LecRKs contain extracellular lectin domain, transmembrane domain, and
intracellular kinase domain (Bouwmeester and Govers 2009, Senchou et al. 2004). The
extracellular lectin domain is suggested to be critical for monosaccharide binding or
ligand binding and then trigger the downstream signals (Vaid, Macovei and Tuteja
2013). LecRK-I.9 can bind to extracellular ATP and is required for the ATP-induced
calcium response, mitogen-activated protein kinase activation, and gene expression
(Cao, Tanaka, Nguyen and Stacey 2014, Choi, Tanaka, Cao, Qi, Qiu, Liang, Lee and
Stacey 2014). From previous studies, the extracellular domain of BAK1 and FLS2
interactions can proceed independently of intracellular domain interactions upon the
perception of flg22 (Koller and Bent 2014). The extracellular domains of FLS2 and
BAK1 are important for defense signaling activation independently of intracellular
kinase domain. So we proposed that the extracellular domain of LecRK-V.2 and
LecRK-VII.1 may play the key role in the perception of flg22 together with FLS2. We
can try to isolate only both LecRKs kinase domains and check their sensing of flg22
will be affected or not.
Upon perception of flg22, BIK1 is phosphorylated and dissociates from the
FLS2/BAK1 complex. Then BIK1 phosphorylates the NADPH oxidase, RbohD, at
specific sites in a calcium-independent manner to enhance ROS generation to trigger
plant immunity against pathogens (Kadota, Sklenar, Derbyshire, Stransfeld, Asai,
Ntoukakis, Jones, Shirasu, Menke, Jones and Zipfel 2014, Laluk, Luo, Chai, Dhawan,
Lai and Mengiste 2011, Li, Li, Yu, Zhou, Liang, Liu, Cai, Gao, Zhang, Wang, Chen
and Zhou 2014). Besides, BAK1 can unidirectionally phosphorylate BIR2 and
negatively regulate MTI (Blaum, Mazzotta, Noldeke, Halter, Madlung, Kemmerling
and Stehle 2014, Halter, Imkampe, Mazzotta, Wierzba, Postel, Bucherl, Kiefer, Stahl,
Chinchilla, Wang, Nurnberger, Zipfel, Clouse, Borst, Boeren, de Vries, Tax and
Kemmerling 2014). It was found that both LecRKs can directly interact with FLS2
after the treatment of flg22. Both LecRKs can interact with BAK1, and both LecRKs
were involved in stomatal immunity. Hence, both LecRKs may be involved in the
phosphorylated modification between FLS2, BAK1, and BIK1, and then affect
stomatal closure. It would be interesting to perform the kinase assay to clarify the
phosphorylated modification between FLS2, BAK1, and both LecRKs. This should
help to understand the functional relationships between members of the FLS2 complex
during stomatal immunity.
Figures
Figure 1：FLS2 associate with LecRK-V.2 and LecRK-VII.1 when analyzed by
co-immunoprecipitation in Arabidopsis protoplasts.
FLS2-HA was co-transformed with BAK1-GFP, LecRK-V.2-GFP, LecRK-VII.1-GFP,
GFP empty vector, and RCI2B-GFP into Arabidopsis protoplasts. Total proteins
(Input) were subjected to immunoprecipitation (IP) with GFP-Trap beads followed by
immunoblot analysis with anti-HA to detect FLS2-HA. EV-GFP and RCI2B-GFP were
used as negative control to confirm that FLS2-HA did not stick to GFP beads or
associate with GFP at the plasma membrane. The protoplasts were treated with or
without 1 μM flg22 for 10 minutes. Experiments were repeated three times with the
similar results.
Figure 2：In vitro FLS2 direct interaction with LecRK-VII.1 kinase domains but
not LecRK-V.2.
Yeast two-hybrid assays with the kinase domains of FLS2, LecRK-V.2, and
LecRK-VII.1. Three consecutive dilutions on selection media lacking the amino acids
leucine, tryptophan, histidine and adenine are shown; growth on medium lacking
leucine and tryptophan assures proper growth of transformed yeast. For the selection of
the interacted yeasts, we use the selective dropout media lacking the amino acids
leucine, tryptophan, and histidine but containing 5 mM, and 15 mM 3-aminotriazole
(3-AT); and the selective dropout media lacking the amino acids leucine, tryptophan,
histidine and adenine but containing X-α-Gal. These experiments were repeated three
times with the similar results.
Figure 3：BAK1 associates with LecRK-V.2 and LecRK-VII.1 when analyzed by
co-immunoprecipitation in Arabidopsis protoplasts.
BAK1-HA was co-transformed with LecRK-V.2-GFP, LecRK-VII.1-GFP, GFP empty
vector, and RCI2B into Arabidopsis protoplasts. Total proteins (Input) were subjected
to immunoprecipitation (IP) with GFP-Trap beads followed by immunoblot analysis
with anti-HA to detect BAK1-HA. EV-GFP and RCI2B-GFP were used as negative
control to confirm that BAK1-HA did not stick to GFP beads or associate with GFP at
minutes. EV, empty vector. Experiments were repeated three times with the similar
results.
Figure 4：BAK1 can directly interact with LecRK-V.2 and LecRK-VII.1 through
its kinase domain.
