In previously study, REP3 has been identified as a potential trans-acting regulatory factor in the regulation of CDR1 expression. The result of this study provides the information that rep3/rep3 homozygous knockout is more sensitive to azoles than wild type.
However, complementation of REP3 in rep3/rep3 homozygous strains can not restore the phenotype of drug susceptibility. However, the molecular mechanism and the REP3 network regulating the expression of CDR1 and drug resistance are poorly understood.
There are still more for future analyses.
1. In order to investigate which molecular mechanism that REP3 is involved in drug resistance, it may be necessary to test the experiment conditions determining the expression of CDR1 and other genes of drug susceptibility in C. albicans by real-time PCR or Northern blot. The conditions for the test may include the temperations of growth, time of drug treatment. This is to determine whether the REP3 is involved in the drug resistance through the regulation of CDR1 or other genes in C. albicans.
2. The rep3/rep3::REP3 rescued strains with SAT1 flipping method shall be confirmed by Southern blot. Southern blot analysis can demonstrate that REP3 is correctly integrated at the proper chromosome location and does not disrupt other genes. It can also determine that all Nous clones had correctly excised the SAT1 flipper by FLP-mediated recombination.
3. Sequencing results of three independent plasmids which integrated into homozygous mutants at REP3 locus showed differences with the sequence of contig19-10194 from
Assembly 19 (http://www.candidagenome.org/). If the point mutations on the REP3 rescue plasmids cause the failure of rescued strains, it is necessary to construct the specific REP3 sequence in rescue plasmids in the further.
4. ORF19.3926, which locates at the down stream 266 bps from REP3, increased the expression level in the presence of miconazole in the strains rescued by pWJB24. It is necessary to determine the espression of orf19.3926 in the rep3/rep3::REP3 rescued strains reconstructed with SAT1 flipping method.
5. Construction of the REP3 over-expression strains for investigating the drug susceptibility. Consistently, cells overexpressing REP3 were hyper-resistant to specific kind of azoles than the wild-type cells. The phenotype may be opposite in the homozygous knockout strains.
6. Since rep3/rep3 homozygous mutants are from the same REP3/rep3 heterozygous mutant strain. Consequently, it is important to determine the drug susceptibility of this REP3/rep3 heterozygous mutant strain in further study. The phenotype of rep3/rep3 homozygous mutants has probably existed in REP3/rep3 heterozygous mutant strain.
References
1. Alarco, A. M. and Raymond, M. 1999. The bZip transcription factor Cap1p is involved in multidrug resistance and oxidative stress response in Candida albicans. J. Bacteriol.
181:700-708.
2. Alarco, A. M., Balan, I., Talibi, D., Mainville, N. and Raymond, M. 1997. AP1-mediated multidrug resistance in Saccharomyces cerevisiae requires FLR1 encoding a transporter of the major facilitator superfamily. J. Biol. Chem. 272:19304-19313.
3. Bader, T., Bodendorfer, B., Schröppel, K. and Morschhäuser, J. 2003. Calcineurin is essential for virulence in Candida albicans. Infect. Immun. 71:5344-5354.
4. Beck-Sague, C. M. and Jarvis, W. R. 1993. Secular trends in the epidemiology of nosocomial fungal infections in the United States, 1980–1990. National Nosocomial Infections Surveillance. Syst. J. Infect. Dis. 167:1247-1251.
5. Ben-Yaacov, R., Knoller, S., Caldwell, G. A., Becker, J. M. and Koltin, Y. 1994.
Candida albicans gene encoding resistance to benomyl and methotrexate is a multidrug resistance gene. Antimicrob. Agents Chemother. 38:648-652.
6. Blankenship, J. R., Wormley, F. L., Boyce, M. K., Schell, W. A., Filler, S. G., Perfect, J.
R. and Heitman, J. 2003. Calcineurin is essential for Candida albicans survival in serum and virulence. Eukaryot. Cell 2:422-430.
7. Boustany, L. M. and Cyert, M. S. 2002. Calcineurin-dependent regulation of Crz1p nuclear export requires Msn5p and a conserved calcineurin docking site. Genes Dev.
