• 沒有找到結果。

Molecular cloning and functional analysis of an orange-spotted grouper (Epinephelus coioides) secreted protein acidic and rich in cysteine SPARC) and characterization of its expression response to nodavirus

N/A
N/A
Protected

Academic year: 2021

Share "Molecular cloning and functional analysis of an orange-spotted grouper (Epinephelus coioides) secreted protein acidic and rich in cysteine SPARC) and characterization of its expression response to nodavirus"

Copied!
48
0
0

加載中.... (立即查看全文)

全文

(1)

Revised Manuscript No: FSIM-D-10 – 00398R1 1

Molecular cloning and functional analysis of an orange-spotted grouper (Epinephelus 2

coioides) secreted protein acidic and rich in cysteine (SPARC) and characterization of 3

its expression response to nodavirus 4

Young-Mao Chena, b, c, 1, Cham-En Kuod, 1, Yi-Ling Huanga , Pei-Shiuan Shiea, Jhong-Jian 5

Liaoa, Yuan-Chih Yanga and Tzong-Yueh Chena, b, c, * 6

7

aLaboratory of Molecular Genetics, Institute of Biotechnology, College of Bioscience and 8

Biotechnology; bResearch Center of Ocean Environment and Technology, and cAgriculture 9

Biotechnology Research Center,National Cheng Kung University, Tainan 70101, Taiwan 10

dDepartment of Nursing, Tzu Hui Institute of Technology, Pingtung 926, Taiwan 11

12

Running title: Nodavirus decreases SPARC production 13

* Correspondence to: Dr. Tzong-Yueh Chen, Laboratory of Molecular Genetics, Institute of 14

Biotechnology, College of Bioscience and Biotechnology, National Cheng Kung University, 15

Tainan 70101, Taiwan; Phone: 886-6-2757575 ext 65622 ext 610; Fax: 886-6-2766505; E- 16

mail: [email protected] 17

18

1 These authors contributed equally to this work.

19

Source:Fish & Shellfish Immunology, Vol. 31, No. 2, pp. 232-242 Year of Publication:2011

ISSN:1050-4648 Publisher:Elsevier

DOI:10.1016/j.fsi.2011.05.008

© 2011 Elsevier Ltd. All rights reserved

(2)

Abstract 21

Mammalian secreted protein acidic and rich in cysteine (SPARC) is the primary regulator of 22

cell shape and cell adhesion to fibronectin. We, for the first time, report the complete 23

sequencing of SPARC cDNA from orange-spotted grouper. Despite the difference in the 24

lengths of the SPARC transcripts, all of the SPARC molecules encoded a signal peptide, 25

follistain-like copper binding sequence (KGHK) domain, and extracellular domain. The 26

grouper SPARC gene was differentially expressed in vivo and contributed differently to high- 27

level expression of SPARC in muscle. Immunohistochemical staining demonstrated a 28

decreased level of SPARC in nodavirus-infected grouper compared with healthy grouper.

29

Comparative real-time polymerase chain reaction analyses of eye tissues of viral nervous 30

necrosis grouper and healthy grouper were performed. Recombinant SPARC produced 31

changes in grouper cell shape 24 h after treatment. The results provide new insight into the 32

pathogenesis of nodavirus, and demonstrate an experimental rationale for SPARC 33

characterization in nodavirus-infected grouper.

34 35

Keywords: Nodavirus, secreted protein acidic and rich in cysteine (SPARC) 36

37

(3)

1. Introduction 38

SPARC (Secreted Protein Acidic and Rich in Cysteine), also termed osteonectin and BM-40, 39

is a secreted, multifunctional, matricelluar glycoprotein that participates in physiological 40

functions especially cell adhesion [1] and proliferation [2], and which regulates a range of 41

biological processes such as development [3], tissue repair [4] and remodeling [5]. SPARC 42

deficient fibroblasts and endothelial cells arrest in the G1 phase of the cell cycle [6].

43

Pulmonary tissue fibroblast cells can display reduced cell adhesion to integrin-ligand coated 44

surfaces as the result of disruption of focal adhesion complexes, giving rise to inhibition of 45

cell spreading [7]. In the case of several growth factors and matrix metalloproteinases, 46

SPARC interacts with several extracellular matrix components to associate with, and regulate, 47

their expression and activity [8]. These activities of SPARC cause antiangiogenesis, likely 48

through blockade of a specific set of vascular endothelial growth factor (VEGF) proteins that 49

induce endothelial cell proliferation, or inhibit tumor stromal cell growth through blocking of 50

platelet-derived growth factor (PDGF) activity [9–11].

51

SPARC of teleost species consists of three distinct domains: an acidic domain in the N- 52

terminus of the polypeptide; a follistatin-like domain, which is a cysteine-rich region that 53

contains a copper binding lysine-glycine-histidine-lysine [(K)GHK] sequence, and a 54

extracellular Ca2+ -binding (EC) domain that contains two EF-hand motifs located in the C- 55

terminus of SPARC [12,13]. The SPARC gene has been cloned in representatives of several 56

(4)

teleost fish including zebrafish [14], medaka [15], and gilthead seabream [16]. Nevertheless, 57

at the present time, betanodavirus is neuropathogenic and inflicts conspicuous damage that is 58

characterized by vacuolation and degeneration of neurons throughout the central nervous 59

system [17]. Piscine nodavirus, a member of the Betanodavirdae family, is the causative 60

agent of viral nervous necrosis or fish encephalitis that produces high mortalities in hatchery- 61

reared larvae and juveniles of marine fishes in Taiwan, Japan, Australia, and Europe [18].

62

However, little is known on the role of SPARC in nodavirus infection. In previous microarray 63

studies, piscine SPARC was shown to be downregulated in infectious salmon anemia virus 64

(ISAV)-infected Atlantic salmon [19] and upregulated with integrin receptor family member 65

CD9, a well-known cell motility and migration marker [19, 20]. Just as a role for SPARC in 66

modulating cell migration, the SPARC function not only induces loss of focal adhesion but 67

also regulates the expression of metalloproteinases (MMPs) [21] and plasminogen-activator 68

factor (PAF) [22]. The observations rely either on SPARC expressed by migrating cells or on 69

structural SPARC, which is composed of part of basal membranes and extracellular matrix 70

(ECM) [23]. In SPARC-deficient mice, the mechanism behind this influence on increasing 71

neutrophil and leukocyte infiltration presents in bleomycin-induced peritonitis [24] and TPA- 72

induced skin inflammation [25]. In tissue remodeling, although the role of SPARC has not 73

been linked directly to cell migration, through its binding to collagen type IV in basal 74

membrane, and to collagen type I in the dermis [26]. Similarly, the lack of SPARC in the 75

(5)

environment accelerates the onset of T-cell priming by hastening Langerhans cells 76

(LCs)/dendritic-cells (DCs) migration and in turn, SPARC also contributes to antigen- 77

specific immune responses by conditioning DC migration [27]. On the other hand, medaka 78

SPARC represents a marker of early sclerotome development, and has been used to analyze 79

early skeletal development and formation of extracellular bone matrix in this vertebrate 80

model [15]. In contrast, zebrafish SPARC is required for otolith (ear stones) growth by 81

interacting with otolin-1 to influence the assembly of the otolith framework and 82

mineralization [28]. Changes in SPARC expression levels have been linked to the extent of 83

the size and number of mice adipocytes [29]. The expression of sea bream SPARC is 84

downregulated by the hypercalcemic hormone [16]. On the other hand, the overexpression of 85

SPARC in response to 5-fluorouracil (FU)-based chemotherapy decreases hepatocellular 86

carcinoma (HCC) cell viability [30]. Thus, altered expression of SPARC in different cancer 87

cells seems to be associated with good prognosis [31]. In nodavirus-infected grouper, the 88

activation of the host immune response and direct invasion of cells are believed to contribute 89

to this pathogenesis [32, 33], which includes induction of inflammatory cells and the host 90

immune response. For example, ubiquitin conjugating enzyme 7 interacting protein, which 91

functions in apoptosis, and interferon induced with helicase C domain protein 1, which 92

contributes to apoptosis and mediates type I interferon production, are differentially 93

expressed in infected and control cells [34]. Piscine SPARC is a rarely studied gene; the 94

(6)

significant function of SPARC in nodavirus-infected grouper remains unclear. Furthermore, 95

no studies have reported the relationship between changes in SPARC expression levels and 96

nodavirus-infected grouper.

