

ventricular size and the prevalence of ventricular enlargement had increased

significantly in the CA 17 group at 6 and 12 dpf. The ventricular ejection

fraction of the CA17 group was also significantly lower than that of the T03

group at 6 and 12 dpf. On the other hand, relative bradycardia was noted

despite the impaired contractility in the CA17 group. Chronotropic

incompetence was another major finding in the cTnC antisense zebrafish.

Even 1.3% of CA17 transgenic fish manifested asynchronized atrial and

ventricular contractions. Atrioventricular conduction block can lead to sudden

death which has been reported for troponin related dilated cardiomyopathy in

humans.2 According to Sedmera et al., trabecular bands form direct myocardial

continuity between the atrioventricular canal and the apex of the ventricle in

zebrafish.32 Therefore, cTnC may play a role in these trabecular bands.

It is interesting to observe the activities of adult fish derived from the

homozygotes of the CA17 transgenic line after continuous treatment with Dox.

The movement of cardiomyopathy-induced fish was slower, and 30% of them

experienced early death; whereas fish from the T03 control group lived

normally. It seemed that the low cardiac output failed to supply adequate

perfusion to skeletal muscles, resulting in a slurring of body movements. The

either a power failure or conduction abnormality of the hearts. These

phenomena are frequently observed in human patients with heart failure.

Recently, the zebrafish has become an important vertebrate model

organism, because this species can be used to study human diseases,

physiology, and pharmacology.33 The cTnC antisense zebrafish in this study

offers a new investigative tool for human heart failure.

Acknowledgments

This study was supported by the National Science Council, Taipei, Taiwan 　

References

1. Gomes AV, Potter JD. Molecular and cellular aspects of troponin

cardiomyopathies. Ann NY Acad Sci 2004; 1015: 214-224.

2. Mogensen J, Murphy RT, Shaw T, Bahl A, Redwood C, Watkins H,

Burke M, Elliott PM, McKenna WJ. Severe disease expression of

cardiac troponin C and T mutations in patients with idiopathic dilated

cardiomyopathy. J Am Coll Cardiol 2004; 44: 2033-2040.

3. Poss KD, Wilson LG, Keating MT. Heart regeneration in zebrafish.

Science 2002; 298: 2188-2190.

4. Raya AKC, Koth CM, Buscher D, Kawakami Y, Itoh T, Raya RM, Sternik

G, Tsai HJ, Rodriguez-Esteban C, Izpisua-Belmonte JC. Activation of

notch signaling pathway precedes heart regeneration in zebrafish. Proc

Natl Acad Sci USA 2003; 100: 11889-11895.

5. Shu X, Cheng K, Patel N, Chen F, Joseph E, Tsai HJ, Chen JN.

Na,K-ATPase is essential for embryonic heart development in the

zebrafish. Development 2003; 130: 6165-6173.

6. Fishman MC, Stainier DY. Cardiovascular development. Prospects for a

genetic approach. Circ Res 1994; 74: 757-763.

embryonic decisions. Development 1997; 124: 2099-2117.

8. Sehnert AJ, Huq A, Weinstein BM, Walker C, Fishman M, Stainier DY.

Cardiac troponin T is essential in sarcomere assembly and cardiac

contractility. Nat Genet 2002; 31: 106-110.

9. Huang CJ, Tu CT, Hsiao CD, Hsieh FJ, Tsai HJ. Germ-line transmission

of a myocardium-specific GFP transgene reveals critical regulatory

elements in the cardiac myosin light chain 2 promoter of zebrafish. Dev

Dyn 2003; 228: 30-40.

10. Huang CJ, Jou TS, Ho YL, Lee WH,Jeng YT, Hsieh FJ, Tsai HJ.

Conditional expression of a myocardium-specific transgene in zebrafish

transgenic lines. Dev Dyn 2005; (in press).

11. Yokoyama K, Imanoto F. Transcriptional control of the endogenous

MYC potooncogene by antisense RNA. Proc Natl Acad Sci USA 1987;

84: 7363-7367

12. McGarry J, Lindquist S. Inhibition of heat shock protein synthesis by

heat-inducible antisense RNA. Proc Natl Acad Sci USA 1986; 83:

399-403.

13. Westerfield M. The zebrafish book, Eugene, or University of Oregon

14. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages

of embryonic development of the zebrafish. Dev Dyn 1995; 203:

253-310.

15. Jowett T. Double in situ hybridization techniques in zebrafish. Methods

2001; 23: 345-358.

16. Chou CY, Hong LS, Tsai HJ. Uniform GFP-expression in transgenic

medaka (Oryzias latipes) at the F0 generation. Transgen Res 2001; 10:

303-315.

