Discussion

IL-12 plays a regulatory role in the innate and acquired immunities. The physiological functions have been identified, but the molecular mechanism study is still in the initial stage.

It has been demonstrated that the Ets-2 (-211 to -205), NF-κB (-116 to -106) and C/EBP (-75 to -64) sites in IL-12p40 promoter are essential for the stimulatory effect of LPS+IFN-γ in APCs [2, 24 and 26]. In our work, LPS or LPS/IFN-γ stimulate pIL12p40/25 (containing Ets-2, NF-κB and C/EBP binding sites) at 37 ℃ for 12 h to 8 and 25 folds (fold increase of medium only and the fold indicated fold increase without normalization). When truncated the Ets-2 binding element, the promoter activity reduced 50%. Hence, our result confirmed the previously studies of LPS- or LPS/IFN-γ-induced IL-12 p40 promoter activity. Interestingly, promoter fragment -563 to -398 of IL-12 p40 promoter could also be stimulated after LPS and LPS/IFN-γ to about 8 and ~50 fold. In the time course of RAWIL12p40/56 and RAWIL12p40/25 (Fig. 10 and 14), activation of IL12p40/56 was long-life and stronger than IL12p40/25. In other words, inducing the putative transcription factor(s) to bind to the promoter region from -563 to -398 can hold the activation of IL-12p40 gene. In the reporter of Ma et al, they used human IL-12 p40 promoter reporter plasmids in murine monocyte-like cell line. They constructed whole IL-12 p40 promoter (from -3300) and depleted to -292, -265, -243, -222, -204 and TATA. When truncated to -292, the promoter activity reduced to 10 fold and only 40% of whole promoter reporter plasmids contained cells. Ma et al suggested that the reduction of promoter activity was not result from TFs binding to the NF-IL6 (-512 to -505) and IRF-1 (-703 to -719) [2]. Therefore, they had even tried to find some TF binding element(s) which was upstream of Ets-2. Utilizing the bioinformatics method, we found the putative transcription factor(s) residing the

promoter region of –563 to –398 might contain c-Rel, a member of NF-κB family. In order to narrow down the critical region of LPS/IFN-γ-induced activity, we transfer the promoter region -563 to -398 to the upstream of TATA box in the IL-12p40/5 (Fig 13). Alternatively, the transcription factor that binds to promoter region -563 and -398 depends on other TF downstream its binding site for its trans-activity. Thus, the removal of -398 to -48 may lead to lost of synergistic effect of LPS and IFN-γ. Thereafter, we performed the EMSA by using Biotin-labeled oligo-probe containing the putative c-Rel binding site (-433 to -413) (Fig. 15). Manson and colleagues identified the c-Rel-dependent and -independent pathways of IL-12 production during infection and inflammatory stimuli [45]. They also demonstrated that c-Rel was required for IL-12 p40 production by macrophages in response to Coryne-bacterium parvum, CpG oligodeoxynucleotides, anti-CD40 and low molecular weight hyaluronic acid. To data, c-Rel has not been characterized as a major enhancer transcription factor of IL-12 p40 activation. In the future, we want to further confirm the TF complex components and the role of putative c-Rel in regulation human IL-12 p40 gene transcription.

IL-10 could abrogate LPS- or IFN-γ- induced murine IL-12p40 promoter by interaction of NF-AT and ICSBP [17]. Another similar reporter revealed that ICSBP could activate the p40 promoter in cooperation with IRF-1 through an ISRE (interferon stimulated responsive element)-like element [47]. To regard with the role of NF-AT and IRF-1 in the regulation of IL-12 p40 gene transcription, we identified the relative locations of NF-AT and IRF-1 binding sites in human IL-12 p40 promoter by alignment (using BLAST 2 sequence and MatInspector®) and constructed the RAW(IL12p40/7), RAW(IL12p40/7∆I) and RAW(IL12p40/7∆N). Zhu et al demonstrated that LPS, IFN-γ or both can activate transcription proceeding of murine IL-12 p40 gene by NF-AT to recruit ICSBP to bind to the NF-AT binding element. To mention with regulation of human IL-12 p40 gene transcription level, NF-AT can upregulate the

transcription activity of IL-12 p40, too. IRF-1,aAnother TF onto the promoter region of -63 to -53, may be an inhibitory factor, because the promoter pIL12p40/7 with truncation of IRF-1 binding site leads to enhance the promoter activity. Μaruyama et al reported that IRF-1 played an inhibitory role in down-regulating the transcription of IL-12 p40 and the production of IL-12 p70, when mice were infected by Plasmodium berghri [53].

