Fig 1. Experimental designs
(A) The control BM-MSC is presented as Mctrl. The TLR2 agonist, Pam3CSK4, -treated BM-MSCs is presented as Mpam. The combination of Pam3CSK4 and the STAT3 inhibitor, S3I-201, -treated BM-MSC is presented as Ms&p. The combination of
Pam3CSK4 and the iNOS inhibitor, L-NMMA, -treated BM-MSC is presented as Ml&p.
The combination of Pam3CSK4 and the IL-6 neutralizing antibody-treated BM-MSC is presented as M6&p. The combination of Pam3CSK4 and the IgG1 k isotype control antibody-treated BM-MSC is presented as Mic&p. (B) The timeline of OVA-induced asthma murine model. Mice were intraperitoneally
(i.p.) sensitized and intranasally (i.n.) challenged using PBS in the negative control (PBS) group but using OVA in the positive control (OVA) group, and Mctrl and Mpam treatment groups. Treatment groups were intravenously (i.v.) treated with Mctrl and Mpam. The cell number used to treat this asthma murine model was 5×105 / mouse. (C) Prestimulated CD4+ T cells were cocultured with the mitomycin c-treated conditioned BM-MSCs in a 20:1 ratio. CD25+ cells were then isolated from those CD4+ T cells to make the conditioned CD4+CD25+ T cells, such as Tctrl, Tpam, Ts&p, and Tl&p. The mitomycin c-treated conditioned CD4+CD25+ T cells were finally cocultured with prestimulated CD4+ responder T cells in a 1:1 ratio.
AHR: airway hyper-responsiveness
Fig 2. Characterization of BM-MSCs
(A) Positive expression of mesenchymal lineage surface markers such as CD29, ScaI, CD73, CD44, and CD105 whereas negative expression of hematopoietic lineage surface markers such as CD11b, B220, CD34, and CD11c were determined in the mouse BM-MSCs. (B) The multipotent BM-MSCs could differentiate into adipocytes (neutral triglycerides and lipids were detected by Oil red O solution, presented as red color), osteocytes (calcium deposits were detected by Alizarin red S, presented as red color), and chondrocytes (acid mucosubstances and acetic mucins were detected by Alcian blue, presented as blue color). Results are presented using 200 X magnification. (C) The representative result from the [3H]-thymidine incorporation assay demonstrated that the diminished CD4+ T cell turnover was attributed to the suppressive effects of BM-MSCs.
(D) The representative result from the [3H]-thymidine incorporation assay demonstrated that the suppressive effects of BM-MSCs were independent of the CD4+ T cell to BM-MSC ratio (mean ± s.d.; ** p<0.005, ****p<0.00005). More than three independent repeats were conducted in each experiment, and the reproducible results were observed in each experiment.
c.p.m.: counts per minute
Fig 3. Post-treatment as a more appropriate setting of BM-MSC treatment (A) The airway hyper-responsiveness of OVA-immunized mice was improved with BM-MSCs more in the post-treatment setting (Mpost) than that in the pretreatment setting (Mpre) (n=6). (mean ± s.d.; **, ****, comparisons between OVA and the other groups, p<0.005, and p<0.00005, respectively; #, ##, ####, comparisons between Mpre and the other groups, p<0.05, p<0.005, and p<0.00005, respectively; $, $$, comparisons between Mpost and PBS groups, p<0.05, and p<0.005, respectively) (B) Less
proliferative total splenocytes were observed in the Mpost group compared to those in the Mpre group from our ex vivo experiments (n=6). (mean ± s.d.; * p<0.05, **
p<0.005).
