CHAPTER 2 Materials and Methods
2.2 Cloning Methods of Recombinant Constructs
2.2.7 Ligation
To produce the final construct, ligation is the most traditional way that using the T4 ligase to ligate the enzyme digested DNA incubated in 16℃ overnight or in room
temperature for 15 min. The protocol is following as below.
Table 2.8 Protocol of T4 ligation
ECOSTM competent cells, DH5α, is used for our study. The cells mixed with the plasmid or ligation product are thawed on the ice for 5 min, heat shocked in 42℃ for 45 seconds, and spreading the dilution onto the selection plate. The colony growth
after incubated in 37℃ overnight.
To identify whether the constructs are successfully transform into the competent cells, the colony PCR is a quick way to used. Mixing the forward and reverse primers with the 2X Ready-to-load PCR Taq Master Mix (MDBio), the single colony is picked
up into the reaction for routine PCR.
Table 2.9 Protocol of colony PCR
HeLa (human cervical cancer cell line) was acquired from Dr. Fon-Chun Ke's
lab and 293T (human embryonic kidney cell line) was acquired from Dr. Jean Lu’s lab. Both of HeLa and 293T cells are growth in high-glucose DMEM medium sup-plemented with 10% FBS, 100 units/mL of penicillin and 100 μg/mL streptomycin in the present of 5%CO2 at 37℃.
When cells growth to 80% confluence, the cells are subculture to the new plate
for continual growth. First, we remove the medium and wash once by 1X DPBS.
Second, the cells are incubated with the trypsin/EDTA for 5 min in 37℃ until the cells are dispersed and inactive the action of trypsin/EDTA by adding the same volume medium. The cells solution is transfer into the new tube for centrifuge at
750 rpm for 5 min to collect the cell pellet and replace the fresh medium after
throwing the subtenant. Eventually, the cells are seeded into the new plate and
con-tinued incubation.
2.4 Transfection
According to the different transfection efficiency, the Liposome-mediated
transfected mainly used in adhesion cells, like HeLa cells and 293T cells, and the electroporation used for the low transfection efficiency cells. In this study, it only display the Lipofectamin 3000 Reagent transfection. The cells are seeded into the wells of 12 or 24-well plate (Corning) and incubated for 24 hours. Importantly, the Lipofectamine 3000 Reagent is mixed with the Opti-MEM (Gibco) for a while.
Then, preparing the solution that the protocol is follow as below, the well-inverted
tube incubated for at least 10 min. Finally, the reagents are adding to the each well.
Table 2.10 Protocol of Lipofectamin 3000 Reagent
Culture Vessel Shared Reagents DNA transfection
2.5 Drugs treatment and cell synchronization
Doxycycline hydrochloride (Dox, Sigma-Aldrich) is used for activate the Tet-On
system and trigger the output expression, incubating the cell in medium with 1,000 ng/ml Dox. STLC (S-trityl-L-cysteine, Merck Millipore) can block the cell cyclin in M phase with the medium containing 5 μM STLC, and it is also used as positive
control of apoptosis test treated for 48 hours. To observe the different expression level of each phase in cell cycle, the cells are culture in the medium containing 2 mM thymidine (Sigma-Aldrich) for 19 hours, washed by DPBS and incubated in fresh medium for 9 hours. Then, the cells are replaced with 2 mM thymidine for 16 hours, blocking cells in G1/S phase. To make the cell entry the G2 phase, the cells
which are already blocked in G1/S phase are replaced in fresh medium again for 2 hours. By culturing the cells in medium containing 0.5% FBS for a period of 72
hours to G0 phase.
2.6 Fluorescence microscopy and time-lapse imaging
All the images are taken by Inverted fluorescence microscopy Axio
Ob-server Z1 (Carl Zeiss) with ZEN software (Carl Zeiss). The filters we chose is the most adept for different fluorescence, like EGFP used the channel of 470/40 nm (excitation) 525/50 nm (emission) and mCherry used the channel of 560/40 nm
are seed in 24-well plate and covered by a layer of mineral oil (Sigma-Aldrich) on medium avoiding the evaporation. The pictures are automatically captured once every 15 minutes in an incubation chamber at 37°C with 5% CO2 continually
pro-vided for 24 hours.
2.7 Flow cytometry
To count the ratio of the fluoresces in the adhesion cells transfected with different circuit, we use the FACSCanto IITM flow cytometer (BD Biosciences) to gather these data. The cells are resuspended in the 1mL 1xDPBS and collected 105 cells that specific gated above the certain threshold defined by non-transfected cells.