We also utilized the pIL12p40/90 Lucneo stably transfected cell clones, the promoter-based screening system, to select the bioactive function extracts from about 30 Chinese herbs. To find out which component(s) is capable of activation the IL-12 p40 promoter, we proceed with the further isolation of these extracts and sieving out the active component(s) in these extracts. Table 6 shows that the herb extracts induced IL-12 p40 promoter transcription activity significantly. In order to understand the regulation of herbs extracts-induced promoter activity, deletion analysis of human IL-12 p40 promoter is to be used.

Fig. 20, 21, 22 and 23 demonstrated four kinds of herb extracts induced human IL-12 p40 gene transcription in a concentration dependent manner. Based on the understanding of regulation of IL-12 p40 transcription level, 8-4 and 15-2 maybe enhance the NF-κB/Rel (-210 to –205, relevant to transcription starting site) or the interaction of NF-AT and ICSBP (-62 to -57). 16-3 may induce IL-12 p40 promoter transcription through the putative c-Rel TF binding element.

However, 50 µg/mL 16-3 is a proper dosage to treating cells without triggering cells to apoptosis. Hence, 16-3 treated RAW264.7 might activate IL-12 p40 through other pathway.

References

[1] Roberson, M. J. and Ritz, J. Interleukin 12： Basic biology and potential applications in cancer treatment. The Oncologist. 1, 88-97. 1996.

[2] Ma, X., Chow, J. M., Gri, Giorgia., Carra, G., Gerosa, F. and Trinchieri, G.

The interleukin 12 p40 gene promoter is primed by interferon-γ in monocytic cells. J. Exp. Med. 183, 147-157, 1996.

[3] Soiffer, R. J., Roberson M. J., Murray, C. and Ritz, J. Interleukin-12

augments cytolytic activity of peripheral blood lymphocytes from patients with hematologic and solid malignancies. Blood 82, 2790-2796, 1993.

[4] Zeh, H. J. III., Hurd, S., Storkus, W. J. and Lotze, M. T. Interleukin 12 promotes the proliferation and cytolytic activity of immune effectors：

implications for the immunotherapy of cancer. J. Immunother. 14, 155-161, 1993.

[5] Bigda, J., Mysliwska, J., Dziadzuszko, R., Bigda, J., Mysliswki, A. and Hellmann, A. Interleukin 12 augments natural killer cell mediated cytolytic in hairt cell leukemia. Leuk. Lymphoma 10, 121-125, 1993.

[6] Hiraki, A., Kiura, K. Yamane, H., Nogami, N., Tabata, M., Takigawa, N., Ueoka, H., Tanimoto, M. And Harada, M. Interleukin-12 augments

cytolytic activity of peripheral blood mononuclear cells against autologous lung cancer cells in conbination with IL-2. Lung Cancer 35, 329-333, 2002.

[7] Parihar, R., Dierksheide, Y., Hu, Y. and Carson, W. E. IL-12 enhances the natural killer cell cytokine response to Ab coated tumor cells. J. Clin.

Invest. 110, 983-992, 2002.

[8] Schwarze, J., Hamelmann, E., Cieslewicz, G., Tomkinson, A., Joetham, A., Bradley, K. and Gelfand, E. W. Local treatment with IL-12 is an effective inhibitor of airway hyperresponsiveness and lung eosinophilia after airway challenge in sensitized mice. J. Allergy Clin. Immunol. 102, 86-93, 1998.

[9] Stirling, R. G. and Chung, K. F. New immunological approaches and

cytokine targets in asthma and allergy. Eur. Respir. J. 16, 1158-1174, 2000.

[10] Sur, S., Bouchard, P., Holbert, D. and Van Scott, M. R. Mucosal IL-12 inhibits airway reactivity to methacholine and respiratory failure in murine asthma. Exp. Lung Res. 26, 477-489, 2000.

[11] Karp, C. L., Biron, C. A. and Irani, D. Interferon-γ in multiple sclerosis：is IL-12 supression the key？Immunology today 21, 24-28, 2000.

[12] Rabinovitch, A., Suarez-Pinzon, W. L. and Sorensen,O. Interleukin 12 mRNA expression in islets correlates with beta-cell destruction in NOD mice. J Autoimmun, 9, 645-51, 1996.

[13] Liu, J. and Beller, D. I. Distinct pathways for NF-kappa B regulation are associated with aberrant macrophage IL-12 production in lupus- and diabetes-prone mouse strains. J Immunol, 170, 4489-96, 2003.