16:608-619.
8. Boschman, C. R., Bodnar, U. R., Tornatore, M. A., Obias, A. A., Noskin, G. A., Englund, K., Postelnick, M. A., Suriano, T. and Peterson, L. R. 1998. Thirteen-year evolution of azole resistance in yeast isolates and prevalence of resistant strains carried by cancer
patients at a large medical center. Antimicrobial Agents and Chemotherapy. 42:734-8.
9. Bruno, V. M. and Mitchell, A. P. 2005. Regulation of azole drug susceptibility by Candida albicans protein kinase CK2. Mol. Microbiol. 56:559-573.
10. Chen, Y. C., Chang, S. C., Luh, K. T. and Hsieh, W. C. 2003. Stable susceptibility of Candida blood isolates to fluconazole despite increasing use during the past 10 years. J.
Antimicrob. Chemother. 52:71-77.
11. Chen, C. G., Yang, Y. L., Shih, H. I., Su, C. L. and Lo, H. J. 2004. CaNdt80 is involved in drug resistance in Candida albicans by regulating CDR1. Antimicrob. Agents Chemother. 48:4505-4512.
12. Chu, S. and Herskowitz, I. 1998. Gametogenesis in yeast is regulated by a transcriptional cascade dependent on Ndt80. Mol. Cell. 1:685-696.
13. Cruz, M. C., Goldstein, A. L., Blankenship, J. R., Del Poeta, M., Davis, D., Cardenas, M.
E., Perfect, J. R., McCusker, J. H. and Heitman, J. 2002. Calcineurin is essential for survival during membrane stress in Candida albicans. EMBO J. 21:546-559.
14. Coste, A. T., Karababa, M., Ischer, F., Bille, J. and Sanglard, D. 2004. TAC1, transcriptional activator of CDR genes, is a new transcription factor involved in the regulation of Candida albicans ABC transporters CDR1 and CDR2. Eukaryot. Cell.
3:1639-1652.
15. Coste, A., Turner, V., Ischer, F., Morschhauser, J., Forche, A., Selmecki, A., Berman, J., Bille, J. and Sanglard, D. 2006. A mutation in Tac1p, a transcription factor regulating CDR1 and CDR2, is coupled with loss of heterozygosity at chromosome 5 to mediate antifungal resistance in Candida albicans. Genetics. 172(4):2139–2156.
16. D'Alessio, G. and Riordan, J. S. 1997. Ribonucleases: Structures and Functions. New York: Academic; pp. 101–130.
17. Dean, M. 2005 The genetics of ATP-binding cassettetransporters. Methods Enzymol. 400:
409-429.
18. de Micheli, M., Bille, J., Schueller, C. and Sanglard, D. 2002. A common
drug-responsive element mediates the upregulation of the Candida albicans ABC transporters CDR1 and CDR2, two genes involved in antifungal drug resistance. Mol.
Microbiol. 43:1197-1214.
19. Edmond, M. B., Wallace, S. E., McClish, D. K., Pfaller, M. A., Jones, R. N. and Wenzel, R. P. 1999. Nosocomial bloodstream infections in United States hospitals: a three-year analysis. Clin. Infect. Dis. 29:239-244.
20. Feigal, D. W., Katz, M. H., Greenspan, D., Westenhouse, J., Winkelstein, W. J., Lang, W., Samuel, M., Buchbinder, S. P., Hessol, N, A. and Lifson, A. R. 1991. The prevalence of oral lesions in HIV-infected homosexual and bisexual men: three San Francisco epidemiological cohorts. AIDS. 5:519-525.
21. Franz, R., Kelly, S. L., Lamb, D. C., Kelly, D. E., Ruhnke, M. and Morschhauser, J. 1998.
Multiple molecular mechanisms contribute to a stepwise development of fluconazole resistance in clinical Candida albicans strains. Antimicrob Agents Chemother 42:3065- 3072.
22. Georgopapadakou, N. H. 2001. Update on antifungals targeted to the cell wall: focus on beta-1,3-glucan synthase inhibitors. Expert. Opin. Investig. Drugs. 10:269-280.