97

The purpose of the present study was 1) clone and molecularly characterize SPARC 98

cDNA from the orange-spotted grouper Epinephelus coioides, 2) to compare its sequences 99

and conduct phylogenetic analyses with other SPARC, 3) to examine the transcription and 100

translation of SPARC from different tissues, 4) to evaluate the changes of SPARC expression 101

in uninfected and nodavirus infected grouper, and 5) to evaluate the effect on the regulation 102

of cell shape after recombinant SPARC treatment of the GF-1 grouper cells.

103 104 105

(7)

2. Materials and methods 106

2.1. Cell culture and reagents 107

The grouper cell line GF-1 [35] was grown at 28 °C in Leibovitz's L-15 medium (GibcoBRL, 108

Gaithersburg, MD, USA) supplemented with 5% fetal bovine serum (FBS). GF-1 cells, which 109

are susceptible to nodavirus infection and nodavirus replication, were obtained from the 110

Bioresources Collection and Research Center in Taiwan BCRC960094. Transient transfection 111

was performed by introducing to 2 g of plasmids encoding grouper SPARC into cells by 112

using Lipofectamine (Invitrogen, Carlsbad, CA, USA). After transfection, cells were grown 113

for 24 to 30 h. Intracellular localization of SPARC proteins was examined by using an 114

Olympus IX70 microscope. An alkaline phosphatase-conjugated substrate Western blotting 115

detection system kit was purchased from Bio-Rad (Hercules, CA, USA). Alkaline 116

phosphatase-conjugated anti-mouse, anti-rabbit, and or anti-goat IgG antibodies (Santa Cruz 117

Biotechnology, Santa Cruz, CA, USA) were diluted 1:5000 prior to use.

118

2.2. RNA isolation and reverse transcription-polymerase chain reaction (RT-PCR) 119

Total RNA was isolated from grouper at 40 to 45 days post-hatching using a previously 120

described single-step acid guanidinium thiocyanate-phenol-chloroform extraction method 121

[36]. Extracted cellular total RNA (5 g) as template was incubated at 42 oC for 60 min in 20 122

L of 1X reaction buffer containing 2 U Moloney murine leukemia virus (M-MLV) reverse 123

transcriptase (Promega, Madison, WI, USA), 0.25 mM dNTP and 4 M oligo(dT)15 primer, 124

(8)

and lastly 0.4 U RNase (Boehringer Mannheim Biochemicals, Mannheim, Germany) was 125

added. Putative SPARC sequences were examined for homogeneity by comparison with 126

published SPARC sequences using Blast (http://www.ncbi.nlm.nih.gov/BLAST). In the first 127

experiment, grouper that were naturally infected with nodavirus were obtained at 40 to 45 128

days post-hatching from hatchery farms. Eyes were excised from healthy and nodavirus 129

naturally-infected grouper, and total RNA was extracted for study of SPARC expression.

130

First-strand cDNA was synthesized using total RNA (5 g) and cDNA (250 ng) as a template 131

for PCR. The grouper SPARC nucleotide sequences of forward and reverse primers were:

132

SPARC-RT-S and SPARC-RT-A (Table 1). The sequences were designed to specifically 133

amplify a 911-bp PCR fragment. Grouper -actin gene expression was analyzed as an 134

internal marker using the following primers: -actin-RT-S436 and -actin-RT-A1170 (Table 135

1). PCR was conducted under the following conditions: 94 oC for 1 min, 60 oC for 1 min, and 136

72 oC for 1 min, with 25 cycles; the last cycle was followed by extension for 5 min at 72 oC.

137

The total amount of cDNA was calibrated based on the amplification of -actin cDNA from 138

the same template, and PCR products were analyzed by agarose gel electrophoresis. In the 139

second experiment, real-time RT-PCR was used to quantify the expression of mRNA for 140

SPARC with -actin as control. First-strand cDNA was synthesized using 2 g total RNA and 141

the SuperScript First Strand cDNA synthesis kit (Invitrogen). The amplification was 142

performed using a quantitative PCR (qPCR) core kit for SYBR Green (Qiagen, Valencia, CA, 143

(9)

USA) and Step-One™ Real Time PCR system (Applied Biosystems, Foster City, CA, USA).

144

Typical profile times used were an initial step of 95 °C for 15 min, followed by a second step 145

at 94 °C for 15 sec, 60 °C for 30 sec and 72 °C for 30 sec for 40 cycles with melting curve 146

analysis. After the PCR program, fluorescent real-time PCR data from three replicate samples 147

were analyzed.

148

2.3. Suppression subtractive hybridization 149

cDNA subtraction was performed to generate a subtracted cDNA library between 40 and 45 150

days post-hatching for nodavirus naturally-infected grouper (tester) and healthy grouper 151

(driver) using PCR-Select cDNA subtraction Kit (Clontech, Mountain View, CA, USA) 152

according to the manufacturer’s protocol. Briefly, poly(A+) RNA was extracted using the 153

FastTrack mRNA isolation kit (Clontech). cDNA was synthesized using the SMART

154

PCR cDNA Synthesis Kit (Clontech) according to the manufacturer’s instruction. Tester and 155

driver cDNAs were purified by ethanol precipitation, and then digested with Rsa1 at 37 oC 156

overnight to obtain shorter blunt-ended molecules. Two different adaptors, adaptor 1 and 157

adaptor 2R, were ligated to the 5-end of each strand of tester cDNA, both of which were 158

separately hybridized at 68 oC for 8 h with an excess of driver cDNA after denaturation at 98 159

oC for 90 s. After the first hybridization, the two samples were mixed together without 160

denaturation and hybridized again with freshly heat-denatured driver cDNAs for 18 h at 68 161

oC. The resulting mixture was diluted 1:50, and then amplified by two rounds of PCR to 162

(10)

enrich desired cDNAs containing both adaptors by exponential amplification of these 163

products [37]. Nested PCR amplicons were subcloned into a pGEM-T easy Cloning Kit 164

(Promega). Finally, the efficiency was evaluated by PCR with -actin forward and reverse 165

primers performed on tester (unsubtracted) and subtracted cDNAs for 25 cycles.

166

2.4. Rapid amplification of cDNA ends polymerase chain reaction (RACE-PCR) 167

RACE-PCR was conducted as previously described [38]. Based on the verified sequence of 168

the 1344 bps fragment of SPARC cDNA from the subtracted plasmid library, SPARC- 169

5RACE and SPARC-3RACE primers (Table 1) were applied in PCR amplification and 170

cloning of the cDNA 5’ end and 3’ end, respectively. Two adapter primers for both ends were 171

provided in the Marathon cDNA Amplication Kit (Clontech). The RACE-PCR thermal cycle 172

profile was as follows: 94 oC for 1 min; 94 oC for 30 sec, 72 oC for 4 min, 72 oC for 10 min 173

with 30 cycles; and extension at 72 oC for 10 min. The amplified fragment was verified with 174

subcloning into pCR II vectors for sequencing. To minimize the polymerization errors during 175

PCR, a proofreading polymerase was employed in PCR reactions.