[14] Jun, H. S., Yoon, C. S., Zbytnuik, L., Van Rooijen, N. and Yoon, J. W. The role of macrophage in the T cell-mediated autoimmune diabetes in nonbese diabetic mice. J. Exp. Med. 189, 347-358, 1999.

[15] Xiong, H., Zhu, C., Li, F., Hegazi, R., He, K., Babyatsky, M., Bauer, A. J., and Plevy, S. E. Inhibition of interleukin-12 p40 transcription and NF-κB activation by nitric oxide in murine macrophages and dendritic cells. J.

Biol. Chem. 279, 10776-10783, 2004.

[16] Kang, B. Y. Chung, S. W., Cho, D. and Kim, T. S. Involvement of p38 mitogen-activated protein kinase in the induction of interleukin-12 p40 production in mouse macrophages by berberine, a benzodioxoloquinolizine alkaloid. Biochem Pharmaco. l63, 1901-1910, 2002.

[17] Zhu, C., Rao, K., Xiong, H., Gsgnidze, K., Li, F., and Horvath, C.

activation of the murine interleukin-12 p40 promoter by functional

interactions between NFAT and ICSBP. J. Biol. Chem. 278, 39372-39382, 2003.

[18] Cor, F. C. and Geert, A. B. Multiple steps in the regulation of

transcription-factor level and activity. Biochem. J. 317,329-342, 1996.

[19] Goodridge, H.S., Harnett, W., Liew, F.Y. and Harnett, M. Differential regulation of interleukin-12 p40 and p35 induction via Erk

mitogen-activated protein kinase-dependent and -independent mechanisms and the implications for bioactive IL-12 and IL-23 responses. Immunology

109, 415-425, 2003

[20] Mausumee, G. and Nackman. LPS induction of gene expression in human monocytes. Cellular Singnalling 13, 85-94, 2001.

[21] Trinchieri Giorgio. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat. Rev. 3, 133-146, 2003.

[22] Sun, Z. and Roland, A. NF-κB activation and inhibition: a review. Shock 18, 99-106, 2002.

[23] Medzbitov, R. and Janeway, C. The toll receptor family and microbial recognition. Trends in Microbiology. 8, 452-256, 2000.

[24] Becker, C., Wirtz, S., Ma, X., Blessing, M., Galle, P. R., and Neurath, M. F.

Regulation of IL-12 p40 promoter activity in primary human monocytes：

roles of NF-κB, CCAAT/enhancer-binding protein , and PU.1 and

identification of a novel repressor element (GA-12) that responds to IL-4 and prostaglandin E₂. J. Immunol. 167, 2608-2618, 2001.

[25] Murphy, T. L., Clevelend, M. G., Kuleaza, P., Magnam, J. and Murphy, K.

M. Regulation of interleukin 12 p40 expression through an NF-κB half-site. Mol.Cell. Biol. 15, 5258-5267, 1995.

[26] Ma, X., Neurath, M., Gri, G., and Trinchieri, G. Identificaiton and

characterization of a novel Ets-2-related nuclear complex impacted in the activation of the human interleukin-12 p40 gene promoter. J. Biol. Chem.

272, 10389-10395, 1997.

[27] Boehm, U., Klsmp, T., Groot, M., and Howard, J. C. Cellular responses of

interferon-γ. Annu. Rev. Immunol., 15, 749-795, 1997.

[28] Brewington, R., Chatterji, M., Zoubine, M., Miranda, R.N., Norimatsu, M., and Shnyra. IFN-γ-independent autocrine cytokine regulatory mechanism in reprogramming of macrophage responses to bacterial

lipopolysaccharide. J. Immunol. 167, 392-398, 2001.

[29] Kotento, S. V., Izotova, L. S. Pollack, B. P., Mariano, T. M., Donnelly L., Muthukumaran, G., Cook, J. R., Garotta, G., Silvennoinen, O., Ihle, J. N.

and Pestka, S. Interaction between components of the interferon-γ receptor complex. J. Biol. Chem. 270, 20915-20921, 1995.

[30] Kotento, S. V., Izotova, L. S.,Pollack, B. P. Muthukumaran, G., Paukku, K., Sivennoinen, O., Ihle, J.N. and Pestka, K. Other kinases can substitute for Jak2 in signal transduction by interferon-γ. J. Biol. Chem. 271,

17174-17182, 1996.