Penh: enhanced pause, an index of airway hyperactivity, relating to ventilatory timing Penh = (peak expiratory flow / peak inspiratory flow) – [(expiratory time / time for expiration of 65% volume) -1]
Penh%: the percentage increase in Penh over baseline Penh; c.p.m.: counts per minute
Fig 4. Administering BM-MSCs in the amount of 5´105 cells resulted in higher immunosuppressive activities in vivo
(A) BM-MSCs alleviated airway hyper-responsiveness by the same extent when either 1´105 (Ma), 5´105 (Mb), or 1´106 (Mc)BM-MSCs was intravenously administered into OVA-challenged mice (n=6). (mean ± s.d.; *, **, ***, ****, comparisons between OVA and the other groups, p<0.05, p<0.005, p<0.0005, and p<0.00005, respectively;
##, ###, comparisons between Ma and the other groups, p<0.005, and p<0.0005, respectively; $$, $$$, comparisons between Mb and the other groups, p<0.005, and p<0.0005, respectively; &&&, &&&&, comparisons between Mc and PBS grouop) (B) Either 5´105 or 1´106 BM-MSCs would downregulate serum IgE level more effectively than that of 1´105 BM-MSCs (n=6). (mean ± s.d.; ** p<0.005, ***p<0.0005). (C) Only 5´105 BM-MSCs decreased IL-4 and IL-5 secretion detected in BALF more effectively than that of 1´105 or 1´106 BM-MSCs (n=6). (mean ± s.d.; *** p<0.0005,
****p<0.00005).
Penh%: the percentage increase in Penh over baseline Penh
Fig 5. TLR expression in BM-MSCs
TLR expression of BM-MSCs was examined by semi-quantitative RT-PCR. RAW264.7 cells were used as positive controls. The BM-MSCs in our system expressed all TLR subtypes but TLR9. In addition, they especially expressed large amount of TLR2, 4, 5, and 6.
Fig 6. Pam3CSK4 as the comparatively effective TLR ligand for enhancing regulatory activities in BM-MSCs
(A) The representative result from the [3H]-thymidine incorporation assay suggested that incubating BM-MSCs with Pam3CSK4 at 1 µg/mL for 72 h further enhanced the suppressive function of BM-MSCs whereas incubating BM-MSCs with a TLR3 ligand, poly (I:C) at 10 µg/mL; a TLR4 ligand, LPS at 10 µg/mL; and a TLR5 ligand, Rec-FLA-ST at 100 ng/mL for 72 h did not. (mean ± s.d.; * p<0.05, ***p<0.0005). More than three independent repeats were conducted in this experiment, and the reproducible results were observed in this experiment. (B) The expression of regulatory factors in BM-MSCs stimulated with different TLR ligands was observed using qPCR. 1 µg/mL Pam3CSK4 and 10 µg/mL LPS substantially enhanced iNOS in BM-MSCs. Statistical results were calculated with three independent repeats. (mean ± s.d.; * p<0.05, **
p<0.005, *** p<0.0005). (C) NO secretion in BM-MSCs was enhanced by incubating BM-MSCs with Pam3CSK4 at 1 µg/mL and with LPS at 10 µg/mL for 96 h. Statistical results were calculated with three independent repeats. (mean ± s.d.; *** p<0.0005).
c.p.m.: counts per minute; R.Q.: relative quantification
Fig 7. Pam3CSK4 as the comparatively effective stimulant for enhancing regulatory activities in BM-MSCs
(A) According to the representative result from the [3H]-thymidine incorporation assay, Pam3CSK4-activated BM-MSCs had the most effective immunomodulatory function among the BM-MSCs activated with different stimulants. (mean ± s.d.; * p<0.05,
**p<0.005, ***p<0.0005, ****p<0.00005). More than three independent repeats were conducted in this experiment, and the reproducible results were observed in this experiment. (B) Using qPCR assays, we observed that iNOS could be substantially enhanced through Pam3CSK4 in BM-MSCs, while ido could be enhanced through IFN-g at 200 ng/mL with or without TNF-a at 10 ng/mL in BM-MSCs. Statistical results were calculated with three independent repeats. (mean ± s.d.; * p<0.05, ** p<0.005, ***
p<0.0005, ****p<0.00005). (C) IL-1RA expression detected by ELISA assays could not be induced through IFN-g without TNF-a in BM-MSCs. Statistical results were calculated with three independent repeats. (mean ± s.d.; * p<0.05, ** p<0.005, ***
p<0.0005, **** p<0.00005).
