In this study we want to investigate the biological function of canine YKL-40 protein, for this reason, we need a source that can stably provide this protein for us to apply in different assays. Most of the studies rely on the human or mouse cartilage chondrocyte (Hakala et al. 1993; De Ceuninck et al. 2001; Faibish et al. 2011), vascular smooth muscle cells (Nishikawa et al. 2003), to express the YKL-40 protein. So far we don’t have any canine cell line that can spontaneously express canine YKL-40, this means that we must produce the canine YKL-40 with a bioengineering method. In addition, there’s no available antibody can recognize the canine YKL-40 protein for us to use, a 6x-histidine tag attached to the recombinant protein will be an appropriate method for detection. Because that the YKL-40 protein is a secreted glycoprotein, for the consideration of the proper glycosylation, we choose the eukaryotic system instead of prokaryotic system to express this recombinant protein.
There’s few study information about using eukaryotic cells to generate recombinant YKL-40, only Scully et al. applied 293T retroviral packaging cells to express recombinant YKL-40 (Scully et al. 2011). Now we want to use the BALB/3T3 mouse embryo cells to express the recombinant canine YKL-40 protein, there’s some uncertainty.
36
One of the advantages of the secreted glycoprotein is that the protein will be secreted out of the cell. We can easily collect the medium which cultured with the CL7208 cells, and no need to lyse the cell. Nevertheless, the phenol red in the DMEM makes the quantification of the protein inaccurate. The protein quantification kit that we used is functioning based on the reaction between the protein and the coomassie G-250 dye, and the detection of the absorbance at wavelength of 595nm. In concern with the effect that the color of the phenol red, we replaced the DMEM with PBS in the end stage of using centrifugal concentrator. Once the solution become transparent, the protein can be quantified correctly.
The pcDNA 3.1/YKL-40 plasmid contains a 6x histidine tag, which should provide a binding site for the his-column. However, the his-column we used somehow failed to purify the recombinant canine YKL-40 protein. One of the most possible reasons should be the folding conformation of the protein, which may be false folded in the expression procedure of the BALB/3T3 cells. Since the 6x histidine tag is aligned in the tail of the amino acid sequence, it may be enwrapped inside the protein and failed to bind the his-column. Fortunately, the YKL-40 protein has the ability to bind heparin. By using this advantage, we’re able to purify the recombinant canine YKL-40 protein with the heparin-column. Though the recycle rate of the heparin-column is considerably high,
37
there’s still elute buffer used in the purification procedure, and thus added the volume of the protein solution. This dramatically decreased the concentration of the purified recombinant canine YKL-40 protein. In the meantime, the protein will slowly degrade as time passes, even the proteinase inhibitor was added and the procedure is in the low temperature condition. Therefore we will again concentrate the purified protein to make sure the concentration of the protein can be in the acceptable range, mostly between 10 to 100 ng/mL.
In the confirmation of the recombinant canine YKL-40 protein, we applied the Western blot analysis to detect the his-tag on the protein. The his-tag of the protein can be probed by the anti-6x-histidine monoclonal antibody correctly, and this can also be used as a double confirmation in the autoantigen analysis. Since there are no available antibody can be used to recognize the canine YKL-40 protein so far, we rely mainly on the anti-his-tag antibody to detect the YKL-40 protein.
In cell proliferation assay, the result showed no significance between different dosages of YKL-40. This was tested several times,
In the investigation of the cell signal pathways that YKL-40 was involved in, we chose to see the PI3K/AKT and MAPK (ERK1/2) pathways. YKL-40 was found to induce the PI3K/AKT pathway in human synovial cells in a dose-dependent manner
38
(Recklies et al. 2002), and also the MAPK pathway in human synovial cells and human microvascular endothelial cells (Recklies et al. 2002; Shao et al. 2009). In this study, we found that YKL-40 indeed induced the PI3K/AKT pathway in both CMT-1 and MPG cells and in a dose-dependent manner (Fig. 11). However, in the MAPK pathway, the result of CMT-1 showed difference in a dose-dependent manner. While in the result of MPG, the activated MAPK (ERK1/2) showed no difference between different YKL-40 concentrations (Fig. 12). Considering the cells applied in this analysis are different, and there’re no mammary gland tumor used in other research, we can only presume that there are several innate differences between the CMT-1 and MPG cells. This can also be verified in the experiment of cell migration assay, in which the CMT-1 showed more obvious response to YKL-40 than the MPG cells.