23. Ghannoum, M. A. and Rice, L. B. 1999. Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin.
Microbiol. Rev. 12:501-517.
24. Goldway, M., Teff, D., Schmidt, R., Oppenheim, A. B. and Koltin, Y. 1995. Multidrug resistance in Candida albicans: disruption of the BENr gene. Antimicrob. Agents Chemother. 39:422-426.
25. Harry, J. B., Oliver, B. G., Song, J. L., Silver, P. M. and Little, J. T. 2005 Drug-induced regulation of the MDR1 promoter in Candida albicans. Antimicrob. Agents Chemother.
49:2785-2792.
26. Heath, V. L., Shaw, S. L., Roy, S. and Cyert, M. S. 2004. Hph1p and Hph2p, novel components of calcineurin-mediated stress responses in Saccharomyces cerevisiae.
Eukaryot. Cell. 3:695-704.
27. Hiller, D., Stahl, S. and Morschhäuser, J. 2006. Multiple cis-acting sequences mediate upregulation of the MDR1 efflux pump in a fluconazole-resistant clinical Candida albicans isolate. Antimicrob. Agents Chemother. 50:2300-2308.
28. Hitchcock, C. A. 1991. Cytochrome P-450-dependent 14 alpha-sterol demethylase of Candida albicans and its interaction with azole antifungals. Biochem. Soc. Trans. 19:
782-787.
29. Jensen-Pergakes, K. L., Kennedy, M. A., Lees, N. D., Barbuch, R., Koegel, C. and Bard, M. 1998. Sequencing, disruption, and characterization of the Candida albicans sterol methyltransferase (ERG6) gene: drug susceptibility studies in erg6 mutants. Antimicrob.
Agents Chemother. 42:1160-1167.
30. Jia, N., Arthington-Skaggs, B. A., Lee, W., Pierson, C. A., Lees, N. D., Eckstein, J., Barbuch, R. and Bard., M. 2002. Candida albicans sterol C-14 reductase, encoded by the ERG24 gene, as a potential antifungal target site. Antimicrob. Agents Chemother.
46:947-957.
31. Karnani, N., Gaur, N. A., Jha, S., Puri, N., Krishnamurthy, S., Goswami, S. K., Mukhopadh-yay, G. and Prasad, R. 2004. SRE1 and SRE2 are two specific steroid-responsive modules of Candida drug resistance gene 1 (CDR1) promoter. Yeast.
21:219-239.
32. Kelly, S. L., Lamb, D. C., Kelly, D. E., Manning, N. J., Loeffler, J., Hebart, H., Schumacher, U. and Einsele, H. 1997. Resistance to fluconazole and cross-resistance to amphotericin B in Candida albicans from AIDS patients caused by defective sterol delta5,6-desaturation. FEBS Lett. 400:80-82.
33. Khvorova, A., Kwak, Y. G., Tamkun, M., Majerfeld, I. and Yarus, M. RNAs that bind and change the permeability of phospholipid membranes. 1999. Proc Natl Acad Sci.
96:10649–10654.
34. Klein, R. S., Harris, C. A., Small, C. B., Moll, B., Lesser, M. and Friedland, G. H. 1984.
Oral candidiasis in high-risk patients as the initial manifestation of the acquired immunodeficien- cy syndrome. N. Engl. J. Med. 311:354-358.
35. Kofron, M., Demel, T., Xanthos, J., Lohr, J., Sun, B., Sive, H., Osada, S., Wright, C., Wylie, C. and Heasman, J. 1999. Mesoderm induction in Xenopus is a zygotic event regulated by maternal VegT via TGFbeta growth factors. Development. 126:5759-5770.
36. Krishnamurthy, S., Gupta, V., Prasad, R., Panwar, S. L. and Prasad, R. 1998. Expression of CDR1, a multidrug resistance gene of Candida albicans: transcriptional activation by heat shock, drugs and human steroid hormones. FEMS Microbiol. Lett. 160:191-197.