We use the Coherent Sapphire 20 mW 488 nm solid state blue laser as our excitation.
Moreover, the measurement of experiment used different bandpass filter, 530/30 nm one with a PMT 250 V of EGFP and 585/42 nm one with a PMT 350V.
2.8 Cell Proliferation Assay
To measure the killing ability of genetic circuit, we chose the CellTiter 96®
AQueous One Solution Cell Proliferation Assay (MTS, Promega) as our tool to quantify. The transfected cells are seed into the 96-well plate (5000 cells/well) in 100μl of culture medium. After adding 20μl CellTiter 96® AQueous One Solution
Reagent into each well and incubating for 1-4 hours, the samples are recorded the absorbance at 490nm by using a ELISA plate reader.
2.9 Trypan Blue exclusion assay
To analyze the number of viable cells present in a cell suspension, we seed
1x105 cells per well and transfection for 24 hours. By trypsinizing the cells and resuspensed in 1X PBS, we mixed 10μl cell suspension and 10μl trypan blue at room temperature. Then the cell suspension is filled into two side of a hemacytometer counter. All cells are counted (clear and blue).
𝑐𝑒𝑙𝑙 𝑣𝑖𝑠𝑖𝑏𝑖𝑙𝑡𝑦 =𝑛𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑐𝑙𝑒𝑎𝑟 𝑐𝑒𝑙𝑙𝑠
8 × 2 × 104
(Formula.1)
𝑐𝑒𝑙𝑙 𝑑𝑒𝑎𝑡ℎ 𝑟𝑎𝑡𝑒 = (1 − 𝑛𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑐𝑙𝑒𝑎𝑟 𝑐𝑒𝑙𝑙𝑠
𝑛𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑡𝑜𝑡𝑎𝑙 𝑐𝑒𝑙𝑙𝑠 ) × 100%
where
𝑡𝑜𝑡𝑎𝑙 𝑐𝑒𝑙𝑙𝑠 = c𝑙𝑒𝑎𝑟 𝑐𝑒𝑙𝑙𝑠 + 𝑏𝑙𝑢𝑒 𝑐𝑒𝑙𝑙𝑠
Total cells indicate the clear cells and blue cells are count simultaneously. After con-verting with the Formula.1, the number of total cells are number of clear cells and blue cells.
(Formula.2)
2.10 primer list
Name Sequences (5’ → 3’)
EGFP_F(EcoRI) CCCCGGAATTCATGGTGAGCAAGGGCGAG
EGFP_R(PstI) AAAACTGCAGTTACTTGTACAGCTCGTCCATGCC
GAT CTA GTA GTG CTT TCT ACT TTA TGA GTA GTGCTT T CT ACT TTA
hBax-β_F(SalI) GCC CGT CGA CAT GGA CGG GTC CGG GGA G
EGFP_F(BglII) CCC CAG ATC TCA TGG TGA GCA AG
Chapter 3 Results
3.1 Comparison between full-length and truncated cyclin B1 promoter
Cyclin B1 promoter is known to regulate cells to entry the G2 phase and M phase.[10]
According to previous data [22], the experiment to block cells in G2/M phase is to cul-ture cells in medium containing 5 μM STLC (S-trityl-L-cysteine, Merck Millipore) for
24 hours. STLC is a potent tumor growth inhibitor that has been identified to target the Human mitotic kinesin Eg5, an essential motor for the formation of the bipolar mitotic
spindle.[26] Compared with blocking at G1/S phase with double thymidine block, this is not the ideal experiment, as cells are mainly at M phase, and some cells may begin to undergo apoptosis. Hence, we decided to synchronize the cells at S/G2 phase by
harvest-ing cells 2 hours after double thymidine block. The result shows that both 342 CBP (truncated cyclin B promoter) and 949 CBP (full-length cyclin B promoter) [11] have increased level of expression at G2 (Fig.4a, 4b). Furthermore, the percentage of the mCherry-positive cells increased at S/G2 phase than these at G0 phase. (Fig.4c)
Taken together, the results confirm that both 342 CBP and 949 CBP
acti-vate upon entering the cell cycle. According to the previous data [27], 342 CBP and 949 CBP show similar expression level in G0 phase. As the fluorescence also in-creased significantly at G1/S in 949CBP, 342 CBP is chosen as our sensor since the
342 CBP is more specific to M phase [22]. In this study, we also showed that there are more numbers of activated cells in 342 CBP than in 949 CBP at S/G2 phase.