176

2.5. Phylogenetic analysis 177

BLAST searches for amino acid sequence similarities were conducted using programs at the 178

National Center for Biotechnology Information (http://www.ncbi.nlm.gov/BLAST/).

179

Sequence alignments were carried out and the sequence identities were calculated by the 180

MegAlign v7.2.1 program from the LASERGENE software suite (DNASTAR, Madison, WI, 181

(11)

USA). To elucidate the evolutionary history of SPARC, novel SPARC sequences were 182

identified in zebrafish and mammalian species, and used to explore the phylogenetic 183

relationships of the SPARC gene family. A neighbor-joining phylogenetic tree was produced 184

by the MEGA3.1 program [39] on the basis of a ClustalW alignment of the nucleotide 185

sequences of the open-reading frames along with all known complete sequences of SPARC 186

cDNA with the complete deletion of gaps for 1000 bootstrap replications. Numbers indicated 187

bootstrap confidence values through 1000 replications; only bootstrap values over 70% are 188

exhibited.

189

2.6. Real Time RT-PCR 190

Real time RT-PCR was used to quantify the expression of mRNA for SPARC with expression 191

of elongation factor 1  (EF-1) as the reference gene. The grouper SPARC nucleotide 192

sequences of forward and reverse primers were: SPARC-QRT-S, and SPARC-QRT-A, 193

(Table 1). The primers were designed to specifically amplify a 173-bp PCR fragment. The 194

SPARC primer pair used in this experiment was designed to cross intron/exon boundaries as 195

inferred from sequence of grouper SPARC structure. Grouper EF-1 gene expression was 196

analyzed as an internal marker using the following primers: EF-1-QRT-S and EF-1-QRT- 197

A, as shown in Table 1, were designed to specifically amplify a 184-bp PCR fragment. Total 198

RNA was separated from healthy grouper following the single-step acid guanidinium 199

thiocyanate-phenol-chlorofrom extraction method. First-strand cDNA was synthesized using 200

(12)

2 g total RNA and the SuperScript First Strand cDNA synthesis kit (Invitrogen). The 201

amplification was performed using the qPCR core kit for SYBR Green (Qiagen) and 202

StepOne Real Time PCR system (Applied Biosystems). Typical profile times used were an 203

initial step of 95 °C for 15 min, followed by a second step at 94 °C for 15 sec, 60 °C for 30 204

sec and 72 °C for 30 sec for 40 cycles with melting curve analysis. The level of target mRNA 205

was normalized to the level of EF-1 and is expressed as relative to controls (healthy grouper) 206

by the 2-CT method.

207

2.7. Production of purification of SPARC protein 208

The cDNA fragments encoding the putative mature peptide were amplified by PCR, followed 209

by primer pairs SPARC-EX-S and SPARC-EX-A (see Table 1). The fragments were 210

separated on a 1% agarose gel, purified using a gel extraction kit (Qiagen), and digested with 211

restriction enzymes B and H. The digested fragment were inserted into the pET29 expression 212

vector at the EcoRI and XhoI restriction enzymes sites, and the resultant plasmid, pET29- 213

SPARC18-303, was sequenced for confirmation of the SPARC gene sequence. The resultant 214

recombinant protein was named r-SPARC. To allow expression of soluble proteins, the 215

plasmids were transformed into Escherichia coli BL21 (DE3) cells. Induction and 216

purification of the recombinant protein were performed as described previously (40). To 217

eliminate the potential contamination of bacterial endotoxins such as lipopolysaccharide (LPS) 218

during protein preparation, the purified recombinant protein was loaded onto a polymyxin B 219

(13)

column (Sigma-Aldrich, St. Louis, MO, USA) and the collected samples were stored at -80 220

ºC before use. The LPS concentration in the purified proteins was measured using a Pyrogent 221

5000 kit (Cambrex, East Rutherford, NJ, USA), with LPS standards being replaced by a 222

series of dilutions of known LPS concentration. Purity of the rSPARC was checked on by 10- 223

12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel stained 224

with Brilliant Blue, and concentration was measured by comparing the protein band density 225

with a standard protein in the same gel using an Ultra gel imaging system. Western blot 226

analysis was performed to confirm the identity of the r-SPARC using a chromogenic Western 227

blot immunodetection kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s 228

instructions. Penta-His antibody (Ab) (Invitrogen Life Technologies) was used as the primary 229

Ab for Western blot detection.

230

2.8. Production of polyclonal rabbit anti-grouper SPARC antiserum 231

The cDNA for the mature SPARC from amino acids 1–304 of orange-spotted grouper was 232

cloned into pGEM-Tvector (Promega) and subcloned into the pET-29 vector (Novagen, 233

Madison, WI, USA) between the EcoRI and XhoI sites to obtain pET29-SPARC. The 234

resulting expression vector encoded SPARC with a (His)6 and several extra amino acids at the 235

N-terminus. The expression vector pET29-SPARC was transformed into the bacterial host, E.

236

coli BL21 (DE3), for expression driven by T7 polymerase. Induction by 0.5 mM isopropyl-- 237

thiogalactopyranoside was carried out 28 ºC for 3 h. After undergoing freezing and thawing 238

(14)

once, cells were sonicated on ice, and the cleared lysate was obtained by centrifugation at 239

12,000 rpm for 15 min. The (His)6-tagged SPARC was bound to a nickel-charged HisTrap 240

column (HisTrap HP, 5 mL bed volume; Amersham Biosciences, Piscataway, NJ, USA) 241

which was pre-equilibrated with binding buffer, and washed with binding buffer containing 242

50 mM imidazole. The bound SPARC was eluted with binding buffer containing imidazole in 243

a step-gradient manner (100–500 mM). The SPARC protein peaks, eluted with 250–350 mM 244

imidazole, were combined and dialyzed against buffer A (50 mM Tris-HCl, pH 8.0, 1 mM 245

dithiothreitol, 50 mM NaCl, 5 mM MgCl2, 10% glycerol), followed by freezing at -70 ºC in a 246

minimal aliquot. Protein concentrations were determined using a Bio-Rad protein assay kit 247

with bovine serum albumin as standard. To obtain anti-grouper SPARC rabbit polyclonal 248

antibody, (His)6-tagged SPARC was used to immunize two New Zealand white rabbits with a 249

primary injection emulsified in Freund’s incomplete adjuvant at 1 mg ml-1, and 1 ml was 250

injected subcutaneously into two rabbits. The rabbits were boosted after 4, 8, and 12 weeks 251

with the same amount of antigen in the adjuvant. The SPARC antibody was obtained after 252

clotting overnight at 4 ºC followed by centrifugation at 1200 rpm [41].

253

2.9. Immunohistochemical studies of SPARC tissue distribution 254

To study SPARC distribution on grouper tissues, immunohistochemical studies were 255

performed. Grouper at 40-45 days post-hatching were fixed in 10% formalin and embedded 256

in paraffin following a routine procedure. Each 5 μm-thick section was mounted on a 257

(15)

polylysin-coated slide, deparaffinized in xylene, and rehydrated in descending grades (100%–

258

70%) of ethanol. Endogenous peroxidase activity was blocked by 10 min incubation at room 259

temperature with absolute methanol containing 3% hydrogen peroxide. The sections were 260

sequentially blocked with power block solution (Bio Genex, San Ramon, CA, USA), washed 261

with phosphate-buffered saline (PBS) and incubated with polyclonal rabbit anti-grouper 262

SPARC or polyclonal rabbit anti-coat protein Ab (1:500 dilution) at 4 oC overnight. The 263

sections were washed twice with PBS, incubated with secondary Ab (Super Sensitive 264

Polymer-HRP IHC; Bio Genex) for 30 min at room temperature. The peroxidase activity was 265

developed with 3,3’-diaminobenzidine (used as chromogen) for 10 min. The sections were 266

counterstained with Harris hematoxylin for nuclei, dehydrated and mounted. Negative 267

controls were performed with preimmune rabbit serum and incubation with PBS instead of 268

the anti-grouper SPARC Abs. The sections were observed using an Axiovert 40 microscope 269

(Carl Zeiss, Gottingen, Germany). The images were obtained with an SPOT RT3 camera 270

(Diagnostic, Sterling Heights, MI, USA).