[31] Maruyama, S., Sumita, K., Shen, H., Kanoh, M., Xu. X., Sato, M., Matsumoto, M., Shinomiya H., and Asano, Y. Identification of IFN regulatory factor-1 binding site in IL-12 p40 gene promoter. J. Immonol.

170, 997-1001, 2003.

[32] Gri, G., Chiodoni, C., Gallo, C. E. Stoppacciaro, A., Liow F. Y. and

Colombo, M. P. Antitumor effect of interleukin (IL)-12 in the absence of endogenous IFN-γ: a role fro intrinsic tumor immunogenicity and IL-15.

Cancer Res. 62, 4390-4397, 2003.

[33] Taniguchi, T., Lamphier, M., and Tanaka, N. IRF-1: the transcription factor linking the interferon response and oncogenesis. Biochim. Biophys. Acta.

1333, M9-17, 1997.

[34] Taniguchi, T. Cytokine signal through nonreceptor protein tyrosine kinases.

Science 268, 251-255, 1995.

[35] Wang, I. M., Contursi, C. Masumi, A., Ma, X., Trincheri, G., and Ozato, K.

An IFN-γ-inducible transcription factor, IFN consensus sequence binding

protein (ICSBP), stimulates IL-12 p40 expression in macrophages. J.

Immonol. 165, 271-279, 2000.

[36] Scharton-Kerten, T., contursi, C., Masumi, A., Sher, A., and Ozato, K.

Interferon Consensus Sequence Binding Protein-deficient Mice Display Impaired Resistance to Intracellular Infection Due to a Primary Defect in Interleukin 12 p40 Induction. J. Exp. Med. 186, 1523-1534. 1997.

[37] McElligott, D. L., Philips, J. A., Stillman, C. A., Koch, R. J., Mosier, D. E.

and Hobbs, M. V. CD4+ T cells from IRF-1-deficient mice exhibit altered patterns of cytokine expression and cell subset homeostasis. J. Immunol.

159, 4180-4186, 1997.

[38] Quandt, K., Frech, K., Karas, H., Wingender, E., Werner, T. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res. 23, 4878-4884, 1995.

[39] Alpy F., Boulay A., Moog-Lutz C., Andarawewa, K. L., Degot S., Stoll I., Rio M. C. and Tomasetto C. Metastatic lymph node 64 (MLN64), a gene overexpressed in breast cancers, is regulated by Sp/KLF transcription factors. Oncogene 22, 3770-3780, 2003.

[40] Liedtke C., Groger N., Manns M. P., Trautwein C. The human caspase-8 promoter sustains basal activity through SP1 and ETS-like transcription factors and can be up-regulated by a p53-dependent mechanism. J Biol Chem. 278, 27593-27604, 2003.

[41] Ufer C., Borchert A., Kuhn H. Functional characterization of cis- and trans-regulatory elements involved in expression of phospholipid

hydroperoxide glutathione peroxidase. Nucleic Acids Res. 31, 4293-4303, 2003.

[42] Plevy, S. E., Gemberling, J. H., Hsu, S., Dorner, A. J. and Smale, S. T.

Multiple control elements mediate activation of the murine and human interleukin 12 p40 promoters：evidence of functional synergy between

C/EBP and Rel proteins. Mol.Cell. Biol. 17, 4572-4588, 1997.

[43] Amy, C. M., Caleph, B. W., Manujendra, R. and Pamela, H. C.

Macrophage-Stimulating protein, the ligand for the stem cell-derived tyrosine kinase/RON receptor tyrosine, inhibits IL-12 production by primary peritoneal macrophages stimulated with IFN-γ　and

lipopolysaccharide. J. Immunol. 172, 1825-1832, 2004.

[44] Brendan, A. H., Nicola, M., Lingyun, X., Jing, S., Salah-Eddine, L. C., Hsiou, C. L., Christopher, H. and Youhai, C. Critical role of c-Rel in autoimmune inflammation and helper T cell differtiation. J. Clin. Inverst.

110, 843-850, 2002.

[45] Manson, N., Aliberti, J., Caamano, J. C., Liou, H. C. and Hunter, C. A.

Cutting edge： Identifivation of c-Rel-dependent and independent pathways of IL-12 rpoduction during infectious and inflammatory stimuli. J. Immunol.

168, 2590-2594, 2002.

[46] Hogan, P. G., Chen, L., Nardone, J. and Rao, A. Transcriptional regulation by calcium, calcineurin, and NFAT. Genes & Dev. 17, 2205 – 2232, 2003.