YKL-40 has many biological functions related to tumorigenesis, such as fibroblast proliferation stimulation and angiogenesis promotion (Recklies et al. 2002; Francescone et al. 2011). However, the specific receptors for YKL-40 have not yet been identified (Hakala et al. 1993; Francescone et al. 2011). For investigation of the role of canine YKL-40 in cancer progression, discovering the specific receptors will be an priority in the future.
In conclusion, the recombinant canine YKL-40 protein that we produced indeed
39
has the properties and abilities in cell growth, including the effects in cell migration and cell invasion. So far we only observed the effects in cell migration and invasion, and mostly obvious on CMT-1 cells. This may be the result of the difference of the canine mammary cell lines. Since most studies investigating the biological function of YKL-40 were based on the effects on human vascular endothelial cells and human synovial cells, there are little information about the YKL-40 in canine study can be referred to. The canine endothelial cells seem to be an appropriate cell in the next step of YKL-40 biological function investigation.
40
Tables
Table 1. Reverse transcription protocol
Solution Volume
5x First strand buffer (Bionovas, Canada) 4 μL HiScript I Reverse transcriptase (Bionovas, Canada) 2 μL
100 mM DTT (Bionovas, Canada) 2 μL
100 mM dNTPs 1 μL
RiboLocks RNase inhibitor (Thermo Scientific, Canada) 1 μL
1 μM Oligo dT primer 1 μL
1 μM Random primer 1 μL
RNA suspension (1 μg total RNA) 8 μL
41
Table 2. YKL-40 primer list
Primer Name Sequence (5'->3')
cYKL-40-F137 CATCTACAGCTTCGCCAACA
cYKL-40-R156 TGTTGGCGAAGCTGTAGATG
cYKL-40-R GGATGGAGCTTTGGTTCTCA
cYKL-40-R968 GTCATCATACCCCACCCACT
oYKL-40-CF741 CTGATGGGCATCCCCACCTT
oYKL-40-CR760 AAGGTGGGGATGCCCATCAG
oYKL-40-CR955 ACCCACTGGTTGCCCTTGGT
CF-YKL-40 TCTGCTGCAGCCAGGATGCT
42
Figures
Figure 1. The construct of canine YKL-40/pcDNA 3.1/V5-HIS-TOPO.
The YKL-40 gene was inserted into the vector pcDNA3.1/V5-HIS-TOPO plasmid, which contains 6-histidine tag and anti-neomycin gene.
43
Figure 2. Expression of the YKL-40 mRNA in different tumor cell lines.
YKL-40 mRNA expression in different canine tumor cell lines were analyzed using RT-PCR, including canine mammary gland tumor (MGT) cell lines, osteosarcoma (OSA) cell line, lymphoma cell lines, and melanoma cell lines. No YKL-40 mRNA was expressed in MGT, OSA, lymphomas, and M1 melanoma cell line. NC stands for negative control and PC stands for positive control.
YKL-40
GAPDH
CLBL-1 UL-1 CLC
Lymphomas
CMT-1 MPG CF4 D17
MGTs OSA
YKL-40 GAPDH
CM-01-01 M1 M2 M3 M4 M5 NC PC
Melanomas
44
Figure 3. The transfection of YKL-40 into BALB/3T3 cells
Transfection of canine YKL-40 gene into BALB/3T3 cells. (A)The transfection of eGFP as a positive control, and (B) the pcDNA3.1 as a mock control. (C) The transfection successful rate is more than 50%.
A B
C
45
(A)
(B)
Figure 4. Purification of the recombinant YKL-40 protein with His-column and Heparin-column
(A) The recombinant canine YKL-40 protein purified with His-column and separated by 10%
SDS-PAGE and western blotted, the membrane was probed with anti-His-tag antibody. (B) The recombinant canine YKL-40 protein purified with heparin-column and separated by 10%
SDS-PAGE and western blotted, the membrane was probed with anti-His-tag antibody.