17. Wang TM, Chen YH, Liu CF, Tsai HJ. Functional analysis of the

proximal promoter regions of fish rhodopsin and myf-5 genes using

transgenesis. Mar Biotechnol 2002; 4: 247-255.

18. Huang CJ, Lin JY, Tsai HJ. Two distinct c-ski cDNAs of fish, tilapia

(Oreochromis aurea). Mol Reprod Dev 1999; 54: 223-231.

19. Ho YL, Shau YW, Tsai HJ, Lin LC, Huang PJ, Hsieh FJ. Assessment of

zebrafish cardiac performance using Doppler echocardiography and

power angiography. Ultrasound Med Biol 2002; 28: 1137-1143

20. Hou PC, Burggren WW. Cardiac output and peripheral resistance

during larval development in the anuran amphibian Xenopus laevis. Am

21. Biesiadecki BJ, Elder BD, Yu ZB, Jin JP. Cardiac troponin T variants

produced by aberrant splicing of multiple exons in animals with high

instances of dilated cardiomyopathy. J Biol Chem 2002; 277:

50275-50285.

22. Sorsa T, Pollesello P, Solaro RJ. The contractile apparatus as a target

for drugs against heart failure: interaction of levosimendan, a calcium

sensitiser, with cardiac troponin c. Mol Cell Biochem 2004; 266: 87-107.

23. Poss KD, Wilson LG, Keating MT. Heart regeneration in zebrafish.

Science 2002; 298: 2188-2190.

24. Raya A, Consiglio A, Kawakami Y, Rodriguez-Esteban C,

Izpisua-Belmonte JC. The zebrafish as a model of heart regeneration.

Cloning Stem Cells 2004; 6: 345-351.

25. Raya A, Koth CM, Buscher D, Kawakami Y, Itoh T, Raya RM, Sternik G,

Tsai HJ, Rodriguez-Esteban C, Izpisua-Belmonte JC. Activation of

Notch signaling pathway precedes heart regeneration in zebrafish. Proc

Natl Acad Sci USA 2003; 100: 11889-11895.

26. Armstrong EJ, Bischoff J. Heart valve development: endothelial cell

signaling and differentiation. Circ Res 2004; 95: 459-470.

Graef IA, Crabtree GR. A field of myocardial-endocardial NFAT

signaling underlies heart valve morphogenesis. Cell 2004; 118:

649-663.

28. Milan DJ, Peterson TA, Ruskin JN, Peterson RT, MacRae CA. Drugs

that induce repolarization abnormalities cause bradycardia in zebrafish.

Circulation 2003; 107: 1355-1358.

29. Hsieh DJ, Liao CF. Zebrafish M2 muscarinic acetylcholine receptor:

cloning, pharmacological characterization, expression patterns and

roles in embryonic bradycardia. Br J Pharmacol 2002; 137: 782-792.

30. Gossen M, Bujard H. Tight control of gene expression in mammalian

cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA

1992; 89: 5547-5551.

31. Gossen M, Freundlieb S., Bender G., Muller G., Hillen W., Bujard H.

Transcriptional activation by tetracycline in mammalian cells. Science

1995; 268: 1766-1769.

32. Sedmera D, Reckova M, deAlmeida A, Sedmerova M, Biermann M,

Volejnik J, Sarre A, Raddatz E, McCarthy RA, Gourdie RG, Thompson

RP. Functional and morphological evidence for a ventricular conduction

Physiol 2003; 284: H1152-H1160.

33. Langheinrich U. Zebrafish: a new model on the pharmaceutical catwalk.

Table 1. Cardiac measurements of F2 embryos at 6 dpf from transgenic fish

after continuously Dox induction from 12 hpf.

T03 (N = 15) CA17 (N = 26) p value

Diastolic

Long diameter (um) 159±5 164±14 0.106

Short diameter (um) 99±5 109±6 < 0.01

Systolic

Long diameter (um) 130±6 132±13 0.24

Short diameter (um) 87±4 90±4 0.02

End-diastolic volume (um3) 870,226±122,525 1,027,030±157,561 0.13

End-systolic volume (um3) 491,800±45,258 568,976±837,191 < 0.01

Ventricular ejection fraction (%) 50±3 44±4 < 0.01

Heart rate (beats/min) 194±11 150±10 < 0.01

T03, control transgenic line which expressed the GFP after induction; CA17,

transgenic line which expressed the GFP and transcribed the antisense strand

Table 2. Cardiac measurements of F2 embryos at 12 dpf from transgenic fish

after continuous Dox induction from 12 hpf.