[47] Masumi, A., Tamaoki, S., Wang, I. M., Ozato, K. and Komuro, K.

IRF-8/ICSBP and IRF-1 cooperatively stimulate mouse IL-12 promoter activity in macrophages. FEBS Letters 531, 348-353, 2002.

[48] Zhu, C., Gagnidze, K., Gemberling J. H., and Plevy, S. E. Charaterization of an activation protein-1-binding site in the murine interleukin-12 p40 promoter. J. Biol. Chem. 276, 18519-18528, 2001.

[49] Luo, Q., Ma, X., Wahl, S. M., Bieker, J. J. Crossley, M. and Montaner, L. J.

Activation and repression of interleukin-12 p40 transcription by erythroid kruppel-like factor in macrophages. J. Biol. Chem. 279, 18451-18456, 2004.

[50] Zhang, J. S., Feng, W. G., Li, C. L., Wang, X. Y., and Chang, Z. L. NF-κB regulates the LPS-induced expression of interleukin 12 p40 in murine peritoneal macrophages: roles of PKC, PKA, ERK, p38 MAPK, and

proteasome. Cell. Immunol. 204, 38-45, 2000.

[51] Cowdery, J. S., Boerth, N. J., Norian, L. A., Myung, P. S. and Koretzky, G.

A. Differential regulation of the IL-12 p40 promoter and of p40 secretion by CpG DNA and lipopolysaccharide. J. Immunol. 162, 6770-6775, 1995.

[52] Li, J. J. The development of NF-IL6 and NF-κB based drug screening

system and its application on the study of Chinese traditional herbs. A thesis Submitted to National Chiao Tung university for the Degree of Master in Science. 2001.

[53] Xu, X., Sumita, K., Feng, C., Xiong, X., Shen, H., Maruyama, S., Kanoh, M. and Asano, Y. Down-regulation of IL-12 p40 gene in Plasmodium berghei-infected mice. J. Immunol. 167, 235-241, 2001.

[] 現代中藥彙整，柯達製藥公司編輯小組，柯達製藥股份有限公司，桃園，

民國八十四年。

Table 1. Primers used in this work

(1) Primers of promoter fragments

Oligo Sequence (from 5’ end to 3’ end) Retriction enzyme

P40/90/S GCTAGCACCGGTGTACACCTTTGCATACC Nhe I

P40/56/S GCTAGCGGAATGTGGGGAGAGGTG Nhe I

P40/40/S GCTAGCGGCATACAGTTGTTCCATCCC Nhe I

P40/25/S GCTAGCCCATCTCCTTCCTTATTCCCC Nhe I

P40/20/S GCTAGCGGATTTTGATGTCTATGTCTATGTT CCC

Nhe I

P40/10/S GCTAGCCCCCAGAAGGTTTTGAGAGTTG Nhe I

P40/7/S GCTAGCGTCAGTTTCTAGTTTAAGTTTCC Nhe I

P40/5/S GCTAGCTTCCATCAGAAAGGAGTAGAG Nhe I

P40/56-4 0/AS

GCTAGCCAAGGGCTTAAAAACAAAATCC Nhe I

P40/AS AAGCTTCCAATGGCCCTGAAACAGATG Hind III

The underline means retriction enzyme cutting site

(2) Primers for the Site-directed mutagenesis un this work

Oligo Sequence (from 5’ end to 3’ end)

The boldface with underline means the mutated site of indicated transcription factors binding sites.

(3) Oligo sets for the EMSA (Electrophoretic Mobility Shift Assays) study

The boldface with underline means the mutated site of indicated transcription factors binding sites.

Table 2. Plasmids and vectors used in this work

Number Name Oringin

1 p3X-NIL-Luc_neo Li J.J., 2001

2 pcDNA3.0 Invitrogen, Inc.

3 pIL12p40/90 Teasy This project 4 pIL12p40/56 Teasy This project 5 pIL12p40/40 Teasy This project 6 pIL12p40/25 Teasy This project 7 pIL12p40/20 Teasy This project 8 pIL12p40/10 Teasy This project 9 pIL12p40/7 Teasy This project 10 pIL12p40/5 Teasy This project 11 pIL12p40/0 Teasy This project 12 pIL-12p40/56-40 Teasy This project 13 pIL12p40/56-CR Teasy This project 14 pIL12p40/7I Teasy This project 15 pIL12p40/7N Teasy This project 16 pIL12p40/90 Luc_neo This project 17 pIL12p40/56 Luc_neo This project 18 pIL12p40/40 Luc_neo This project 19 pIL12p40/25 Luc_neo This project 20 pIL12p40/20 Luc_neo This project 21 pIL12p40/10 Luc_neo This project 22 pIL12p40/7 Luc_neo This project 23 pIL12p40/5 Luc_neo This project 24 pIL12p40/0 Luc_neo This project 25 pIL12p40/56-40 Luc_neo This project

26 pIL12p40/56-CR Luc_neo This project 27 pIL12p40/7I Luc_neo This project 28 pIL12p40/7N Luc_neo This project

Table 3. Classification of Chinese Herbs by KODA

pharmaceutical Co. Ltd.