37. Leelaporn, A., Firth, N., Byrne, M. E., Roper, E. and Skurray, R. A. 1994. Possible role of insertion sequence IS257 in dissemination and expression of high- and low-level trimethop-rim resistance in staphylococci. Antimicrob. Agents Chemother. 38:2238-2244.
38. Letscher-Bru, V. and Herbrecht, R. 2003. Caspofungin: the first representative of a new antifungal class. J. Antimicrob. Chemother. 51:513-521.
39. Lyons, C. N. and White, T. C. 2000. Transcriptional analyses of antifungal drug resistance in Candida albicans. Antimicrob. Agents Chemother. 44:2296-2303.
40. Lopez-Ribot, J. L., McAtee, R. K., Perea, S., Kirkpatrick, W. R., Rinaldi, M. G. and Patterson, T. F. 1999. Multiple Resistant Phenotypes of Candida albicans Coexist during Episodes of Oropharyngeal Candidiasis in Human Immunodeficiency Virus-Infected Patients. Antimicrob. Agents Chemother. 43:1621-1630.
41. Lupetti, A., Danesi, R., Campa, M., Tacca, M. D. and Kelly, S. 2002. Molecular basis of resistance to azole antifungals. Trends Mol. Med. 8:76–81.
42. MacIntosh, G. C., Bariola, P. A., Newbigin, E. and Green, P. J. 2001. Characterization of Rny1, the Saccharomyces cerevisiae member of the T2 RNase family of RNases:
Unexpected functions for ancient enzymes? Proc Natl Acad Sci U S A.January 30; 98(3):
1018–1023.
43. Marchetti, O., Entenza, J. M., Sanglard, D., Bille, J., Glauser, M. P. and Moreillon, P.
2000. Fluconazole plus cyclosporine: a fungicidal combination effective against experimental endocarditis due to Candida albicans. Antimicrob. Agents Chemother.
44:2932-2938.
44. Marchetti, O., Moreillon, P., Glauser, M. P., Bille, J. and Sanglard, D. 2000. Potent synergism of the combination of fluconazole and cyclosporine in Candida albicans.
Antimicrob. Agents Chemother. 44:2373-2381.
45. Matheos, D. P., Kingsbury, T. J., Ahsan, U. S. and Cunningham, K. W. 1997.
Tcn1p/Crz1p, a calcineurin-dependent transcription factor that differentially regulates gene expression in Saccharomyces cerevisiae. Genes Dev. 11:3445-3458.
46. Miller, L. G., Hajjeh, R. A. and Edwards, J. E., Jr. 2001. Estimating the cost of nosocomial candidemia in the united states. Clin. Infect. Dis. 32:1110.
47. Morschhauser, J. 2002. The genetic basis of fluconazole resistance development in Candida albicans. Biochim. Biophys. Acta—Mol. Basis Dis. 1587:240-248.
48. Odds, F. C., Brown, A. J. and Gow, N. A. 2003. Antifungal agents: mechanisms of action.
Trends Microbiol. 11:272-279.
49. Onyewu, C., Blankenship, J. R., Del Poeta, M. and Heitman, J. 2003. Ergosterol biosynthesis inhibitors become fungicidal when combined with calcineurin inhibitors in Candida albicans, Candida glabrata, and Candida krusei. Antimicrob. Agents Chemother. 47:956-964.
50. Parks, L. W. and Casey, W. M. 1995. Physiological implications of sterol biosynthesis in yeast. Annu. Rev. Microbiol. 49:95-116.
51. Perea, S., Lopez-Ribot, J. L., Kirkpatrick, W. R., McAtee, R. K., Santillan, R. A., Martinez, M., Calabrese, D., Sanglard, D. and Patterson, T. F. 2001. Prevalence of molecular mechan-isms of resistance to azole antifungal agents in Candida albicans strains displaying high-level fluconazole resistance isolated from human immunodeficiency virus-infected patients. Antimicrob. Agents Chemother. 45:2676-2684.