c.p.m.: counts per minute; R.Q.: relative quantification
Fig 8. Pam3CSK4 at 1 µg/mL was chosen to modify BM-MSCs
(A) In OVA-induced asthma model, compared to 5 µg/mL (Mpam5), 1 µg/mL
Pam3CSK4-treated BM-MSCs (Mpam1) alleviated airway hyper-responsiveness more effectively (n=6). (mean ± s.d.; *, **, ****, comparisons between OVA and the other groups, p<0.05, p<0.005, and p<0.00005, respectively; #, ###, comparisons between Mctrl and the other groups, p<0.05, and p<0.0005, respectively; &, comparisons between Mpam5 and PBS groups, p<0.05) (B) There were no significant differences between Mpam1 and Mpam5 in pulmonary inflammatory cell infiltration (n=6). (mean
± s.d.; * p<0.05, ** p<0.005, *** p<0.0005) (C) In OVA-induced asthma model, compared to 5 µg/mL, 1 µg/mL Pam3CSK4-treated BM-MSCs diminished IL-5 secretion in BALF more effectively (n=6). (mean ± s.d.; * p<0.05, ** p<0.005) (D) There were no significant differences between Mpam1 and Mpam5 in serum IgE level (n=6). (mean ± s.d.; *** p<0.0005)
Penh%: the percentage increase in Penh over baseline Penh
Fig 9. Pam3CSK4 at 1 µg/mL was chosen to treat BM-MSCs for 96 h
The representative result from the [3H]-thymidine incorporation assay showed that compared to use 1 µg/mL Pam3CSK4 to treat BM-MSCs for 24 h, treating BM-MSCs with 1 µg/mL Pam3CSK4 for 96 h was a more effective regimen to enhance the
immunosuppressive function of BM-MSCs. (mean ± s.d.; * p<0.05, ** p<0.005, ****
p<0.00005). More than three independent repeats were conducted in this experiment, and the reproducible results were observed in this experiment.
Fig 10. Immunosuppressive activities of BM-MSCs were enhanced by Pam3CSK4
stimulation
The representative result from the [3H]-thymidine incorporation assay demonstrated that the diminished CD4+ T cell turnover attributed to the suppressive effects of BM-MSCs was further diminished by the enhanced suppressive function of the Pam3CK4-treated BM-MSCs (mean ± s.d.; ** p<0.005, *** p<0.0005). More than three independent repeats were conducted in this experiment, and the reproducible results were observed in this experiment.
Fig 11. Mpam ameliorated systemic inflammation of asthmatic mice more effectively than did Mctrl
(A) Serum samples were collected from mice on day 31, immediately before sacrifices or invasive airway resistance measurements were performed. Serum IgG1/IgG2a levels were downregulated more effectively with Mpam than they were with Mctrl (n=5). (B) The IL-13 expression in the supernatants of OVA-stimulated splenocytes was
significantly downregulated only in the Mpam treatment group (n=5). (mean ± s.d.; * p<0.05, ** p<0.005, *** p<0.0005)
Fig 12. Mpam alleviated local symptoms of asthmatic mice more effectively than did Mctrl
(A) The expression of IL-4 and IL-5 in the BALF was further downregulated with Mpam than it was with Mctrl treatment (n=5). (B) Infiltrated cells were collected and counted from BALF. Eosinophil infiltration was much less in the Mpam treatment group than that in the Mctrl treatment group (n=5). (C) Less eosinophil infiltration in the Mpam treatment group than that in the Mctrl treatment group was confirmed using flow cytometry (n=5). (mean ± s.d.; * p<0.05, ** p<0.005, *** p<0.0005)
Fig 13. Compared to Mctrl, Mpam was more likely to improve airway remodeling in asthmatic mice
(A) Examined by the plethysmograph with paralyzed and tracheotomized mice, the airway resistance of OVA-induced asthmatic mice could be further alleviated with the Mpam therapy compared with the Mctrl therapy in response to 6.25 and 12.5 mg/mL of β-methacholine administrations (n=8). (mean ± s.d.; **, ***, comparisons between OVA and the other groups, p<0.005, and p<0.0005, respectively; #, ###, comparisons between Mctrl and the other groups, p<0.05, and p<0.0005, respectively; $,
