Recently, hundreds of small RNAs of ~22 nucleotides, named microRNAs (miRNAs) have been discorved in animals and plants (Lau et al. 2001; Llave et al.
2002; Lagos-Quintana et al. 2002). The miRNAs have three different forms. First, it was transcribed as long primary transcripts (pri-miRNAs) and formed a hairpin loop structure. Following are two-step processing pathway: Drosha, which is the nuclease of the RNase III family, mediated the initial cleavage and the product called pre-miRNAs. After pre-miRNAs were exported to the cytoplasm, the further processed will act by Dicer and the mature miRNAs comes out. The mature miRNAs would cooperate with argonaute family proteins to carry out the gene silencing in complex form called “RISC”. The predominant mechanism of silencing by “RISC” in animal is to interfere gene expression in the translation level (Denli et al. 2004; Saito et al.
2005; Liu et al. 2004).
miRNAs, interfere with the expression of the mRNA, which control the timing of the development, stem cell maintenance, and other developmental processed by binding to the complementary sequences on the target genes (Brennecke et al. 2003;
Carrington et al. 2003). By the mechanism of miRNA-mediated silencing, the maternal-effect selfish genetic elements created in the Drosophila are resistant to the recombination-mediated dissociation of the drive and disease refractoriness functions (Chen et al. 2007). The efficiency of the designed RNA fragments, which apply the miRNA processing system in Drosophila, is high to knockdown the gene expression (Personal communication). According to the guides for the RNA fragment designed, his system was applied to generate the unc-4 mutant.
A 22-nucleotide length target site in the 3’-UTR of the unc-4 gene was
selected. With the following 7 criteria: (1) a 22 nucleotides fragment, (2) contains
30-52% GC, (3) at least 16-20% A or T, (4) the nucleotide number 20 must be A, (5) the 3rd nucleotide is better as A, (6) the nucleotide number 10 is better as T, and (7) the nucleotide number 13 should not be G. The criteria 3 and 4 are essential but 5 and 6 are optional.
The miRNA transcript should have four oligos to form a loop structure. The common two oligos for all with cloning sites are miR6_5’_NotI/BglII and
miR6_3’_BamHI/XbaI. The oligos that contain the sequence that target to the unc-4 gene are miR6_unc4mel_C for the target site sequence:
CCAAAGCAATGCTTGAAATATG from 1646bp to 1669bp , and the miR6_unc4mel_D for the target site sequence: AGAGTCCATTTCTCATGGAAAG from 2452bp to 2475bp. The designed oligo sequences are listed in Table 4.
Table 4
The sequences for the oligos for miR6_unc4mel
Name Sequence
miR6_5’_NotI/BglII GGCGCGGCCGCCGCCAGATCTTTTAAAGTCCACAACTCATC AAGGAAAATGAAAGTCAAAGTTGGCAGCTTACTTAAACTTA miR6_3’_BamHI/XbaI GGCCTCTAGAACGGATCCAAAACGGCATGGTTATTCGTGTG
CCAAAAAAAAAAAAAATTAAATAATGATGTTAGGCAC miR6_unc4mel_C1 GGCAGCTTACTTAAACTTAATCACAGCCTTTAATGTCCAAA
GCAATGCTTGAAATCTGTAAGTTAATATACCATATC
miR6_unc4mel_C2 AATAATGATGTTAGGCACTTTAGGTACCCAAAGCAATGCT TGAAATATGTAGATATGGTATATTAACTTACAGA
miR6_unc4mel_D1 GGCAGCTTACTTAAACTTAATCACAGCCTTTAATGTAGAGT CCATTTCTCATGGACAGTAAGTTAATATACCATATC
miR6_unc4mel_D2 AATAATGATGTTAGGCACTTTAGGTACAGAGTCCATTTCTC ATGGAAAGTAGATATGGTATATTAACTTACTGT
The designed sequences of the oligos were used to predict the structure and the target site online (http://sfold.wadsworth.org/) (Fig. 23), and did the e cloning by
of the unc-4 gene, and the oligos would form the loop structure. After these checking steps, did two rounds of PCR to generate the fragment that contained four oligos.
Two fragments that target to two different sites of the 3’-UTR in the unc-4, were cloned into pCR2.1-TOPO® (Invitrogen) respectively. One of the TA clone were digested with the restriction enzymes BglII and HindIII to get the fragment as the insert in the next step. Another TA clone was digested with the restriction enzymes BamHI and HindIII to get the fragment as the vector in the next step. After gel extraction, the insert and vector part from each digestion steps were ligated. The product from the ligation procedure was digested again with the restriction enzymes NotI and XbaI for preparing to clone into the transgenic vector pUAST attB and pUASP attB. The transgenic constructs were named pP{5’-UAST::mir_unc4mel} and pP{5’-UASP:: mir_unc4mel}.
Fig. 23.—The target and structure prediction of two miRNA. There are two miRNA designed with the target sites in the 3’-UTR of unc-4 gene. The upper one of the picture in this figure is named miR_unc4mel_C, and the lower one is named
miR_unc4mel_D. In both two parts of the picture, the left ones are the predict structures, and the right ones are the predicted target sites.