52. Pfaller, M. A., Jones, R. N., Messer, S. A., Edmond, M. B. and Wenzel, R. P. 1998.
National surveillance of nosocomial blood stream infection due to Candida albicans:
frequency of occurrence and antifungal susceptibility in the SCOPE Program. Diagn.
Microbiol. Infect. Dis. 31:327-332.
53. Prasad, R., De Wergifosse, P., Goffeau, A. and Balzi, E. 1995. Molecular cloning and characterization of a novel gene of Candida albicans, CDR1, conferring multiple resistance to drugs and antifungals. Curr Genet. 27:320-329.
54. Puri, N., Krishnamurthy, S., Habib, S., Hasnain, S. E., Goswami, S. K. and Prasad, R.
1999. CDR1, a multidrug resistance gene from Candida albicans, contains multiple regulatory domains in its promoter and the distal AP-1 element mediates its induction by miconazole. FEMS Microbiol. Lett. 180:213-219.
55. Radding, J. A., Heidler, S. A. and Turner, W. W. 1998. Photoaffinity analog of the semisynthetic echinocandin LY303366: identification of echinocandin targets in Candida albicans. Antimicrob. Agents Chemother. 42:1187-1194.
56. Reuß, O., Vik, Å., Kolter, R. and Morschhäuser, J. 2004. The SAT1 flipper, an optimized tool for gene disruption in Candida albicans. Gene. 341:119-127.
57. Ruhnke, M., Eigler, A. and Tennagen, I. 1994. Emergence of fluconazole-resistant strains of Candida albicans in patients with recurrent oropharyngeal candidosis and human immunodeficiency virus infection. Journal of Clinical Microbiology. 32:2092-8.
58. Rustad, T. R., Stevens, D. A., Pfaller, M. A. and White, T. C. 2002 Homozygosity at the Candida albicans MTL locus associated with azole resistance. Microbiology. 148:1061-
1072.
59. Sanglard, D., Ischer, F., Parkinson, T., Falconer, D. and Bille, J. 2003. Candida albicans mutations in the ergosterol biosynthetic pathway and resistance to several antifungal agents. Antimicrob. Agents Chemother. 47:2404-412.
60. Sanglard, D., Isher, I., Calabrese, D., de Micheli, M. and Bille, J., (1998b) Multiple mechanisms to azole antifungals in yeast. Drug Resistance Updates. 1:255-265.
61. Sanglard, D., Ischer, F., Marchetti, O., Entenza, J. and Bille, J. 2003. Calcineurin A of Candida albicans: involvement in antifungal tolerance, cell morphogenesis and virulence.
Mol. Microbiol. 489:59-76.
62. Sanglard, D., Kuchler, K., Ischer, F., Pagani, J. L., Monod, M. and Bille, J. 1995.
Mechanisms of resistance to azole antifungal agents in Candida albicans isolates from AIDS patients involve specific multidrug transporters. Antimicrob Agents Chemother. 39:
2378-2386.
63. Smits, G. J., Kapteyn, J. C., van den Ende, H, and Klis, F. M. 1999. Cell wall dynamics in yeast. Curr Opin Microbiol. 2:348–352.
64. Sundriyal, S., Sharma, R. K. and Jain, R. 2006. Current advances in antifungal targets and drug development. Curr. Med. Chem. 13, 1321-1335.
65. Spreghini, E., Davis, D. A., Subaran, R., Kim, M. and Mitchell, A. P. 2003. Roles of Candida albicans Dfg5p and Dcw1p cell surface proteins in growth and hypha formation.
Eukaryot Cell. Aug. 2(4):746-55.
66. Stathopoulos, A. M. and Cyert, M. S. 1997. Calcineurin acts through the CRZ1/TCN1- encoded transcription factor to regulate gene expression in yeast. Genes Dev.
11:3432-3444.
67. Stathopoulos-Gerontides, A., Guo, J. J. and Cyert, M. S. 1999. Yeast calcineurin regulates nuclear localization of the Crz1p transcription factor through dephosphorylation. Genes Dev. 13:798-803.
68. Tkacz, J. S. and DiDomenico, B. 2001. Antifungals: what's in the pipeline. Curr. Opin.
Microbiol. 4:540-545.