YKL-40 (His-tag)
Supernatant Flow-through Wash Elute
His-column
Elute Concentrated
Supernatant Flow-through Wash Elute
Heparin-column
Elute Concentrated
YKL-40 (His-tag)
A B
46
(A)
(B)
Figure 5. YKL-40 increases the proliferation rate of CMT-1 and MPG cells.
(A) CMT-1 cells were treated with YKL-40 protein, concentration from 10 to 1000 ng/mL, and the treatment time from 24 to 72 hours. The result shows significant difference and is also dose-dependent. (B) MPG cells have similar reaction to YKL-40 protein.
0
47
(A)
(B)
Figure 6. The result of cell migration assay on CMT-1 cells
(A) The result of the cell migration assay on CMT-1 cells, the cells have a better efficiency in migration to recover a gap in a dose-dependent manner. (B) The results in Fig 7A were calculated and analyzed, *P<0.05 and **P<0.01 compared with corresponding control cells treated with serum-free DMEM.
48
(A)
(B)
Figure 7. The result of cell migration assay on MPG cells
The result of the cell migration assay on MPG cells, the cells appear to have better migration efficacy in higher concentration. (B) The results in Fig 8A were calculated and analyzed by computer software. *P<0.05 and **P<0.01 compared with corresponding control cells treated with serum-free DMEM.
49
50
Figure 8. YKL-40 stimulates the invasion ability of CMT-1 cells.
(A) The insert with CMT-1 cells treated with YKL-40 showed obvious invasion ability compare to the control group treated with serum-free DMEM. The invasion ability will not be activated by the FBS. (B) The results of cell invasion in Fig. 9A are calculated by computer software, significant differences are presented in the groups with YKL-40 added. *P<0.05 and
**P<0.01 compared with corresponding control cells treated with serum-free DMEM.
51
52
Figure 9. YKL-40 stimulates the invasion ability of CMT-1 cells.
(A) The insert with CMT-1 cells treated with YKL-40 showed obvious invasion ability compare to the control group treated with serum-free DMEM. The invasion ability will not be activated by the FBS. (B) The results of cell invasion in Fig. 9A are calculated by computer software, significant differences are presented in the groups with YKL-40 added. *P<0.05 and
**P<0.01 compared with corresponding control cells treated with serum-free DMEM.
53
Figure 10. Autoantigenicity of YKL-40
The recombinant canine YKL-40 protein was separated with 10% SDS-PAGE and Western blotted, the membrane was probed with dog serum (dog A, B, C, D). The membrane was then stripped and confirmed by anti-His-tag antibody again.
A B C D
YKL-40 (His-tag)
YKL-40 (Serum)
Dog Sera
54
(A)
(B)
Figure 11. The PI3K/AKT and MAPK pathway analysis on CMT-1 and MPG cells
(A) CMT-1 cells pretreated with serum-free DMEM were stimulated with YKL-40 from 10 to 1000 ng/mL and DMEM with 10% FBS for 1 hour. The result showed that pAKT and pERK were induced by YKL-40 in a dose-dependent manner. (B) MPG cells pretreated with serum-free DMEM were stimulated with YKL-40 from 10 to 1000 ng/mL and DMEM with 10% FBS for 1 hour. The result showed that pAKT and pERK were induced by YKL-40, and pAKT was induced in a dose-dependent manner.
Actin
55
References
Allin KH, Bojesen SE, Johansen JS, Nordestgaard BG. Cancer risk by combined levels of YKL-40 and C-reactive protein in the general population. Br J Cancer 2012;106:199-205.
Baeten D, Boots AMH, Steenbakkers PGA, Elewaut D, Bos E, Verheijden GFM, Verbruggen G, Miltenburg AMM, Rijnders AWM, Veys EM, De Keyser F. Human cartilage gp-39+, CD16+ monocytes in peripheral blood and synovium. Arthritis Rheum 2000;43(6):1233-1243.
Benjamin SA, Lee AC, Saunders WJ. Classification and behavior of canine mammary epithelial neoplasms based on life-span observations in Beagles. Vet Pathol 1999;36:423-436.
Bigg HF, Wait R, Rowan AD, Cawston TE. The mammalian Chitinase-like lectin, YKL-40, binds specifically to type I collagen and modulates the rate of type I collagen fibril formation. J Biol Chem 2006;281(30):21082-21095.