271

2.10. Adhesion assay in vitro 272

Grouper GF-1 cells were seeded in a 24-well plate at a density of 104 cells/well. Recombinant 273

SPARC was added immediately to cells in suspension and the cells were monitored hourly by 274

phase contrast microscopy, up to 24 hours. Quantification of cell spreading was performed by 275

calculation of a Rounding Index, as described by Lane and Sage [42]. A score of 3 indicates 276

(16)

rounded cells that have not initiated spreading, whereas a score of 1 indicates fully spread 277

cells.

278 279

(17)

3. Results 280

3.1. Molecular cloning and nucleotide sequencing of grouper SPARC gene 281

From the PCR-based subtracted library, recombinant clones were randomly selected and 282

sequenced. A partial cDNA fragment (approximately 0.8 kb) was identified by sequence 283

analysis and was considered likely to be SPARC. The deduced amino acid sequence showed 284

homology with that of medaka SPARC at the C-terminus [15]. SPARC full-length cDNA was 285

generated by RACE, which was conducted to determine the nucleotide sequence of the 286

grouper SPARC cDNA (Fig. 1A). The complete SPARC cDNA is shown in Fig. 1A. Based on 287

the putative SPARC cDNA sequences obtained by the PCR-based subtracted library, primers 288

for 5 and 3 RACE were designed. The PCR-amplified 5 and 3 UTR cDNAs were used for 289

direct DNA sequencing and/or cloned into a pGEM T Easy vector. Several 5-termini were 290

found, corresponding to alternative transcription sites. A comparison of the cDNA sequence 291

of grouper SPARC with those of the fish SPARC indicated several motifs in grouper SPARC.

292

Analysis of the predicted translation revealed a protein of 52 kDa, with a theoretical signal 293

peptide (residues 1–17). The predicted mature peptide of grouper SPARC contained three 294

functional domains representing conserved human SPARC domains. Domain I was an acidic 295

rich domain (residues 18–73) that represented an acidic region rich in aspartic acid and 296

glutamic acid. The horizontal bar line amino acid sequence (74–154) showed a follistatin-like 297

domain, the characteristic KGHR motif (137–140) was fully conserved in grouper. A 298

(18)

potential glycosylation site (NXT) was found at amino acid position 116–118. Lastly, a 299

potential extracellular calcium binding domain (amino acids 155–303) displayed the highest 300

similarity within teleost species [8, 12]. Transient transfections were performed by 301

introducing g of plasmid encoding grouper SPARC-green fluorescent protein (GFP) 302

fusion protein into cells. Strong fluorescence probably resulting from overexpression was 303

evident in the cytoplasm and also accumulated in the nucleus, with an anti-adhesive effect of 304

SPARC (Fig. 1B). Expression of embryonic chicken SPARC is a negative regulator of 305

cellular adhesion activity [43]. The result was consistent with a common ancestor of all 306

vertebrate SPARCs. Additionally, among the GF-1 cells that had been tested for the 307

production of grouper SPARC-GFP, some recovered supernatant medium contained 308

detectable levels of mature SPARC-GFP when examined by immunoblotting, representing 309

overexpression of grouper SPARC-GFP in grouper cells. Lysates of SPARC-GFP producing 310

grouper cells yielded an immunoreactive band of 60.8 kDa on Western blotting. On the other 311

hand, another immunoreactive band of recombinant grouper SPARC-GFP migrated slightly 312

slower than the 67 kDa band characteristic of cell lysates, a possible consequence of cellular 313

production of N-glycoproteins containing a modification of many carbohydrate chains of 314

SPARC-GFP protein (Fig. 1C). The results provided evidence that grouper SPARC is a 315

secreted protein with high homology between fish and mammalian molecules, suggesting that 316

(19)

all SPARC molecules have a similar modular structure, which includes a signal peptide, 317

acidic rich domain, follistatin-like domain and extracellular calcium binding domain.

318

3.2. Phylogenetic tree analysis 319

SPARC is a secreted protein acid and rich in cysteine that plays important roles in signal 320

transduction networks, cell cycle inhibition and support of cell-matrix interaction [12].

321

SPARC expression is also associated with mineralization and bone remodeling [14]. To 322

elucidate the evolutionary history of SPARC, we identified novel SPARC sequences of 20 323

species across all kingdoms of organisms and all sequences available in GenBank, and 324

explored the phylogenetic relationships of the SPARC gene family.Phylogenetic analysis was 325

conducted by the CLUSTAL X method from a multiple sequence alignment of orange- 326

spotted grouper SPARC gene, and alignment of the amino acid sequences of the open-reading 327

frames along with all known complete sequences of SPARC cDNA (Fig. 2A). As expected, 328

the results indicated the presence of teleost SPARC forming a well-supported clade and 329

separating clades. The phylogenetic tree revealed the relationship between the full-length 330

orange-spotted grouper SPARC amino acid sequence, with other known SPARC orthologous 331

teleost SPARC family members (Fig. 2B).

332

3.3. Grouper SPARC transcript expression in different organs 333

Real time quantitative RT-PCR using SYBR Green dye demonstrated levels of SPARC 334

expression at similar levels in all tissues (Fig. 3A). The SPARC transcript was ubiquitously 335

(20)

expressed in all organs. Staining was visible as a brown granular reaction product with 3, 3’- 336

diaminobenzidine in chromogen solution (DAB) in the muscle and fin. The muscle produced 337

a patchy, focal pattern of SPARC expression. An immunohistochemical (IHC) study 338

indicated that grouper SPARC was highly expressed in liver and bone matrix. However, the 339

IHC-evident expression of SPARC protein decreased during nodavirus infection of grouper 340

(Fig. 3B).

341

3.4. Influence of SPARC expression in response to nodavirus 342

To analyze SPARC expression during nodavirus naturally-infected grouper, total RNA from 343

grouper eye was reverse transcribed and amplified for 25 cycles with the grouper SPARC 344

primers SPARC-RT-S and SPARC-RT-A. Amplification of total eye RNA produced a PCR 345

product of approximately 450 bp (Fig. 4A). The differential expression of SPARC was also 346

examined by real-time qRT-PCR during nodavirus infection (Fig. 4B). Grouper SPARC 347

mRNA levels decreased about 1.5 times that of control levels in eye tissue. The expression of 348

coat protein (CP) was monitored in a nodavirus-infected sample using Western-blot analysis.

349

IHC imaging detected SPARC to a significantly higher degree in the muscle region of healthy 350

grouper rather than the muscle of nodavirus-infected grouper (Figs. 5A and 5B). In contrast 351

to grouper SPARC levels, the levels of myostatin did not change significantly in response to 352

nodavirus infection (Figs. 5C and 5D). Nodavirus CP was demonstrated by IHC in the brain 353

from nodavirus naturally-infected grouper, but not in healthy grouper (Figs. 5E and 5F).

354

(21)

Vacuolization was found in the brain area of nodavirus-infected grouper during the 355

examination of H&E stained sections (Figs. 5G and 5H).

356

3.5. Recombinant grouper SPARC possesses de-adhesive bioactivity for GF-1 in vitro 357

To determine the biological activities of grouper SPARC, the putative mature peptide was 358

expressed as an N-terminal 6-histidine-tagged fusion protein in E. coli cells and purified 359

under native condition by affinity chromatography (Fig. 6A). The recombinant SPARC 360

protein was confirmed by Western blot analysis using a monoclonal Ab against the histidine 361

tag in which a single band was detected (Fig. 6B). The results indicated that expression of 362

SPARC may provide a feasible host-derived factor that regulates cell-matrix interaction.