69. Vanden Bossche, H., Marichal, P. and Odds, F. C. 1994a. Molecular mechanisms of drug resistance in fungi. Trends Microbiol. 2:393-400.
70. White, T. 1997. Increased mRNA levels of ERG16, CDR, and MDR1 correlates with increased resistance in azole resistance in Candida albicans isolates from patients infected with human immunodeficiency virus. Antimicrob Agents Chemother.
41:1482-1487.
71. White, T. C., Marr, K. A. and Bowden, R. A. 1998. Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin. Microbiol. Rev. 11:382-402.
72. Wirsching, S., Michel, S., Kohler, G. and Morschhauser, J. 2000. Activation of the multiple drug resistance gene MDR1 in fluconazole-resistant, clinical Candida albicans strains is caused by mutations in a trans-regulatory factor. J. Bacteriol. 182:400-404.
73. Yang, Y. L. and Lo, H. J. 2001. Mechanisms of antifungal agent resistance. J Microbiol Immunol Infect. 34:79-86.
74. Young, L. Y., Hull, C. M. and Heitman, J. 2003. Disruption of ergosterol biosynthesis confers resistance to amphotericin B in Candida lusitaniae. Antimicrob. Agents Chemother. 47:2717-2724.
75. 紀錦昇 Chin-Sheng Chi 2004
在藥物誘導下分離鑑定白色念珠菌之調控因子
Isolation and identification of trans-regulatory factors of CDR1 in Candida albicans.
Master thesis, Institute of Biological Science and Technology, National Chiao Tung University.
76. 吳宛真 Wan-Jen Wu 2005
白色念珠菌抗藥基因CDR1 之異位調控因子 REP3、REP4 與 REP5 之遺傳學研究
Genetic study of trans-regulatory factors REP3, REP4 and REP5 of the drug resistant
gene CDR1 in Candida albicans.
Master thesis, Institute of Biological Science and Technology, National Chiao Tung University.
Table 1. The recombinant plasmid.
Plasmid Lab No. Description Source
pGEM-HIS1 LOB14 A vector contained CaHIS1 , AmpR (Wilson et al ., 1999) pDDB78 LOB83 A vector constructed from in vivo recombination of (Spreghini et al ., 2003)
pRS314 and CaHIS1 fragment from pGEM-HIS1 , AmpR
pGEM-URA3 LOB15 A vector contained CaURA3 , AmpR (Wilson et al ., 1999) pRSARG4 △Spe1 LOB16 yeast 2μ ori , E. coli ColE1 ori , ARG4 , AmpR (Wilson et al ., 1999) pSFS2 LOB223 The plasmid contains a C. albicans -adapted
nourseothricin resistance marker, CaSAT1 , AmpR (Wirsching et al ., 2000b)
pWJB24 WJB24 backbone. (Wan-Jan Wu, 2005)
Used to rescue REP3 function in rep3/rep3 mutant strains.
CaHIS1 , AmpR
pCJB1 CJB1 The plasmid containing A region(dpl200:URA3:dpl200 This study from -558 ~ -721 and REP3 from +130 ~ +218)
in the pSFS2 backbone. CaSAT1 , AmpR
pCJB6 CJB6 The plasmid containing full length of REP3 in the This study pGEM-T easy backbone.
(orf19.3926 : +1188 ~ orf19.3929 : +58), AmpR
pCJB7 CJB7 The plasmid containing full length of REP3 in the This study pGEM-T easy backbone.
(orf19.3926 : +1188 ~ orf19.3929 : +58), AmpR
pCJB8 CJB8 The plasmid containing full length of REP3 in the This study pGEM-T easy backbone.
(orf19.3926 : +1188 ~ orf19.3929 : +58), AmpR
pCJB11 CJB11 The plasmid containing B region full length of REP3 This study in the pCJB6 backbone.
Used to rescue REP3 function in rep3/rep3 mutant strains by SAT1 method. CaSAT1 , AmpR
pCJB15 CJB15 The plasmid containing B region full length of REP3 This study in the pCJB8 backbone.