Boots AMH, Hubers H, Kouwijzer M, den Hoed-van Zandbrink L, Westrek-Esselink BM, van Doorn C, Stenger R, Bos ES, van Lierop MC, Verheijden GF, Timmers CM, van Staveren CJ. Identification of an altered peptide ligand based on the endogenously presented, rheumatoid arthritis-associated, human cartilage glycoprotein-39(263-275) epitope: an MHC anchor variant peptide for immune modulation. Arthritis Res Ther 2007;9(4):R71.
56
Boussac M, Garin J. Calcium-dependent secretion in human neutrophils: a proteomic approach. Electrophoresis 2000;21:665-672.
Chang CY, Chiou PP, Chen WJ, Li YH, Yiu JC, Cheng YH, Chen SD, Lin CT, Lai YS.
Assessment of the tumorigenesis and drug susceptibility of three new canine mammary tumor cell lines. Res Vet Sci 2010;88:285-293.
Cintin C, Johansen JS, Christensen IJ, Price PA, Sorensen S, Nielsen HJ. High serum YKL-40 level after surgery for colorectal carcinoma is related to short survival. Cancer 2002;95:267-274.
Coffman FD. Chitinase 3-Like-1 (CHI3L1): a putative disease marker at the interface of proteomics and glycomics. Crit Rev Clin Lab Sci 2008;45:531-562.
Connor JR, Dodds RA, Emery JG, Kirkpatrick RB, Rosenberg M, Gowen M. Human cartilage glycoprotein 39 (HC gp-39) mRNA expression in adult and fetal chondrocytes, osteoblasts and osteocytes by in-situ hybridization. Osteoarthritis Cartilage 2000;8:87-95.
De Ceuninck F, Gaufillier S, Bonnaud A, Sabatini M, Lesur C, Pastoureau P. YKL-40 (cartilage gp-39) induces proliferative events in cultured chondrocytes and synoviocytes and increases glycosaminoglycan synthesis in chondrocytes. Biochem Biophys Res Commun 2001a;285:926-931.
De Ceuninck, Pastoureau P, Bouet F, Bonnet J, Vanhoutte PM. Purification of guinea pig
57
YKL-40 and modulation of its secretion by cultured articular chondrocytes. J Cell Biochem 1998;69:414-424.
Faibish M, Francescone R, Bentley B, Yan W, Shao R. A YKL-40-neutralizing antibody blocks tumor angiogenesis and progression: a potential therapeutic agent in cancers. Mol Cancer Ther 2011;10(5):742-751.
Francescone RA, Scully S, Faibish M, Taylor SL, Oh D, Moral L, Yan W, Bentley B, Shao R.
Role of YKL-40 in the angiogenesis, radioresistance, and progression of glioblastoma. J Biol Chem 2011;286(17):15332-15343.
Goldschmidt M, Peña L, Rasotto R, Zappulli V. Classification and grading of canine mammary tumors. Vet Pathol 2011;48(1):117-131.
Fusetti F, Pijning T, Kalk KH, Bos E, Dijkstra BW. Crystal structure and carbohydrate-binding properties of the human cartilage glycoprotein-39.
Hakala BE, White C, Recklies AD. Human cartilage gp-39, a major secretory product of articular chondrocytes and synovial cells, is a mammalian member of a chitinase protein
family. J Biol Chem 1993;268(34):25803-25810.
Harvey S, Weisman M, O’Dell J, Scott T, Krusemeier M, Visor J, Swindlehurst C. Chondrex:
new marker of joint disease. Clin Chem 1998;44:509-516.
Hellmén E, Moller M, Blankenstein MA, Andersson L, Westermark B. Expression of different
58
pheynotypes in cell lines from canine mammary spindle-cell tumours and osteosarcomas indicating a pluripotent mammary stem cell origin. Breast Cancer Res Treat 2000;61:197-210.
Henrissat B, Davies G. Structural and sequence-based classification of glycoside hydrolases.
Curr Opin Struct Biol 1997;7:637-644.
Hogdall EV, Johansen JS, Kjaer SK, Price PA, Christensen L, Blaakaer J, Bock JE, Glud E, Hogdall CK. High plasma YKL-40 level in patients with ovarian cancer stage III is related to shorter survival. Oncol Rep 2003;10:1535-1538.