Yeast two-hybrid assays with the kinase domains of BAK1, LecRK-V.2, and
LecRK-VII.1. Three consecutive dilutions on selection media lacking the amino acids
leucine, tryptophan, histidine and adenine are shown; growth on medium lacking
leucine and tryptophan assures proper growth of transformed yeast. For the selection of
the interacted yeasts, we use the selective dropout media lacking the amino acids
leucine, tryptophan, and histidine but containing 5 mM, and 15 mM 3-aminotriazole
(3-AT) are shown; the selective dropout media lacking the amino acids leucine,
tryptophan, histidine and adenine but containing X-α-Gal. These experiments were
repeated three times with the similar results.
Figure 5： Co-immunoprecipitation analyses of LecRK-V.2 association with
LecRK-VII.1 in Arabidopsis protoplasts.
LecRK-V.2-HA was co-transformed with LecRK-VII.1-GFP, GFP empty vector, and
RCI2B-GFP into Arabidopsis protoplasts. Total proteins (Input) were subjected to
immunoprecipitation (IP) with GFP-Trap beads followed by immunoblot analysis with
anti-HA to detect LecRK-V.2-HA. EV-GFP and RCI2B-GFP were used as negative
control to confirm that LecRK-V.2-HA did not stick to GFP beads or associate with
GFP at the plasma membrane. The protoplasts were treated with or without 1 μM flg22
for 10 minutes. EV, empty vector. Experiments were repeated three times with the
similar results.
Figure 6： LecRK-V.2 cannot directly interact with LecRK-VII.1 through their
kinase domain when analyzed with the yeast two hybrid assay.
Yeast two-hybrid assays with the kinase domains of LecRK-V.2 and LecRK-VII.1.
Three consecutive dilutions on selection media lacking the amino acids leucine,
tryptophan, histidine and adenine are shown; growth on medium lacking leucine and
tryptophan assures proper growth of transformed yeast. For the selection of the
interacted yeasts, we use the selective dropout media lacking the amino acids leucine,
tryptophan, and histidine but containing 5 mM, and 15 mM 3-aminotriazole (3-AT) are
shown; the selective dropout media lacking the amino acids leucine, tryptophan,
histidine and adenine but containing X-α-Gal. These experiments were repeated three
times with the similar results.
Figure 7： FLS2 associates with BAK1 and LecRK-VII.1 in the lecrk-V.2 mutant
background.
FLS2-HA was co-transformed with BAK1-GFP and LecRK-VII.1-GFP into
Arabidopsis protoplasts. Immunoprecipitation was conducted against anti-GFP
antibodies to immunoprecipitate the FLS2 proteins and immunoblot analyses were
performed with anti-GFP and anti-HA antibodies. The protoplasts were treated with or
without 1 μM flg22 for 10 minutes. Experiments were repeated three times with the
similar results.
Figure 8： FLS2 associates with BAK1 and LecRK-V.2 in the lecrk-VII.1 mutant
background.
FLS2-HA was co-transformed with BAK1-GFP and LecRK-V.2-GFP into Arabidopsis
protoplasts. Immunoprecipitation was conducted against anti-GFP antibodies to pull
down the FLS2 proteins and western blot analyses were performed with anti-GFP and
anti-HA antibodies. The protoplasts were treated with or without 1 μM flg22 for 10
minutes. Experiments were repeated three times with the similar results.
Figure 9：Proposed model
LecRK-V.2 and LecRK-VII.1 can associate with BAK1 and FLS2 before the treatment
of flg22. Upon the perception of flg22, both LecRKs and BAK1 can interact and
associate with FLS2 and form the immune-complex.
Tables
Table 1 ：Primers for kinase domain constructs
Gene Primers Sequence (5’ - 3’)
FLS2 FLS2 KD Fp CACCTTACCGGATTTGGAT
FLS2 FLS2 KD Rp CTAAACTTCTCGATCCTCGTTACG
BAK1 BAK1 KD Fp CACCCCTACACCGCCAT
BAK1 BAK1 KD Rp TTATCTTGGACCCGAGGGG
LecRK-V.2 LecRK-V.2-KD Fp GGATCCTTGAAGAGGAAGAAGTT
LecRK-V.2 LecRK-V.2-KD Rp CTCGAGTTAGCGTCCACTAGAGA
LecRK-VII.1 LecRK-VII.1-KD Fp GGATCCAGAAAGAGATTAGAGAGG
LecRK-VII.1 LecRK-VII.1-KD Rp CTCGAGTCACCTCCCTTCTAAAA
Table 2 ：List of abbreviations
Abbreviation Full name
PAMPs/MAMPs Pathogen/microbe-associated molecular patterns
PRRs Pattern recognition receptors
PTI/MTI PAMPs/MAMPs-triggered immunity
LPS Lipopolysaccharides
PGN Peptidoglycans
FLS2 Flagellin-sensing 2
BAK1 Brassinosteroid insensitive 1-associated kinase 1
BIK1 Botrytis-induced kinase 1
RLKs Receptor-lie kinase
Pst DC3000 Pseudomonas syringae pv. tomato DC3000
BiFC Bimolecular fluorescence complementation
Co-IP Co-immunoprecipitation
LiAc Lithium acetate
PEG Polyethylene glycol
SD medium Synthetic dropout medium
3-AT 3-amino-1,2,4-triazole