Used to rescue REP3 function in rep3/rep3 mutant strains by SAT1 method. CaSAT1 , AmpR
Note. AmpR, ampicillin resistant
Table 2. Candida albicans used in this study
parental strain
SC5314 Wild type strain. (Sanglard et al .,1996)
BWP17 SC5314 derivative; (Wilson et al ., 1999)
ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG arg4::hisG/arg4::hisG
YLO159 ura3△::λimm434/ ura3△::λimm434 △cdr1::hisG-URA3-hisG/△cdr1::hisG CAF4-2 (SC5314)
(Sanglard et al .,1996) CSC21 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG arg4::hisG/arg4::hisG BWP17 (Chin-Sheng Chi,2004)
rep3::ARG4/REP3
CSC22 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG arg4::hisG/arg4::hisG BWP17 (Chin-Sheng Chi,2004) rep3::ARG4/REP3
CSC80 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG arg4::hisG/arg4::hisG CSC21 (Chin-Sheng Chi,2004) rep3::ARG4/rep3::URA3-dpl200
CSC81 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG arg4::hisG/arg4::hisG CSC21 (Chin-Sheng Chi,2004) rep3::ARG4/rep3::URA3-dpl200
CJC2 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG::HIS1 arg4::hisG/arg4::hisG CSC80 This study rep3::ARG4/rep3::URA3-dpl200
CJC4 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG::HIS1 arg4::hisG/arg4::hisG CSC81 This study rep3::ARG4/rep3::URA3-dpl200
CJC7 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG arg4::hisG/arg4::hisG CSC80 This study rep3::ARG4/rep3::URA3-dpl200, rep3::REP3-HIS1 (pWJB24)
CJC10 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG arg4::hisG/arg4::hisG CSC81 This study rep3::ARG4/rep3::URA3-dpl200, rep3::REP3-HIS1 (pWJB24)
CJC13 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG::HIS1 arg4::hisG/arg4::hisG CJC2 This study rep3::ARG4/rep3::URA3-dpl200, rep3::SAT1-REP3 (pCJB11)
Strain Genotype or relevant features Source
CJC14 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG::HIS1 arg4::hisG/arg4 CJC2 This study rep3::ARG4/rep3::URA3-dpl200, rep3::SAT1-REP3 (pCJB15)
CJC15 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG::HIS1 arg4::hisG/arg4::hisG CJC2 This study rep3::ARG4/rep3::URA3-dpl200, rep3::SAT1-REP3 (pCJB15)
CJC16 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG::HIS1 arg4::hisG/arg4::hisG CJC4 This study rep3::ARG4/rep3::URA3-dpl200, rep3::SAT1-REP3 (pCJB11)
CJC17 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG::HIS1 arg4::hisG/arg4::hisG CJC4 This study rep3::ARG4/rep3::URA3-dpl200, rep3::SAT1-REP3 (pCJB15)
CJC18 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG::HIS1 arg4::hisG/arg4::hisG CJC4 This study rep3::ARG4/rep3::URA3-dpl200, rep3::SAT1-REP3 (pCJB15)
CJC19 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG::HIS1 arg4::hisG/arg4::hisG CJC13 This study rep3::ARG4/rep3::URA3-dpl200, rep3::REP3 (pCJB11)