Hollak CEM, van Weely S, van Oders MHJ, Aerts JMFG. Marked elevation of plasma chitotriosidase activity. J Clin Invest 1994;93:1288-1292.
Horbinski C, Wang G, Wiley CA. YKL-40 is directly produced by tumor cells and is inversely linked to EGFR in glioblastomas. Int J Clin Exp Pathol 2010;3(3):226-237.
Houston DR, Recklies AD, Krupa JC, Van Aalten DMF. Structure and ligand-induced conformational change of the 39-kDa glycoprotein from human articular chondrocytes. J Biol Chem 2003;278(32):30206-30212.
Hu B, Trinh K, Figueira WF, Price PA. Isolation and sequence of a novel human chondrocyte protein related to mammalian members of the Chitinase protein family. J Biol Chem 1996;271(32):19415-19420.
59
Jensen BV, Johansen JS, Price PA. High levels of serum HER-2/neu and YKL-40 independently reflect aggressiveness of metastatic breast cancer. Clin Cancer Res 2003;9:4423-4434.
Johansen JS, Williamson MK, Rice JS, Price PA. Identification of proteins secreted by human osteoblastic cells in culture. J Bone Miner Res 1992;7(5):501-512.
Johansen JS, Møller S, Price PA, Bendtsen F, Junge J, Garbarsch C, Henriksen JH. Plasma YKL-40: a new potential marker of fibrosis in patients with alcoholic cirrhosis? Scand J Gastroenterol 1997;32:582-590.
Johansen JS, CHristoffersen P, Møller S, Price PA, Henriksen JH, Garbarsch C, Bendtsen F.
Serum YKL-40 is increased in patients with hepatic fibrosis. J Hepatol 2000;32:911-920.
Johansen JS, Olee T, Price PA, Hashimoto S, Ochs RL, Lotz M. Regulation of YKL-40 production by human articular chondrocytes. Arthritis Rheum 2001;44:826-837.
Johansen JS. Studies on serum YKL-40 as a biomarker in diseases with inflammation, tissue remodelling, fibroses and cancer. Dan Med Bull 2006;53:172-209.
Johansen JS, Olee T, Price PA, Hashimoto S, Ochs RL, Lotz M. Regulation of YKL-40 production by human articular chondrocytes. Arthritis Rheum 2011;44(4):826-837.
Junker N, Johansen JS, Andersen CB, Kristjansen PEG. Expression of YKL-40 by peritumoral macrophages in human small cell lung cancer. Lung Cancer 2005;48:223-231.
Kawada M, Seno H, Kanda K, Nakanishi Y, Akitake R, Komekado H, Kawada K, Sakai Y,
60
Mizoguchi E, Chiba T. Chitinase 3-like 1 promotes macrophage recruitment and angiogenesis in colorectal cancer. Oncogene 2011;31(26):3111-3123.
Krause SW, Rehli M, Kreutz M, Schwarzfischer L, Paulauskis JD, Andreesen R. Differential screening identifies genetic markers of monocyte to macrophage maturation. J Leukoc Biol 1996;60(4):540-545.
Kushner I. The phenomenon of the acute phase response. Ann NY Acad Sci 1982;389:38-48.
Lal A, Lash AE, Altschul SF, Velculescu V, Zhang L, McLendon RE, Marra MA, Prange C, Morin PJ, Polyak K, Papadopoulos N, Vogelstein B, Kinzler KW, Strausberg RL, Riggins GJ. A pubic database for gene expression in human cancers. Cancer Res 1999;59:5403-5407.
Lee JL, Chang CJ, Chueh LL, Lin CT. Expression of secreted frizzled-related protein 2 in a primary canine mammary tumor cell line: a candidate tumor marker for mammary tumor cells. In Vitro Cell Dev Biol Anim 2003;39:221-227.
Lindahl U, Kusche-Gullberg M, Kjellén L. Regulated diversity of heparan sulfate. J Biol Chem 1998;273:24979-24982.
Malinda KM, Ponce L, Kleinman HK, Shackelton LM, Millis AJT. Gp38k, a protein synthesized by vascular smooth muscle cells, stimulates directional migration of human umbilical vein endothelial cells. Exp Cell Res 1999;250:168-173.