清熱藥 補虛藥

Local name Scientific name Local name Scientific name

黃蓮 Coptis Chinensis 黨蔘

^Angelicae

Dahuricae Radix

紫草

Lithospermi Radix

甘草

Glycyrrhiza

uralensis

仙鶴草

Agriminia pilosa

丁香

Flos caryophylli

茜草

Rubia cordifolia.

L.

Table 4. List of respondingelements in the human or murine IL-12 p40 gene promoter

1. murine IL-12 p40

Transcription factor Loci Treating condition Cell line Referance NF-κB -132 to -122 treat with 1 µg/mL of LPS after 100 U of IFN-γ

1 µg/mL of CpG oligonucleotide

J774*

peritoneal exudate cells [31]

2. human IL-12 p40

Transcription factor Loci Treating condition Cell line Referance C/EBP、Rel -96 to -88 1.5*10⁸/mL of KHLM**+ 100 U/mL of IFN-γ for

EKLF (erythroid

kruppel-like factor) -224 to -204 10 ng/mL of IFN-γ and 1 mg/mL of LPS for 1hr RAW264.7 [49]

J774* : murine macrophage cell line KHLM** : heat-killed Listeria monotogenes

？ : need to be confirmed.

Table 5 The putative transcription responding elements in the promoter region from -922 to +33 of human IL-12 p40.

The putative transcription responding elements in the promoter region of IL-12 p40 gene was deduced from sequence comparison with the conserved responding element sequences listed in the MatInspector library: (Matrix Family Library Version 4.0 ; Website :www.genomatrix.de).

Sequence representation : Basepairs marked red shows a high information content, i.e. the matrix exhibits a high

conservation (ci-value > 60) at the position. Basepairs in capital letters denote the core sequence used by MatInspector.

Family loci Strand Core

similarity

Matrix similarity

Sequence published

Oct-1 -914 ~ -900 - 1.000 0.986 ggtATGCaaaggtgt

MEF-2 -875 ~ -853 - 1.000 0.866 tagcggaaTAAAgatatctctcg

IRF-3 -731 ~ -717 - 1.000 0.947 cagaaagtGAAAtac shown as IRF-1 in [2]

c-Ets -684 ~ -668 + 0.925 0.956 agcacAGGAtgtgcacca

GATA -640 ~ -628 - 1.000 0.953 agatGAGAaaact

Oct-1 -614 ~ -600 - 1.000 0.909 cACATttcatacaga

Oct-1 -602 ~ -597 - 1.000 0.845 cccATGCacatttca

c-Rel -433 ~ -419 - 1.000 0.913 cctggttcTTCCcaa

MEF-2 -421 ~ -399 - 1.000 0.903 caagggctTAAAaacaaaatcct

AP-2 -351 ~ 339 + 0.976 0.890 cgCCCttggcct

Oct-1 -259 ~ -245 - 1.000 0.905 gagatgctAATTtct

Ets -218 ~ -202 - 1.000 0.956 ctaagaGGAAatgactt [2 and 27]

NF-κB -120 ~ -106 - 1.000 0.879 ggGGGAatttcaaga

[24, 25 and 51]

IRF -63 ~ -53 - 1.000 0.849 ttaaactaGAAActg [31 and 47]

Table 6 The activation of IL-12 p40 promoter induced by four fractionated layer of Chinese Herbs