363

There was a close link between SPARC expression and de-adhesive activity [44]. Presently, 364

recombinant grouper SPARC added to GF-1 cells in suspension, rSPARC (0.5 µg mL-1; Fig.

365

7A-d), rSPARC (1.0 µg mL-1; Fig. 7A-e) and rSPARC (1.5 µg mL-1; Fig. 7A-f), inhibited the 366

spreading on culture plastic in the presence of 5% FBS. Comparing to non-treated samples 367

(Fig. 7A-a), 50 mM imidazole-treated samples (Fig. 7A-b), or bovine serum albumin-treated 368

controls (Fig. 7A-c), this effect was apparent up to 24 h after plating, after which rSPARC 369

treated GF-1 completed de-adhesion. As shown in Fig. 7B, we have confirmed the results that 370

have been mentioned previously and used Rounding Indices to quantified anti-adhesive 371

activity. Cell viability was determined under all conditions shown in Fig. 7C.

372 373

(22)

4. Discussion 375

Expression of SPARC genes has been reported in zebrafish, medaka and gilthead seabream 376

[14–16]. In the present study, the SPARC gene was cloned from orange-spotted grouper (E.

377

coioides) and determined to encode a protein 303 amino acids in length. The cloned grouper 378

SPARC was similar in structure to that of zebrafish, medaka and gilthead seabream. Indeed, 379

the grouper SPARC gene was found to show high homology with teleosts. The phylogenetic 380

tree also indicated that grouper, medaka, fugu and gilthead seabream all belonged to the same 381

cluster, but was distant from mammalian and avian versions. Kawasaki et al [45] previously 382

reported that SPARC may be critical for initial mineralization, a finding that was likely due to 383

phylogenetic analysis of SPARC and SPARCL1 (SPARC-like 1), which provided evidence 384

that secretory calcium-binding phosphoprotein (SCPP) genes arose after the divergence of 385

cartilaginous fish and bony fish, indicating that early vertebrate mineralization did not use 386

SCPPs. Developmental tissue mineralization associated with nodavirus infection is poorly 387

understood, especially pertaining to infection-mediated brain injury.

388

The presently studied SPARC protein has the ability to modulate cell shape and cell 389

adhesion to different substrates, such as fibronectin [46]. The protein possesses highly 390

conserved sequence alignment of grouper SPARC with other known SPARC proteins, 391

especially in the regions of extracellular calcium binding domain. Interestingly, grouper 392

SPARC-GFP fusion protein was evenly spread out across the cytoplasm and nucleus (Fig.

393

(23)

1B). Moreover, homology analysis revealed that it was possible to indicate potential 394

structural and functional features of grouper SPARCs depending on conserved features of the 395

extant SPARC types. Gooden et al. [43] reported that, in embryonic chicken cells, SPARC is 396

expressed at the nuclear matrix during interphase, indicating a potential role of SPARC in the 397

regulation of mitosis during development. Further investigations need to be carried out to 398

determine whether the characteristics of intracellular SPARC protein observed in nodavirus- 399

infected grouper acts on the nuclear translocation of SPARC or on the regulatory network 400

associated with nuclear substrates.

401

When groupers become infected by nodavirus, the virus accumulates in the brain and 402

eyes, and undergoes replication at these two sites. These two sites are, therefore, very 403

important in the study of virus-host interactions. The eye is a very important tissue in the 404

study of virus-induced stress. Our real-time PCR analysis indicated that when groupers were 405

naturally-infected with nodavirus a faint decrease in SPARC transcripts could be discerned in 406

eye tissue. The SPARC expression was consistent with the significant increase in the 407

expression level of grouper SPARC at 12, 24 and 48 h post nodavirus infection when 408

compared to the control results (Fig. 3). The molecular mechanism of SPARC reduction and 409

the role of grouper SPARC during nodavirus infection remain to be elucidated. In humans, 410

the ability of virus to generate reactive oxygen species (ROS) or reactive nitrogen species 411

from phagocytes are evidence of the considerable host cell stress inflicted by viral infection 412

(24)

[47]. It is possible that generation of ROS has an antiviral effect on cells, but that this is also 413

damaging to the host cells, giving rise to a large amount of denatured protein. In view of 414

nodavirus infection and subsequent ROS production, aggregation of misfolding proteins in 415

the host cell may lead to stress status. The SPARC expression is considered to be associated 416

with a protective mechanism in the lens, whereby SPARCs possess the necessary chaperone- 417

like machinery to refold into their original structure under physiologically relevant stress 418

conditions including down-regulation of focal adhesions and reduced phosphorylation of 419

focal adhesion protein [48].

420

Experiments in vitro provided evidences that SPARC could disrupt cell adhesion [49] and 421

inhibit cell spreading [50] through a possible tyrosine phosphorylation-dependent pathway 422

[51]. SPARC also induces extracellular matrix and matrix metalloprotease production, 423

therefore, it regulates the connection of cell and matrix and finally, it makes changes in cell 424

morphology and cell migration [21, 22]. In addition, alignment of deduced grouper SPARC 425

amino acid sequence with those in various species, it is highly conserved among them (Fig.

426

2A). Therefore, recombinant grouper SPARC has been successfully produced previously 427

using either eukaryotic system or in vitro translation. It has been proven that recombinant 428

human SPARC expressed in E. coli exhibits biological characteristics including cellular anti- 429

adhesion assays [52]. Thus, protein glycosylation may be not essential for the biological 430

activity of grouper SPARC. In the current study, we produced recombinant grouper SPARC 431

(25)

with an E. coli expression system, and the results corroborated the anti-adhesion activity. In 432

addition, the expression level of SPARC in the fish tissue that contacts external environments 433

such as eye, gill and intestine is higher than other tissues because those tissues are more 434

prone to injury and require more SPARC protein to repair the damage. Socha et al [53]

435

demonstrated that the increased fibroblasts SPARC levels have been involved in the 436

pathogenesis of fibrosis and chronic tubulointerstitial disease. In addition, SPARC not only 437

binds to collagen, but also regulates extracellular matrix deposition through mediation 438

cellular matrix metalloproteinases [54]. The investigation explains about the precise grouper 439

SPARC mediates a change in cell shape from a spread to rounded morphology during 440

nodavirus-infected grouper biologically. Moreover, little is known about the role of grouper 441

SPARC in influencing leukocyte migration, injury or the inflammatory response. SPARC 442

shares some functions with matricellular protein with respect to collagen fibrillogenesis [46].

443

Matricellular protein is with anti-adhesive properties and with a pattern of expression similar 444

to that grouper SPARC. Sangaletti et al. [25] demonstrated that the absence of SPARC is 445

associated with a defect in collagen type IV deposition in newly formed basement membrane- 446

like structures which present lobular carcinoma. In general, newly formed or remodeled 447

matrix is less structured and then easier to degrade and more accessible to leukocyte 448

migration in the absence of SPARC. Additionally, in SPARC null-mice, neutrophil 449

accumulation has been associated with acute pulmonary inflammation [24]. Hence, grouper 450

(26)

SPARC may play a causal role in invading pathogens infection from repairing immune 451

system damage.

452 453

(27)

Acknowledgements 454

We thank Dr. Brian D. Hoyle for editing the manuscript. This research was supported by the 455

National Science and Technology Program for Agricultural Biotechnology, Council 456

of Agriculture (97AS-1.2.1-ST-a3(23)), and National Science Council (NSC96-2317-B-006- 457

002), and the Landmark Project (B0127) of National Cheng Kung University, the plan of 458

University Advancement, Ministry of Education.