61
Markert JM, Fuller Cm, Gillespie GY, Bubien JK, McLean LA, Hong RL, Lee K, Gullans SR, Mapstone TB, Benos DJ. Differential gene expression profiling in humna brain tumors.
Physiol Genomics 2001;5:21-33.
MacEwen EG. Spontaneous tumors in dogs and cats: models for the study of cancer biology and treatment. Cancer Metastasis Rev 1990;9(2):125-136.
Millis AJT, Hoyle M, Reich E, Mann DM. Isolation and characterization of a Mr=38,000 protein from differentiating smooth muscle cells. J Biol Chem 1985;260:3754-3761.
Millis AJT, Hoyle M, Kent L. In vitro expression of a 38,000 dalton heparin-binding glycoprotein by morphologically differentiated smooth muscle cells. J Cell Physiol 1986;127:366-372.
Mitsuhashi A, Matsui H, Usui H, Nagai Y, Tate S, Unno Y, Hirashiki K, Seki K, Shozu M.
Serum YKL-40 as a marker for cervical adenocarcinoma. Ann Oncol 2009;20:71-77.
Mohanty AK, Singh G, Paramasivam M, Saravanan K, Jabeen T, Sharma S, Yadav S, Kaur P, Kumar P, Srinivasan A, Singh TP. Crystal structure of a novel regulatory 40-kDa mammary gland protein (MGP-40) secreted during involution. J Biol Chem 2003;278:14451-14460.
Morrison BW, Leder P. neu and ras initiate murine mammary tumors that share genetic markers generally absent in c-myc and int-2-initiated tumors. Oncogene 1994;9:3417-3426.
62
Nielsen AR, Plomgaard P, Krabbe KS, Johansen JS, Pedersen BK. IL-6, but not TNF-α, increases plasma YKL-40 in human subjects. Cytokine 2011;55:152-155.
Nishikawa KC, Millis AJT. Gp38k (CHI3L1) is a novel adhesion and migration factor for vascular cells. Exp Cell Res 2003;287:79-87.
Nyirkos P, Golds EE. Human synovial cells secrete a 39 kDa protein similar to a bovine mammary protein expressed during the non-lactating period. Biochem J 1990;268:265-268.
Patil NS, Hall FC, Drover S, Spurrell DR, Bos E, Cope AP, Sonderstrup G, Mellins ED.
Autoantigenic HCgp39 epitopes are presented by the HLA-DM-dependent presentation pathway in human B cells. J Immunol 2001;166(1):33-41.
Perrimon N, Bernfield M. Specificities of heparan sulphate proteoglycans in developmental processes. Nature 2000;404:725-728.
Qureshi AM, Hannigan A, Campbel D, Nixon C, Wilson JB. Chitinase-like proteins are auroantigens in a model of inflammation-promoted incipient neoplasia. Genes Cancer 2011;2(1):74-87.
Recklies AD, White C, Ling H. The Chitinase 3-like protein human cartilage glycoprotein 39 (HC-gp39) stimulates proliferation of human connective-tissue cells and activates both extracellular signal-regulated kinase- and protein kinase B-mediated signaling pathways.
63
Biochem J 2002;365:119-126
Rehli M, Krause SW, Andreesen R. Molecular characterization of the gene for human cartilage gp-39 (CHI3L1), a member of the chitinase protein family and marker for late stages of macrophage differentiation. Genomics 1997;43:221-225.
Rejman JJ, Hurley WL. Isolation and characterization of a novel 39 kilodalton whey protein from bovine mammary secretions collected during the nonlactating period. Biochem Biophys Res Commun 1988;150:329-334.
Renkema GH, Boot RG, Au FL, Donker-Koopman WE, Strijland A, Muijsers AO, Hrebicek M, Aerts JMFG. Chitotriosidase, a chitinase, and the 39-kDa human cartilage glycoprotein, a chitin-binding lectin, are homologues of family 18 glycosyl hydrolases secreted by human
Renkema GH, Boot RG, Au FL, Donker-Koopman WE, Strijland A, Muijsers AO, Hrebicek M, Aerts JMFG. Chitotriosidase, a chitinase, and the 39-kDa human cartilage glycoprotein, a chitin-binding lectin, are homologues of family 18 glycosyl hydrolases secreted by human