Fractions Local name Scientific name

water n-hexane dichloromethane n-butanol

黨蔘 Angelicae Dahuricae Radix 26.26 7.71 1.86 ND

熟地 Rehmannia glutinosa Libosch.f.hueichigensis 0.85 1.00 1.56 1.74

九層塔 Ocimum basilicum 1.14 ND 4.97 11.46

水丁香 Ludwigia octovalvis 1.27 2.1 ND ND

仙鶴草 Agriminia pilosa 0.48 ND 3.79 2.79

女真子 Codouopsitis Radix 2.24 ND ND 0.78

旱連草 Ecliptae Herba ND 1.35 10.16 0.84

釘地蜈蚣 Torenia concolor Lindl EY. Var. formosans Yamazaki. 1.43 1.75 0.25 2.71

枸杞 lyceum chinense 0.92 25.94 ND 0.60

蒼絨子 0.84 1.72 ND 2.34

山甘草 Mussaenda pubescens Ait. f. 0.8 ND 6.67 0.93

ND：Not detectable Red：Fold increase > 10

NF-kB

Fig. 1. Comparison of the promoter region of murine and human IL-12 p40 genes. The sequence alignment of the promoter region of murine and

human IL-12 p40 gene was performed using Blast 2 sequence of NCBI web.

Transcription factor responding elements are indicated under (human) or above the sequence (murine). The result indicates that most of known responding elements are conserved between human and murine IL-12 p40 genes.

-929 ggtccacacc ggtgtacacc tttgcatacc tcttagcaac ttgaaattcc accacgagag -869 atatctttat tccgctattc ctgtgcatct gcacggagcc cctagggcca tagatttgtg ^Oct-1 -809 tgcaaatgaa atgaggatgt agtctgggtg cccaaggggg ggtgccttga gtgtggttgt ^MEF-2 -749 ctgtatgcct ccctgagggt atttcacttt ctgctcccat ccgcccctat gagcgagtac

c-Rel

-689 ctatgagcac aggatgtgca catatttgag tcttattagt ggtacacgca gttttatcat ^IRF-3 -629 ctccccaggt ctgtgtctgt atgaaatgtg catgggtgtg tgtgtgcacg cgtgtgttcc ^{c-Ets GATA-1} -569 cactcgggga atgtggggag aggtgcatgg agccaagatg ggtggtaaat agtatgtttc ^{Oct-1 Oct-1} -509 tgaaattaaa ggactaatgt ggaggaaggc gccccagatg tactaaaccc tttgccttca ^C-EBP/β -449 tctcatcctc tctgacttgg gaagaacc ag gattttgttt ttaagccctt gggcatacag

-389 ttgttccatc ccgacatgaa ctcagcctc cgtctgaccg ccccttggcc ttccttcttc -329 ctcgatctgt ggaacccagg gaatctgcct agtgctgtct ccaagcacct tggccatgat

MEF-2 AP-2

-269 gtaaacccag agaaattagc atctccatct ccttccttat tccccaccca aaagtcattt -209 cctcttagtt cattacctgg gattttgatg tctatgttcc ctcctcgtta ttgatacaca

NF-κB

Oct-1 Ets、NF-AT

-149 cacagagaga gacaaacaaa aaaggaactt cttgaaattc ccccagaagg ttttgagagt ^GA-12 -89 tgttttcaat gttgcaacaa gtcagtttct agtttaagtt tccatcagaa aggagtagag ^{Pu.1 NF-κB}

-29 TATAtaagtt ccagtaccag caacagcaGc agaagaaaca acatctgttt cagggccatt C-EBP IRF-1 NF-AT +31 ggactctccg tcctgcccag agcaaagctt

Fig. 2. Potential responding elements in the 5 -flanking region of human IL-12 p40 gene (U89323).

The sequence of human IL-12 p40 promoter (-922 to +22) was scanned by the computer program: “MatInspector” available on web site:

http://www.genomatrix.de/ Capital “G” indicates the transcription start site.

Human genomic DNA

PCR

Nhe I cutting site

IL-12p40/90 967 bp

Ligation

Fig. 3. Construction of pIL12p40/90 Teasy. Using PCR to clone human

IL-12 p40 promoter region from -922 to +33, followed by ligating to pGEM Teasy® to form pIL12p40/90 Teasy.

Hind III cutting site

HindIII cutting site SacI cutting site

SacI & HindIII digestion

SacI cutting site HindIII cutting site

IL-12p40/90

Ligation

Fig. 4. Construction of pIL12p40/90 Luc

_neo

. Using SacI and HindIII to

digest p3X-NIL-Luc_neo and pIL12p40/90 Teasy, followed by religating the

IL-12p40/90 promoter region to linearized p3X-NIL-Luc_neo depleted 3X NF-IL6 binding element.

Fig. 5. pIL12p40/90 Luc

_neo

Vector circle map.

Fig. 6. Illustration of the Luciferase reporter plasmids containing various length of the promoter region of human IL-12 p40 gene.