CJC20 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG::HIS1 arg4::hisG/arg4::hisG CJC14 This study rep3::ARG4/rep3::URA3-dpl200, rep3::REP3 (pCJB15)
CJC21 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG::HIS1 arg4::hisG/arg4::hisG CJC15 This study rep3::ARG4/rep3::URA3-dpl200, rep3::REP3 (pCJB15)
CJC22 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG::HIS1 arg4::hisG/arg4::hisG CJC16 This study rep3::ARG4/rep3::URA3-dpl200, rep3::REP3 (pCJB11)
CJC23 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG::HIS1 arg4::hisG/arg4::hisG CJC17 This study rep3::ARG4/rep3::URA3-dpl200, rep3::REP3 (pCJB15)
CJC24 ura3△::λimm434/ ura3△::λimm434 his1::hisG/ his1::hisG::HIS1 arg4::hisG/arg4::hisG CJC18 This study rep3::ARG4/rep3::URA3-dpl200, rep3::REP3 (pCJB15)
Table 3. Primer used in this study
Name Sequence Position
HJL133 ACCAGTAGCACAGCGATT CaURA3: (pDDB57) +51~+68
HJL178 GATACAGGTCAACATACTGC CaSNF3 :+1348~+1367
HJL179 GATGTGATTGTGACGATGAC CaSNF3 :+1834~+1815
HJL272 GAAGCCACACCAAGTCAATA CaCPH1 : +834~+851
HJL273 CCAGTTTGCGGTATTGCCT CaCPH1 : +1361~+1343
HJL293 AGTCATTGAACGAATTCTTGGCTG CaEFB1 :+38~+61
HJL294 TTCTTCAACAGCAGCTTGTAAGTC CaEFB1 :+591~+568
HJL311 AGTAGAAATCACACCAGTAGCAA CaARG4 :+1077~+1055
HJL312 CGGCAATTCTTGAACGAGCAC CaARG4 :+443~+463
HJL315 GTGCTGAACGTGAATATGT CaCDR1 :+4205~+4223
HJL316 CTCTCTGTTACCCTTTGG CaCDR1 :+4471~+4488
HJL360 TACCGCTTGTCACACTG CaERG3 :+930~+946
HJL361 ACCTTCAACTTCTCCTCTAAT CaERG3 :+1128~+1108
HJL393 GCTACTACTGCTTCTGGT CaMDR1 :+1396~+1413
HJL394 CTCAACTTTGGTCCGTTC CaMDR1 :+1670~+1653
HJL458 CCACCCGGGCTCGGAGCTTTATCATCG orf19.3926:+1267~+1294 HJL504 CGGGATCCGTCACTGGATCTGGATCAAC orf19.3926:+1114~+1133 HJL505 CGGGATCCATAGTTCCATAGGCAGCCTC orf19.3929:+902~+883
HJL590 TTTCTCCAGGTTATGCTCA CaERG11 :+1211~+1229
HJL591 TCAGGGTCAGGCACTTTA CaERG11 :+1494~+1511
HJL606 CAGAAGAGGCTATTGACAGG CaHIS1 : -605~-586
HJL607 CCCAGTTATACCCAAGTCAC CaHIS1 : +285~+266
HJL632 GCCTCACCAGTAGCACAG CaURA3 : + 46~+ 63
HJL633 GTTGTCCTAATCCATCACC CaURA3 :+ 643~+661
HJL712 TTGCTACAGAGCACCCT CaREP3 :+791~+807
HJL713 TGAGACTGCACAGCAT CaREP3 :+1103~+1088
HJL855 GCTGAACATAGCGGAAG orf19.3928(REP3) :-444~-460
HJL856 CAAGTCCACAGTGCTC orf19.3928(REP3) :+469~+454
HJL896 CCCTCCAAAAGGCAATTC orf19.3926:+768~+785
HJL897 CAGTGACAGCACCCAA orf19.3926:+1105~+1120
HJL898 GGTGCTGTTGATGCTC orf19.3929:+718~+733
HJL899 GTCCTCCACTGTGTCGA orf19.3929:+981~+997
HJL928 GCGGCCGCCTTAGATATGAGGCGT orf19.3926:+1118~+1142 HJL929 CCCCGCGGCTCACTAATGCTTTCGA orf19.3929:+6~+31
HJL930 GTGGTACCCAAATAAGCATTCCAAC CaURA3 :(pGEM-URA3 ) -558~-721 HJL931 GCCACTCGAGAGAACACGAGGCA orf19.3928:-1230~-1253
HJL963 CCTTCAATATCTGGGAG CaURA3 :(pGEM-URA3 ) -601~-618
HJL964 CGACAAGTTGATGGACC orf19.3928:+787~+770
*The A of the ATG translation initiation site is +1
*The A of the ATG translation initiation site is +1