The mir_unc-4 transgenic lines
For the transgenic vector pUAST attB, pP {5’-UAS::mir_unc-4mel} was injected into 34 embryos for each attP line, and 3 larvae of ZH-attP-51D line and 16 larvae of ZH-attP-86Fa line were collected. For another transgenic vector pUASP attB, 26 embryos were injected for each attP line, and 8 larvae of ZH-attP-51D line and 14 larvae of ZH-attP-86Fa line were collected. Only one transformant of each chromosome for each UAS constructs were obtained respectively (Table 5).
Table 5
The list of UAS-mir_unc-4 transgenic lines Numbers of
injected embryo Numbers of
hatched larvae Transformant
The third chromosome insertion lines for each P-elenment construct were used to cross with different Gal4 lines, including elav-Gal4, GMR-Gal4, nanos-Gal4, and tub-Gal4, for functional analysis. All Gal4 lines chosen to drive UAS-mir_unc-4 expression have no defect in the development of flies that all embryos in four lines can grow up to adult flies no matter what the transgenic vectors were used. The RT-PCR result showed that the expression of the unc-4 gene in the tub>mir_unc-4 are similar to the expression in w1118 (Fig. 24).
Fig. 24.—RT expression of unc-4. RNA were extracted from three different lines, including (w) w1118, (T) tub>mir_unc4mel (with the transgenic vector pUAST attB), and (P) tub>mir_unc4mel (with the transgenic vector pUASP attB). All of them have the unc-4 expression. rp49 was used as the control gene in all samples.
According to the results of the phenotypic observation and the RT-PCR, the RNA interfere system seams invalidity. Several methods can be tried to improve this.
First, design the miRNA that target to the sequence both in the coding region and the 3’-UTR region. Although the endogenous miRNA of the animals usually have the complementary sequence in the 3’-UTR of the gene that it regulated, the RNA fragments designed to apply the Drosophila endogenous miRNA system may have higher efficiency to deal with the coding region rather than the 3’-UTR. Second, raising the incubated temperature of the flies, when it crosses to Gal4 lines to induce the miRNA expression, because the activity of the Gal4 lines may increase with the higher temperature (Duffy 2002). Finally, increase the target sites of the gene, because the efficiency of the miRNA to knockdown the gene expression is not one hundred percent, more target sites may increase the probability to knockdown the gene.
Generate the OdsH knockdown flies
Except for the unc-4 knockdown, OdsH knockdown flies were also desired to be generated. By following the miRNA designed criteria, the target site of OdsH is determined. The target site sequence: GATTTCGGGTGGTTAGCTAAGC is from the
unc-4
rp49
W T P
1183bp to 1205bp in 3’-UTR of OdsH. The 3’-UTR sequence of OdsH is short thus only one suitable target site is chose. The common two oligos: miR6_5’_NotI/BglII and miR6_3’_BamHI/XbaI were also used. The designed oligo sequences are listed in Table 6.
Table 6
The sequences for the oligos
Name Sequence
miR6_5’_NotI/BglII GGCGCGGCCGCCGCCAGATCTTTTAAAGTCCACAACTCATC AAGGAAAATGAAAGTCAAAGTTGGCAGCTTACTTAAACTTA miR6_3’_BamHI/XbaI GGCCTCTAGAACGGATCCAAAACGGCATGGTTATTCGTGTG
CCAAAAAAAAAAAAAATTAAATAATGATGTTAGGCAC miR6_OdsHmel_C1 GGCAGCTTACTTAAACTTAATCACAGCCTTTAATGTGATTTC
GGGTGGTTAGCTACGCTAAGTTAATATACCATATC
miR6_OdsHmel_C2 AATAATGATGTTAGGCACTTTAGGTACGATTTCGGGTGGTT AGCTAAGCTAGATATGGTATATTAACTTAGCGT
The transgenic constructs named pP{5’-UASP::mir_OdsHmel} was generated following the procedures described in the unc-4 part. To get the transgenic flies, pP{5’-UASP::mir_OdsHmel} was injected into 38 embryos for each attP line, and 6 larvae of ZH-attP-51D line and 2 larvae of ZH-attP-86Fa line were collected.
However, no transformant was obtained.
3. Solutions
10X Phosphate-buffered saline (10X PBS):
NaH2PO4•H2O ………..…….. 2.56g (18.6mM) Na2HPO4 ………... 11.94g (84.1mM) NaCl ………...…... 102.2g (1750mM)
Combine all components in <1 liter of ddH2O and stir to dissolve. Adjust pH to 7.0 and final volume of 1 liter with ddH2O. Sterilize by autoclaving.
1X Phosphate Buffered Saline Tween-20 (1X PBST):
0.3% Tween 20 in 1x PBS
4% Paraformaldehyde (fixation solution):
Paraformaldehyde ……….. 4g
ddH2O ………50ml
1N NaOH ………...1ml
Mixture gently and heat to 60-65 ºC until the paraformaldehyde is dissolved. Next add 10ml of 10X PBS and to cool to room temperature. Adjust pH to 7.4 and final volume of 100ml with ddH2O. Finally, filter the solution through a 0.45-!m membrane filter.
3% BSA (blochking solution):
BSA ……….. 3g 1X PBST ……….... 100ml
1,4-Diazabicyclo[2.2.2]octane (DABCO) (mounting solution):
N-propyl gallate ……….... 1.23g 10X PBS ………... 5ml 100% glycerol ………45ml