comparisons between Mpam and PBS groups, p<0.05) (B) Lung tissues were dissected and then made into paraffin sections. Hematoxylin was used as a positive stain colored basophilic nuclei violet, and eosin was used as a negative contrast stained acidophilic proteins in cytoplasm pink. Both Mctrl and Mpam treatments were demonstrated to diminish inflammatory cell infiltration and bronchial epithelial thickness. Results were presented using 100 X magnification. (C) Lung tissues were dissected and then RNA extraction and reverse transcription were performed sequentially. The expression of muc5ac was further downregulated in the Mpam more than it was in the Mctrl group, implying that Mpam might abolish mucin hypersecretion more effectively in the airways (n=8). (mean ± s.d.; p<0.005; * p<0.05, ** p<0.005, *** p<0.0005) R.Q.: relative quantification
Fig 14. Pam3CSK4 changed the multipotent stem cell properties of BM-MSCs (A) Mpam was found to form more colonies than Mctrl according to our colony
formation assays. The representative result presents that Mctrl and Mpam grew 482 and 662 colonies, respectively. (B) The expression of the stem cell factor, Sca-1, was slightly enhanced in Mpam, compared to that in Mctrl. (C) Under the adipogenic condition, while Pam3CSK4 seemed to impair the adipogenic ability of normal mice-derived BM-MSCs, BM-MSCs isolated from TLR2 knockout mice were more prone to differentiate into adipocytes. More than three independent repeats were conducted in each experiment, and the reproducible results were observed in each experiment.
Fig 15. The enhanced cell-cell contact-dependent suppressive effect of Mpam was through the TLR2/STAT3/iNOS signaling pathway
(A) The [3H]-thymidine incorporation assays were done with or without transwell insertions. The immunosuppressive function of BM-MSCs was enhanced by Pam3CSK4
activation through STAT3 signaling pathway in a cell-cell contact-dependent manner.
(B) Compared to the Mctrl-treated group, less eosinophils infiltrated to lungs in the Mpam-treated asthmatic mice. However, such diminished eosinophil infiltration in the Mpam-treated group was reversed in the Ms&p-treated group (n=5). (C) The
upregulation of iNOS, il-1ra, tsg-6, and hgf expression stimulated with Pam3CSK4 in BM-MSCs was abolished by S3I-201 incorporation. (D)(E) The upregulation of NO and IL-1RA expression stimulated with Pam3CSK4 in BM-MSCs, consistent with the results at mRNA level, was abolished by S3I-201 incorporation. Statistical results were
calculated with three independent repeats in in vitro experiments. (mean ± s.d.; * p<0.05, ** p<0.005, *** p<00005)
R.Q.: relative quantification
Fig 16. The mobility of BM-MSCs might be increased with Pam3CSK4 treatment The expression of ccl7 (detected by qPCR), mcp-1 (detected by qPCR), CCL3 (detected by ELISA), CCL5 (detected by ELISA), and VCAM-1 (detected by flow cytometry) was upregulated in Mpam. Further, the upregulated expression of ccl7 and CCL5 in Mpam was reduced when we treated Mpam with either STAT3 or iNOS inhibitor. The upregulated expression of VCAM-1 in Mpam was reduced when we treated Mpam with STAT3 inhibitor. Statistical results were calculated with three independent repeats.
(mean ± s.d.; * p<0.05, ** p<0.005, *** p<00005) R.Q.: relative quantification
Fig 17. The immunoprivileged properties of conditioned BM-MSCs
TLR2 activation did not significantly affect the immunoprivileged properties of BM-MSCs. (Mctrl was presented using a black line, Mpam was presented using a red line, Ms&p was presented using a yellow line, and Ml&p was presented using a blue dotted line).
Fig 18. The molecules indicating apoptosis and anergy in CD4+ T cells were not induced by Mpam
(A) The expression of FAS and PD-1 detected by flow cytometry showed no differences between all the different conditioned CD4+ T cells. (B) The expression of caspase-3 and itch detected by qPCR showed no differences between all the different conditioned CD4+ T cells. Statistical results were calculated with three independent repeats.
R.Q.: relative quantification
Fig 19. Mpam induced more regulatory T cells
(A) Mpam further diminished CD4+ T cell proliferation through STAT3/iNOS pathway.