459 460

(28)

References 461

[1] Murphy-Ullrich JE. The de-adhesive activity of matricellular proteins: is intermediate of 462

cell adhesion an adaptive state? J Clin Invest 2001;107:785–90.

463

[2] Motamed K, Blake DJ, Angello JC, Allen BL, Rapraeger AC, Hauschka SD, Sage EH.

464

Fibroblast growth factor receptor-1 mediates the inhibition of endothelial cell 465

proliferation and the promotion of skeletal myoblast differentiation by SPARC: a role for 466

protein kinase A. J Cell Biochem 2003;90:408–23.

467

[3] Sage H, Bornstein P. Extracellular protein that modulate cell-matrix interaction. SPARC, 468

tenascin, and thrombospondin. J Biol Chem 1991;266:14831–4.

469

[4] Bradshaw AD, Sage EH. SPARC, a matricellular protein that functions in cellular 470

differentiation and tissue response to injury. J Clin Invest 2001;107:1049–54.

471

[5] Termine JD, Kleinman HK, Whitson SW, Conn KM, McGarvey ML, Martin GR.

472

Osteonectin, a bone-specific protein linking mineral to collagen. Cell 1981;26:99–105.

473

[6] Funk SE, Sage EH. Differential effects of SPARC and cationic SPARC peptides on DNA 474

synthesis by endothelial cells and fibroblasts. J Cell Physiol 1993;154:53–63.

475

[7] Barker TH, Baneyx G, Cardo-Vila M, Workman GA, Weaver M, Menon PM, Dedhar S, 476

Rempel SA, Arap W, Pasqualini R, Vogel V, Sage EH. SPARC regulates extracellular 477

matrix organization through its modulation of integrin-linked kinase activity. J Biol Chem 478

2005;280:36483–93.

479

(29)

[8] Brekken RA, Sage EH. SPARC, a matricellular protein: at the crossroads of cell-matrix.

480

Matrix Biol 200;19:569–80.

481

[9] Hasselaar P, Sage EH. SPARC antagonizes the effect of basic fibroblast growth factor on 482

the migration of bovine aortic endothelial cells. J Cell Biochem 1992;49:272–83.

483

[10] Motamed K, Funk SE, Koyama H, Ross R, Raines EW, Sage EH. Inhibition of PDGF- 484

stimulated and matrix-mediated proliferation of human vascular smooth muscle cells by 485

SPARC is independent of changes in cell shape or cyclin-dependent kinase inhibitors. J 486

Cell Biochem 2002;84:759–71.

487

[11] Yunker CK, Golembieski W, Lemke N, Schultz CR, Cazacu S, Brodie C, Rempel SA.

488

SPARC-induced increase in glioma matrix and decrease in vascularity are associated 489

with reduced VEGF expression and secretion. Int J Cancer 2008;122:2735–43.

490

[12] Yan Q, Sage EH. SPARC, a matricellular glycoprotein with important biological 491

functions. J Histochem Cytochem 1999;47:1495–505.

492

[13] Sage H, Johnson C, Bornstein P. Characterization of a novel serum albumin-binding 493

glycoprotein secreted by endothelial cells in culture. J Biol Chem 1984;259:3993–4007.

494

[14] Kawasaki K, Suzuki T, Weiss KM. Genetic basis for the evolution of vertebrate 495

mineralized tissue. Proc Natl Acad Sci USA 2004;101:11356–61.

496

[15] Renn J, Schaedel M, Volff J-N, Goerlich R, Schartl M, Winkler C. Dynamic expression 497

of sparc precedes formation of skeletal elements in the Medaka (Oryzias latipes). Gene 498

(30)

2006;372:208–18.

499

[16] Redruello B, Estevao MD, Rotllant J, Guerreiro PM, Anjos LI, Canario AVM, Power 500

DM. Isolation and characterization of piscine osteonectin and downregulation of its 501

expression by PTH-related protein. J Bone Miner Res 2005;20:682–92.

502

[17] Mori K, Nakai T, Muroga K, Arimoto M, Mushiake K, Furusawa I. Properties of a new 503

virus belongs to nodaviridae found in larval striped jack (Pseudocaranx dentex) with 504

nervous necrosis. Virology 1992;187:368–71.

505

[18] Munday BL, Nakai T. Special topic review: nodaviruses as pathogens in larval and 506

juvenile marine finfish. World J Microbiol Biotechnol 1997;13:375–81.

507

[19] LeBlanc F, Laflamme M, Gagne N. Genetic markers of the immune response of Atlantic 508

salmon (Salmo salar) to infectious salmon anemia virus (ISAV). Fish Shellfish Immunol 509

2010;29:217–32.

510

[20] Chambrion C, Le Naour F. The tetraspanins CD9 and CD81 regulate CD9P1-induced 511

effects on cell migration. PLoS one 2010;5:e11219.

512

[21] Tremble PM, Lane TF, Sage EH, Werb Z. SPARC, a secreted protein associated with 513

morphogenesis and tissue remodeling, induces expression of metalloproteinases in 514

fibroblasts through a novel extracellular matrix-dependent pathway. J Cell Biol 515

1993;121:1433–44.

516

(31)

[22] Hasselaar P, Loskutoff DJ, Sawdey M, Sage EH. SPARC induces the expression of type 517

I plasminogen activator inhibitor in cultured bovine aortic endothelial cells. J Biol Chem 518

1991;266:13178–84.

519

[23] Hotary KB, Allen ED, Brooks PC, Datta NS, Long MW, Weiss SJ. Membrane type I 520

matrix metalloproteinase usurps tumor growth control imposed by the three-dimensional 521

extracellular matrix. Cell 2003;114:33–45.

522

[24] Savani RC, Zhou Z, Arguiri E, Wang S, Vu D, Howe CC, DeLisser HM. Bleomycin- 523

induced pulmonary injury inmice deficient in SPARC. Am J Physiol Lung Cell Mol 524

Physiol 2000;279:L743–L750.

525

[25] Sangaletti S, Stoppacciaro A, Guiducci C, Torrisi MR, Colombo MP. Leukocyte, rather 526

than tumor-produced SPARC, determines stroma and collagen type IV deposition in 527

mammary carcinoma. J Exp Med 2003;198:1475–85.

528

[26] Yan Q, Blake D, Clark JI, Sage EH. Expression of the matricellular protein SPARC in 529

murine lens: SPARC is a necessary for the structural integrity of the capsular basement 530

membrane. J Histochem Cytochem 2003;51:503–11.

531

[27] Sangaletti S, Gioiosa L, Guiducci C, Rotta G, Rescigno M, Stoppacciaro A, Chiodoni C, 532

Colombo MP. Accelerated dendritic-cell migration and T-cell priming in SPARC- 533

deficient mice. J Cell Sci 2005;118:3685–94.

534

[28] Kang YJ, Stevenson AK, Yau PM, Kollmar R. SPARC protein is required for normal 535

(32)

growth of zebrafish otoliths. J Assoc Res Otolaryngol 2008;9:436–51.

536

[29] Bradshaw AD, Graves DC, Motamed K, Sage EH. SPARC-null mice exhibit increased 537

adiposity without significant differences in overall body weight. Proc Natl Acad Sci 538

USA 2003;100:6045–50.

539

[30] Atorrasagasti C, Malvicini M, Aquino JB, Alaniz L, Garcia M, Bolontrade M, et al.

540

Overexpression of SPARC obliterates the in vivo tumorigenicity of human hepatocellular 541

carcinoma cells. Int J Cancer 2009;126:2726–40.

542

[31] Said N, Motamed K. Absence of host secreted protein acidic and rich in cysteine 543

(SPARC) augments peritoneal ovarian carcinomatosis. Am J Pathol 2005;167:1739–52.