T03 (N = 15) CA17 (N = 20) p value

Diastolic

Long diameter (um) 225±8 252±16 < 0.01

Short diameter (um) 125±9 146±18 < 0.01

Systolic

Long diameter (um) 196±8 211±19 < 0.01

Short diameter (um) 110±4 124±14 < 0.01

End-diastolic volume (um3) 1,831,044±245,255 2,870,476±846,137 < 0.01

End-systolic volume (um3) 1,303,185±155,464 1,738,336±472,814 < 0.01

Ventricular ejection fraction (%) 52±4 39±5 < 0.01

Heart rate (beats/min) 168±8 128±12 < 0.01

T03, control transgenic line which expressed the GFP after induction; CA17,

transgenic line which expressed the GFP and transcribed the antisense strand

Table 3. Prevalence of abnormal cardiac measurements in F2 embryos

derived from the cTnC-antisense transgenic line (CA17) of zebrafish after

induction by Dox.

CA17 (N = 26, 6 dpf) CA17 (N = 20, 12 dpf)

n (%) n (%)

Diastolic Diastolic Abnormally long diameter

(> 169 µm)

7 (26.9%) Abnormally long diameter (> 241 µm)

14 (70.0%)

Abnormally short diameter (> 110 µm)

14 (53.8%) Abnormally short diameter (> 142 µm)

10 (50.0%)

Systolic Systolic Abnormally long diameter

(> 141 µm)

5 (19.2%) Abnormally long diameter (> 211 µm)

9 (45.0%)

Abnormally short diameter (> 94 µm)

1 (3.8%) Abnormally short diameter (> 118 µm) 13 (65.0%) Abnormally end-diastolic volume (> 115276 µm3) 4 (15.4%) Abnormally end-diastolic volume (> 2321554 µm3) 12 (60.0%)

volume (> 581424 µm3) volume (> 1614112 µm3) Abnormally ventricular

ejection fraction (< 44%)

12 (46.2%) Abnormally ventricular ejection fraction (< 45%)

18 (90%)

Abnormally heart rate (< 173 beats/min)

26 (100%) Abnormally heart rate (< 153 beats/min)

Legends

Fig. 1. Molecular cloning of cardiac troponin C (cTnC). In vertebrates, the amino acid sequences of cTnC are highly conserved from fish to mammal. The

overall identities are exceed 90% not only in the 4 calcium-binding domains

but also in the entire fragment. The nucleotide sequences of others species

were obtained form the NCBI EST database (a). In the phylogenic tree,

zebrafish troponin C was clustered in the ss/cTnC group (b). The full coding

region sequence is shown in (c).

Fig. 2. Expression pattern of the zebrafish cardiac troponin C (cTnC) gene. Images of 18 hpf (A) and 24 hpf (B) are in the dorsal view; the image at 48 hpf (C) is in the ventral view; and image at 72 hpf (D) is left-side up. The

expression of cTnC was restricted to the heart field from fusion of the 2

bilateral cells (at 18 hpf) to the mature heart (at 72 hpf).

Fig. 3. Construction map of antisense knockdown of cardiac troponin C (cTnC). After adding Dox, the transactivator, rtTA-M2, was driven by the cmlc2 promoter combined with Dox after 16 hpf. This complex was capable of

expression of the reporter green fluorescent protein (GFP) and the

transcription of cTnC antisense RNA.

Fig. 4. Detection of the expression of green fluorescent protein (GFP) and the transcription of cardiac troponin C (cTnC) antisense RNA. The 12-hpf embryos derived form the cTnC-antisense transgenic line CA17 were collected

and incubated in 10 µg/ml Dox. Green fluorescence was observed in the heart

at 48 hpf (A). The reverse-transcription polymerase chain reaction was used to

detect the transcription of endogenous cTnC mRNA and the transcription of

cTnC antisense RNA (B). Embryos were treated with Dox after 12 hpf, and the

total RNA was extracted when these embryos reached 6 dpf. Antisense cTnC

was strongly detected in the CA17 group after induction. Although the

antisense RNA of the cTnC gene was slightly detected in the non-induced

group, the green fluorescent signal was not detected. Expression of the

endogenous cTnC gene was almost the same in the T03 and CA17 groups.

This suggests that the antisense of cTnC did not interfere in the expression of

the endogenous cTnC gene. Arrow indicates the position of the heart.

Fig. 5. Heart rates at different stages in the T03 and CA 17 groups.

heart rates of embryos derived from the CA17 group were significant slower

than those of embryos from theT03 group at 6 and 12 dpf. ＊ p < 0.01.

Fig. 6. Changes in ventricular morphology. The end-systolic and

end-diastolic ventricular dimensions of the F2 embryos of the CA17 group

were larger than those of the T03 group.

Fig. 7. Asynchronized contractions of the atrium and ventricle were observed in some F2 embryos derived from the CA17 group.