(mean ± s.d.; ** p<0.005, **** p<0.00005). The representative result from the [3 H]-thymidine incorporation assay is presented here. More than three independent repeats were conducted in this experiment, and the reproducible results were observed in this experiment. (B) The increased NO secretion of Mpam was diminished through STAT3 or iNOS inhibition. Statistical results were calculated with three independent repeats.
(mean ± s.d.; *** p<0.0005). (C) Only the Mpam-educated CD4+CD25+ T cells were able to significantly inhibit the Tresp proliferation. Moreover, this phenomenon was reversed when the Mpam was treated with the iNOS inhibitor. (mean ± s.d.; ** p<0.005,
*** p<0.0005, **** p<0.00005). The representative result from the [3H]-thymidine incorporation assay is presented here. More than three independent repeats were conducted in this experiment, and the reproducible results were observed in this experiment.
c.p.m.: counts per minute
Fig 20. More CD4+CD25+Foxp3+ T cells were detected after the Mpam treatment in vitro and in vivo
(A) Compared with the noneducated CD4+CD25+ T cells (Tnaive), the expression of tgf-b and il-10 was not significantly changed in Tctrl, Tpam, Ts&p, and Tl&p.
Statistical results were calculated with three independent repeats. (B) Compared with the noneducated CD4+CD25+ T cells (Tnaive), the expression of GITR and CTLA-4 was not significantly changed in Tctrl, Tpam, Ts&p, and Tl&p. Statistical results were calculated with three independent repeats. (C)(D) Compared to the noneducated CD4+CD25+ T cells, the expression of foxp3 was upregulated only in the Mpam-educated CD4+CD25+ T cells both at mRNA and protein levels. Statistical results were calculated with three independent repeats. (mean ± s.d.; * p<0.05, *** p<0.0005) (E) Total mononuclear cells and CD4+CD25+Foxp3+ cells isolated from lung tissues were examined using flow cytometry. In the asthma murine model, compared to the Mctrl treatment, the Mpam treatment decreased total mononuclear cell recruitment to lung tissue, however, increased the percentage of CD4+CD25+Foxp3+ cells in lung tissue (n=5). (mean ± s.d.; * p<0.05, ** p<0.005, *** p<0.0005, **** p<0.00005)
R.Q.: relative quantification
Fig 21. Pam3CSK4 induced NF-κB/STAT3/iNOS signals in BM-MSCs
Sequential activation of NF-κB, STAT3 and iNOS signaling was evidenced using Western blot. Pam3CSK4 induced IκB degradation, and consequently made NF-κB phosphorylated. The activation of the downstream STAT3/iNOS signaling pathway was established using a STAT3 inhibitor, S3I-201. Less iNOS expression was detected when the STAT3 phosphorylation was abolished through S3I-201in Ms&p.
Fig 22. IL-6 Mediated NF-κB/STAT3 signaling in Mpam
(A) IL-6 over-secretion was induced with Pam3CSK4 irrespective of S3I-201 or L-NMMA inhibition. Statistical results were calculated with three independent repeats.
(mean ± s.d.; **** p<0.00005; n.d.= not detected). (B) Using Western blot, enhanced iNOS expression by Pam3CSK4 induction was abolished when IL-6 neutralizing antibody was added. (C) The enhanced suppressive function of BM-MSCs with Pam3CSK4 treatment was diminished when IL-6 neutralizing antibody was added.
(mean ± s.d.; ** p<0.005, *** p<0.0005, **** p<0.00005). The representative result from the [3H]-thymidine incorporation assay is presented here. More than three independent repeats were conducted in this experiment, and the reproducible results were observed in this experiment.
R.Q.: relative quantification; c.p.m.: counts per minute
Fig 23. Proposed mechanisms of the enhanced immunosuppressive properties of Mpam
After IκB, an inhibitor of NF-κB, was degraded through Pam3CSK4 stimulation, IκB was dissociated from NF-κB. The released NF-κB was subsequently phosphorylated at S536 and was further translocated into the nucleus. In the downstream of NF-κB, IL-6 production was increased in Mpam. IL-6 in turn phosphorylated STAT3. NO, the key suppressive molecule of BM-MSCs, was later highly increased through upregulated iNOS expression, which was in the downstream of STAT3 phosphorylation. The intensified suppressive functions of BM-MSCs were finally executed by inducing CD4+CD25+Foxp3+ regulatory T cells in a cell-cell contact-dependent manner.