544

[32] Montes A, Figueras A, Novoa B. Nodavirus encephalopathy in turbot (Scophthalmus 545

maximus): Inflammation, nitric oxide production and effect of anti-inflammatory 546

compounds. Fish Shellfish Immunol 2010;28:281–8.

547

[33] Poisa-Beiro L, Dios S, Ahmed H, Vasta GR, Martinez-Lopez A, Estepa A, Alonso- 548

Gutierrez J, Figueras A, Novoa B. Nodavirus infection of sea bass (Dicentrarchus labrax) 549

induces up-regulation of galectin-1 expression with potential anti-inflammatory activity.

550

J Immunol. 2009;183:6600–11.

551

[34] Dios S, Poisa-Beiro L, Figueras A, Novoa B. Suppression subtraction hybridization 552

(SSH) and macroarray techniques reveal differential gene expression profiles in brain of 553

sea bream infected with nodavirus. Mol Immunol 2007;44:2195–204.

554

(33)

[35] Chi SC, Hu WW, Lo BJ. Establishment and characterization of a continuous cell line 555

(GF-1) derived from grouper, Epinephelus coioides (Hamilton): a cell line susceptible to 556

grouper nervous necrosis virus (GNNV). J Fish Dis 1999;22:173–82.

557

[36] Chomezynski P, Sacchi N. Single-step method of RNA isolation by acid 558

guanidiniumthiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156–9.

559

[37] Chen YM, Su YL, Lin HY, Yang HL, Chen TY. Cloning of an orange-spotted grouper 560

Mx cDNA and characterization of its expression in response to nodavirus. Fish Shellfish 561

Immunol 2006;20:58–71.

562

[38] Frohman MA, Dush MK, Martin GR. Rapid production of full-length cDNA from rare 563

transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl 564

Acad Sci USA 1988;85:8998–9002.

565

[39] Kumar S, Tamura K, Nei M. Integrated software for molecular evolutionary genetics 566

analysis and sequence alignment. Bioinformatics 1994;5:150–63.

567

[40] Chen YM, Wei CY, Chien CH, Chang HW, Huang SI, Yang HL, Chen TY. Myostatin 568

gene organization and nodavirus-influenced expression in orange-spotted grouper 569

(Epinephelus coioides). Comp Biochem Physiol D 2007;2:215–27.

570

[41] Chen YM, Su YL, Lin HY, Shie PS, Huang SL, Yang HL, Chen TY. Grouper Mx 571

confers resistance to nodavirus and interacts with coat protein. Dev Comp Immunol 572

2008;32:825–36.

573

(34)

[42] Lane TF, Sage EH. Functional mapping of SPARC: peptides from two distinct Ca – 574

binding sites modulate cell shape. J Cell Biol 1990;111:3065–76.

575

[43] Gooden MD, Vernon RB, Bassuk JA, Sage EH. Cell cycle-dependend nuclear location 576

of the matricellular protein SPARC: association with the nuclear matrix. J Cell Biochem 577

1999;74:152–67.

578

[44] Girard JP, Springer TA. Modulation of endothelial cell adhesion by hevin, an acidic 579

protein associated with high endothelial venules. J Biol Chem 1996;271:4511–17.

580

[45] Kawasaki K, Buchanan AV, Weiss KM. Gene duplication and the evolution ofvertebrate 581

skeletal mineralization. Cells Tissues Organs 2007;186:7–24.

582

[46] Kamihangi K, Katayama M, Ouchi R, Kato I. Osteonectin/SPARC regulates cellular 583

secretion rates of fibronectin and laminin extracellular matrix proteins. Biochem Biophys 584

Res Commun 1994;200:423–8.

585

[47] Schwarz KB. Oxidative stress during viral infection: a review. Free Radic Biol Med 586

1996;21:641–9.

587

[48] Emerson RO, Sage EH, Ghosh JG, Clark JI. Chaperone-like activity revealed in the 588

matricellular protein SPARC. J Cell Biochem 2006;98:701–5.

589

[49] Murphy-Ullrich JE, Lane TF, Pallero MA, Sage EH. SPARC mediates focal adhesion 590

disassembly in endothelial cells through a follistatin-like region and the calcium-binding 591

EF-hand. J Cell Biochem 1995;57:341–50.

592

(35)

[50] Lane TF, Iruela-Arispeg ML, Sage EH. Regulation of gene expression by SPARC during 593

angiogenesis in vitro. Changes in fibronectin, thrombospondin-1, and plasminogen 594

activator inhibitor-1. J Biol Chem 1992;267:16736–45.

595

[51] Motamed K, Sage EH. SPARC inhibits endothelial cell adhesion but not proliferation 596

through a tyrosine phosphorylation-dependent pathway. J Cell Biochem 1998;70:543–52.

597

[52] Bassuk JA, Baneyx F, Vernon RB, Funk SE, Sage EH. Expression of biologically active 598

human SPARC in Escherichia coli. Arch Biochem Biophys 1996;325:8–19.

599

[53] Socha MJ, Manhiani M, Said N, Imig JD, Motamed K. Secreted protein acidic and rich 600

in cysteine deficiency ameliorates renal inflammation and fibrosis in angiotensin 601

hypertension. Am J Pathol 2007;171:1104–12.

602

[54] Francki A, Sage EH. SPARC and the kidney glomerulus: matricellular proteins exhibit 603

diverse functions under normal and pathological conditions. Trends Cardiovasc Med 604

2001;11:32–7.

605 606

(36)

Figure Legends 607

Fig. 1. Characterization of a grouper SPARC. (A) The complete nucleotide and deduced 608

amino acid sequences of the grouper E. coioides SPARC gene. The dotted line indicates a 609

potential signal peptide sequence (amino acids 1–17). The underlined amino acid sequence 610

(18–73) represents an acidic region rich in aspartic acid and glutamic acid. The horizontal bar 611

line depicts the amino acid sequence (74–154) showing a follistatin-like domain. Potential 612

extracellular calcium binding domain is denoted by the marked line (amino acids 155–303).

613

Conserved cysteine residues on grouper SPARC are in boxes. The stop (TGA) codon is 614

indicated with a dot. The positions of deduced amino acids are indicated in bold numbers.

615

This nucleotide sequence data reported in this paper have been submitted to the GenBank 616

nucleotide sequence databases and have been assigned the accession no. HM855206. (B) 617

Detection of the transiently expressed grouper SPARC protein in grouper cells. Visualized 618

fluorescence of cells after transfection with pcDNA3.1/SPARC-EGFP expression plasmid.

619

Intracellular localization of GFP-fusion protein was examined by microscopy. (C) The 620

detection of secreted SPARC protein expression of grouper cells by Western blotting. Cell 621

lysates from GF-1 grouper cells were transiently transfected with pcDNA3.1/EGFP, lane1, 622

and pcDNA3.1/SPARC-EGFP, lane3, respectively. After 3–4 days of incubation, the culture 623

supernatant from transfected cells, lane 4 pcDNA3.1/SPARC-EGFP (or from control, lane2 624

pcDNA3.1/EGFP) was centrifuged and the supernatant was frozen at -80 ºC. Protein from 625

(37)

cell lysates and culture supernatants were separated by SDS-PAGE and secreted SPARC- 626

EGFP fusion protein detected by anti-SPARC antibody of Western blotting. The arrows 627

indicate the full-length fusion protein and the main glycoprotein products. Molecular mass 628

standards are shown on the left in kDa.