0 5 10 15 20

3 6 9 12 15

Time (Hour)

Relative Luciferase activity (fold

LPS LPS+IFN

Fig. 7. Time-dependent activation of RAW(IL12p40/90). The

RAW(IL12p40/90) cells were incubated with LPS (1 µg/mL) or LPS (1 µg/mL) plus IFN-γ (100 U/mL) at 37℃ for 3 ~ 15 h. At each time point, cells were harvested and subjected to a luciferase activity assay. Fold increase were determined relative to control (treat with medium only). Values are presented as means of two independent experiments.

(A)

(B)

β-actin 43 kDa NPT 31 kDa RAWIL12p40/ RAW

90 56 40 25 20 10 7 5 0

Fig. 8. Western blotting of NPT in different RAW264.7 stable clones. (A)

Western blot analysis of total cell lysate of RAW264.7 and various stable clones.

(B) The relative expression level of NPT in each RAW264.7 stable clone. The NPT expression level in each clone was first quantified by densitometry and normalized by the expression level of β-actin. The normalization index (A/B ratio) of NPT in each RAW(IL12p40/90) stable clone is used as 100 %. The results shown are the means of two separate experiments, each carried out in triplicate.

Fig. 9. LPS and LPS plus IFN-γ induced IL-12 p40 promoter

fragments activation.

Cells were treated with 1 µg/mL of LPS or LPS (1 µg/mL) plus IFN-γ (100 U/mL) at 37℃ for 12 h. Data presented is mean ± S.D., (n=3); , p＜0.001; *, p<0.05. ^**

0 10 20 30 40 50 60

3 6 9 12 18 24 30

Time (hr)

Relative luciferase activity (Fold)

LPS IFN LI

Fig. 10. Time course of the RAW(IL12p40/56) activation by LPS, IFN-γ or

both. RAW(IL12p40/56) cells were incubated with LPS (1 µg/mL), IFN-γ

(100 U/mL) or both LPS and IFN-γ at 37℃ for 3~30 h as indicated. At the indicated time point, cells were harvested and subjected to the luciferase activity assay. Fold increase were determined as relative to control (treat with medium only). Values are presented as means of two independent experiments.

0 5 10 15 20

1 2 4 8 12

Time (Hour)

Relative luciferase acitvity (Fold) LPS

L+I

Fig. 11. Time course of the RAW(IL12p40/25) activation by LPS and LPS/IFN-γ. RAW(IL12p40/25) cells were incubated with LPS (1 µg/mL) in

thepresence or absence of IFN-γ (100 U/mL) at 37℃ for 1~12 h as indicated.

At the indicated timepoint, cells were harvested and subjected to the luciferase activity assay. Relative activity was determined by comparing with that of control (treat with medium only). Values are presented as means of two

(A) Co-treatment with 100 U/mL of IFN-γ

(B) Co-treatment with 1 µg/mL of LPS

0

0 200 400 600 800 1000 1200

IFN (U/mL)

Relative luciferase activity (Fold)

Fig. 12. (A)Does-dependent effect of LPS in the presence of IFN-γ on the induction of RAW(IL12p40/56) luciferase activity. RAW(IL12p40/56) cells

were incubated with various concentration of LPS (100~10,000 ng/mL) in the presence of fix concentration of IFN-γ (100 U/mL) at 37℃ for 12 h. (B)

Does-dependent effect of IFN-γ in the presence of LPS on the induction of RAW(IL12p40/56) luciferase activity. RAW(IL12p40/56) cells were

incubated with various concentration of IFN-γ(100~1000 U/mL) in the presence of fix concentration of LPS (1000 ng/mL) at 37℃ for 12 h. Values are presented as means of two independent experiments.

(A)

P40/56

P40/56-40

P40/5

(B)

p40/56 56-40 RAW

ΝPΤ 31 k Da β-actin 43 kDa

NPT/β-actin

(%) 100 83.4 0

Fig. 13. Illustration of reconstituted reporter plasmid pIL-12p40/56-40.

(A) A Schematic representation of reporter plasmids pIL12p40/56,

pIL12p40/56-40 and pIL12p40/5. (B)Western analysis of total cell lysate of different RAW264.7 stable clones. The relative level of NPT in each stable

pIL12p40/56-40 and pIL12p40/5. (B)Western analysis of total cell lysate of different RAW264.7 stable clones. The relative level of NPT in each stable

在文檔中 探討干擾素及內毒素刺激誘導人類介白素12 p40 (IL-12 p40)基因轉錄作用分子機轉之研究 (頁 38-82)