Chapter VIII: Appendix
Semi-quantitative PCR primers
TLR Primer sequence Size (bp) Anealing
temperature (℃)
Real-time PCR primers
Primer sequence Size (bp) Anealing
temperature (℃) muc5ac CCATGCAGAGTCCTCAGAACA A
TTACTGGAA AGGCCCAAGCA
106 60
inos GGCAGCCTGTGAGACCTTTG
GCATTGGAAGTGAAGCGTTTC
72 60
il-1ra GACCCTGCAAGATGCAAGCC GAGCGGATGAAGGTAAAGCG
292 60
foxp3 TACCACAATATGCGACCC CTCAAATTCATCTACGGTCC
240 53
gapdh GATGGGTGTGAACCACGAGA AGATCCACGACGGACACAT
339 60
Table 1. Primer sequences used in this study
Fig 1. MSCs suppress immune cells directly and/or indirectly
MSCs suppress T cells, macrophages, dendritic cells (DCs), neutrophils, and B cells directly either through soluble regulatory factors or through cell-cell contact. In addition, indirectly mediated by macrophages and DCs, MSCs are able to suppress T cells and neutrophils.
Fig 2. MSCs suppress proinflammatory T cell subsets and natural killer cells while stimulating regulatory T cell subsets
MSCs suppress proinflammatory natural killer cells and T cell subsets such as Th1, Th17, and cytotoxic T cells through soluble regulatory factors including PGE2 and IDO. However, MSCs can induce regulatory T cell subsets such as Th3 and Treg.
Fig 3. MSCs polarize macrophages into regulatory macrophages, instead of proinflammatory macrophages
When macrophages coculture with MSCs, they are polarized to regulatory macrophages which highly express mannose receptor CD206 and IL-10. In contrast, proinflammatory macrophages, which highly secrete TNF-α and IL-12, are unlikely to be induced by MSCs. This phenomenon is related to PGE2, GM-CSF, and IL-6.
Fig 4. MSCs inhibit the differentiation, maturation, and proinflammatory polarization processes of DCs
MSCs arrest the cell cycle of monocytes in G0. The differentiation of DCs from peripheral blood monocytes is thus inhibited. IL-6 secreted by MSCs inhibits the maturation of DCs. Moreover, MSCs polarize DCs into regulatory DC2, rather than proinflammatory DC1.
Fig 5. Structure and signaling pathway of TLR2
(A) TLR2 is composed by the N-terminal extracellular domain, the transmembrane domain, and the C-terminal intracellular domain. (B) TLR2 signaling pathway starts with TLR2 ligands binding to TLR2. The recruitment of MyD88 to the receptor complex then leads to the recruitment of IL-1 receptor-associated kinase (IRAK) and IRAK2. Following IRAK recruitment, TNF receptor-assiciated factor (TRAF) 6, TGF-b-activated kinase (TAK) 1, and TAK1 binding protein (TAB) 1 were activated.
Activated TAK1 thereby activates IκB kinase (IKK)-b.
Chapter IX: Abbreviations TLR: toll-like receptor
BM-MSC: bone marrow-derived mesenchymal stem cell IkB: inhibitor of kB
NF-kB: nuclear factor-kB IL-6: interleukin-6
STAT3: signal transducer and activator of transcription 3 iNOS: inducible nitric oxide synthase
Ms&p: the combination of Pam3CSK4 and S3I-201-treated MSCs Ml&p: the combination of Pam3CSK4 and L-NMMA-treated MSCs
M6&p: the combination of Pam3CSK4 and IL-6 neutralizing antibody-treated MSCs Mic&p: the combination of Pam3CSK4 and IgG1 k isotype control antibody-treated MSCs
Tnaive: non-educated CD4+ T cells Tctrl: Mctrl-educated CD4+ T cells Tpam: Mpam-educated CD4+ T cells Ts&p: Ms&p-educated CD4+ T cells Tl&p: Ml&p-educated CD4+ T cells