629 630

Fig. 2. Functional domains in human SPARC are conserved in grouper. (A) Sequence 631

alignment of SPARC proteins. The domains used for prediction according to the human 632

SPARC protein [12]. Identical amino-acids are represented by asterisks. The conservative 633

amino-acids are indicated by colons and semi-conservative substitution amino-acids are 634

depicted by dots. (B) Phylogenetic tree showing the relationships among SPARC family of 635

different organisms. The tree is based on an alignment corresponding to the open-reading 636

frames of the SPARC sequences. The numbers on the branches are bootstrap values. The 637

GenBank accession codes of the sequence designations. Homo sapiens, NM_003118; Bos 638

taurus, J03233; Sus scrofa, AY963262; Rattus norvegicus, Y13714; Mus musculus, 639

NM_009242; Gallus gallus, NM_204410; Coturnix japonica, M61908; Coturnix coturnix, 640

AF077327; Rana catesbeiana, AB116365; Xenopus laevis, BC054150; Xenopus tropicalis, 641

AY575077; Danio rerio, AY575072; Oncorhynchus mykiss, U25721; Oryzias latipes, 642

AY575076; Epinephelus coioides, HM855206; Takifugu rubripes, AY575073; Sparus 643

aurata, AJ564190; Caenorhabditis elegans, L21758; Drosophila melanogaster, NM_143252;

644

(38)

and Artemia franciscana, AB052961; Only bootstrap values higher than 70% was used on 645

each branch. The scale for branch length (0.1 substitutions/site) is shown below the tree.

646 647

Fig. 3. Expression levels of SPARC transcript in different organs of grouper. (A) 648

Relative expression levels of SPARC in different tissues from orange-spotted grouper, 649

Epinephelus coioides. (B) Representative IHC image of the orange-spotted grouper, 40–45 650

days post-hatching healthy grouper and nodavirus experimentally-infected grouper section 651

following IHC staining using an anti-grouper SPARC Ab (original magnification 10).

652 653

Fig. 4. Analysis of grouper SPARC expression during nodavirus infection. (A) Ethidium 654

bromide-stained gels demonstrate amounts of amplified grouper SPARC in nodavirus 655

naturally-infected eye tissue and a comparison with healthy grouper eye tissue at the 656

indicated number of cycles (three fish per group). Ethidium bromide-stained gel showing 657

amplification of grouper -actin gene expression was as an internal control to ensure that 658

equal amounts of mRNA were present in each experiment. Nodavirus RNA2 served as a 659

positive control since it is present in nodavirus naturally-infected grouper. The primers 5' 660

TTCAGCCAATGTGCCCCGC 3' and 5' TACACRGCACGGTCRACRTC 3' were used to 661

detect nodavirus RNA2. (B) The level of expression was calculated relative to the ef-1 alpha 662

expression level. Data represent the mean ± standard deviation of results for three fish.

663

(39)

664

Fig. 5. The expression pattern of SPARC, myostatin, and nodavirus coat protein in 665

nodavirus-infected grouper compared with healthy grouper. Histological sections of 666

muscle tissues from grouper with pathological changes that could be attributed to nodavirus, 667

immunohistochemistry for SPARC (A, B), Myostatin (C, D), nodavirus coat protein (E, F), 668

and staining with H&E (G, H).

669 670

Fig. 6. Production and purification of grouper recombinant SPARC (rSPARC) in E. coli.

671

The plasmid pET29-SPARC expressing the putative mature SPARC was transformed into E.

672

coli BL21(DE3) cells, and production of rSPARC was induced by isopropyl β–D- 673

thiogalactoside. Bacterial lysate or purified rSPARC was separated by 10-12% SDS-PAGE 674

under denaturing condition and confirmed by Western blot analysis. (A) Lanes 1–3, lysate 675

from uninduced cells, lysate from isopropyl β–D-thiogalactoside-induced cells, and purified 676

rSPARC. (B) Lane 1, 100 ng of purified rSPARC detected by Western blot analysis using a 677

mAb against the histidine tag.

678 679

Fig. 7. Soluble recombinant SPARC inhibits spreading for GF-1 in vitro. (A) Soluble 680

recombinant SPARC is anti-adhesive for GF-1 in vitro. Recombinant SPARC (rSPARC) (a) 681

0 µg mL-1, (b) 50 mM imidazole, (c) Bovine serum albumin 0.5 µg µL-1 (Control cells plated 682

(40)

without exogenous r-SPARC), (d) rSPARC 0.5 µg mL-1, (e) rSPARC 1.0 µg mL-1, (f) 683

rSPARC 1.5 µg mL-1. The purified rSPARC was added immediately to cells in suspension, 684

and the cells were monitored 24 hours by phase-contrast microscopy (Magnification×200). (B) 685

Inhibition of cell adhesion by rSPARC. Cells were scored for degree of cell spreading based 686

on Lane and Sage (42). (C) Cells viability was determined using the MTT assay.

687

(41)

Table 1. Position and sequence of synthetic oligonucleotide primers.

Name Location Sequence 5’ to 3’ Direction

SPARC-RT-S 531–553 CCTGCGTGGACTCTGAGCTCAA Forward SPARC -RT-A 981–958 TCAGATGATGAGGTCTTTGTCCA Reverse SPARC -5RACE-SP1 535–515 GCAGGGCTCGATGAATTTGCA Reverse

SPARC -5RACE-SP2 500–477 CCAGGTGCAGCTTGTGGCCCTTCT Reverse SPARC -3RACE-SP1 738–761 ACTACAACATGTACATCTTCCCCG Forward SPARC -3RACE-SP2 781–800 AGCTCGACCAGCACCCCGTTG Forward SPARC -QRT-S 71–93 ATGAGGGTGTGGATTGTCTTCCT Forward SPARC -QRT-A 243–221 TCGATGGCCTCGTCAAACTCTCC Reverse

EF-1-QRT-S ACCGCTCACATTGCTTGCA Forward

EF-1-QRT-A CAGCGAAGCGACCCAGTGGA Reverse

-ACTIN-QRT-S 527–554 TGCCTCTGGTCGTACCACTGGTATTGTC Forward

-ACTIN-QRT-A 791–768 GGCAGCAGTGCCCATCTCCTGCTC Reverse

-ACTIN-RT-S436 437–459 AGCCAACAGGGAGAAGATGACCC Forward

-ACTN-RT-A1170 1170–1151 TGATCCACATCTGCTGGAAG Reverse SPARC-EX-S 122–142 GCGCCGGAATTCCGCTCCTACTGAGGAGGAGCCC Forward

SPARC-EX-A 979–957 GCGCCGCTCGAGGATGATGAGGTCTTTGTCCACGT Reverse

The orientation is indicated as sense (S) and antisense (A). Nucleotide location of the SPARC and -ACTIN primers in DNA is according to Fig.

1. and GenBank nucleotide sequence databases FJ644278, respectively.

(42)

Figure 1

(43)

Figure 2

(44)

Figure 3

(45)

Figure 4

(46)

Figure 5

(47)

Figure 6

(48)

Figure 7

參考文獻

相關文件

(1) Western musical terms and names of composers commonly used in the teaching of Music are included in this glossary.. (2) The Western musical terms and names of composers

Therefore, it is our policy that no Managers/staff shall solicit or accept gifts, money or any other form of advantages in their course of duty respectively without the

Wang, Solving pseudomonotone variational inequalities and pseudocon- vex optimization problems using the projection neural network, IEEE Transactions on Neural Networks 17

For example, Liu, Zhang and Wang [5] extended a class of merit functions proposed in [6] to the SCCP, Kong, Tuncel and Xiu [7] studied the extension of the implicit Lagrangian

In summary, the main contribution of this paper is to propose a new family of smoothing functions and correct a flaw in an algorithm studied in [13], which is used to guarantee

dimensional nanomaterials for photodetectors with ultrahigh gain and wide spectral response. II.  Photon down conversion and light trapping in hybrid ZnS nanopartcles/Si

Define instead the imaginary.. potential, magnetic field, lattice…) Dirac-BdG Hamiltonian:. with small, and matrix

Specifically, in Section 3, we present a smoothing function of the generalized FB function, and studied some of its favorable properties, including the Jacobian consistency property;