(Fig.4c)
3.2 The degree of apoptosis triggered by hBax-β, caspase-3 and
cleaved-capsepase-7
To further know whether toxic gene(s) can trigger the epithelial cells death or not, we chose to test three well-known genes in the apoptotic pathway, human Bcl-2–associated X protein hBax (hBax-β) and two caspase family (caspase-3 and caspase-7), as our candidate genes. Both caspase-3 and caspase-7 are truncated by
removing their pro-domains. According to previous study, truncation mutant of caspase-7 at amino acid 57 can kill cells more effectively then other mutants.[18]
(Fig.3) Therefore, in this study, we test whether the expression of hBax-β, truncated caspase-3 and truncated caspase-7 can be used for killing cancer cells.
First, three toxic genes were constructed into the expression plasmid with
bi-directional CMV (constitutive) promoter, pBI-CMV1, with EGFP simultaneously expressed as the marker for transfection. (Fig.5A) Result shows that constitutive ex-pression of hBax-β caused significant killing in both HeLa cells and 293T cells.
(Fig.5B) The apoptotic cells were blebbing with no EGFP detected. We can observe same degree of apoptosis with truncated caspase-7. We did not see a difference be-tween with or without miR-142 MBS for hBax-β and truncated-caspase-7. This is expected, as miR-142 are of low expression in HeLa cells and 293T cells.[27]
To further enhance the killing ability, we cotransfected the hBax-β and
trun-cated-caspase-7 (both in pBI-CMV1 plasmid). As there were already significant death for hBax-β and truncated-caspase-7 alone in HeLa and 293T, we did not see a visible increase in death in combination of these two. Combination experiments can be per-formed in death-resistant cells, e.g. A549. In conclusion, overexpression of hBax-β can effectively trigger apoptosis, and is therefore chosen as the toxic gene in later
experiments.
3.3 Activation of complete circuit in HeLa cells
Next, we tested the complete circuit (Figure 1B) in HeLa cells. Since in the Tet-On system, the inducer, Doxycycline, switches on the circuit, the first thing to confirm
is whether the inducer can regulate the system. We cotransfected the Tet-On 3G pro-tein driven by 342CBP and hBax-β driven by pTRE3G-BI into HeLa cells, and the result shows that this system can be controlled by Tet-On system (Fig 6). The
hBax-β gene was expressed when the inducer was present, as evident from the amount of cell death and EGFP, with or without miR-142 MBS. Moreover, we confirmed the result with time-lapse image (Figure 7). The first picture was taken immediately after the addition of doxycycline into the medium. It is evident that the circuit was activated in 30 min, as reported by both the mCherry and EGFP signal. Nevertheless, only a
proportion of the fluorescent cells rounded up (a feature of apoptosis). What’s more, the morphology of apoptosis was displayed 2 hour after the addition of doxycycline.
Most of cells successfully underwent cell death in 24 hours. However, there were still some EFGP+ cells alive, which means that cancer cells with higher death threshold (i.e. more resistant) still have the chance for escaping our circuit.
Subsequently, the other two toxic genes mentioned above were also constructed in the system to compare the degree of apoptosis. Quantification of apoptosis for all circuits is shown in Figure 8. Taken together, our results show that the genetic circuit has the ability to activate apoptosis in HeLa cells, and the expression of hBax-β trig-gered by TetOn system appears to be the best choice.
3.4 Insulator between two promoters
The ultimate question for this study is whether the miR-142 expression in hematopoietic cell lines, such as HL-60 and Jurkat, can repress the toxic signaling in our circuit. We attempt to address this, however, the problem we met is that most suspension cells were killed by electroporation in cotransfection of our circuit. Also,
the efficiency of cotransfection is very low. To solve this problem, we plan to first build stable cell line of TetOn-3G protein driven by 342CBP and constitutively ex-pressing the mCherry. This cell line (mCherry+ cells) can be selected with flow cy-tometry. Then, the line can be used to transfect the plasmid with the expression of hBax-β driven by TRE promoter, using EGFP as the marker for transfection, or
an-other selection for stable cell lines.
Nevertheless, another problem appeared in this design. The pTRE3G-Bi plas-mid we used cannot express EGFP without doxycycline. The addition of doxycycline also turns on the expression of hBax-β that leads to cell death. In other words, we cannot use EGFP+ to select for stable cells with this second layer of expression.
There-fore, we aim to create a new vector, containing a constitutive promoter and an induc-ible promoter, to express EGFP without toxic signaling. Using pBI-CMV1 as the
initial vector of our new vector (pTRE-CMV), we constructed a co-expression cas-sette with mCherry under the control of CMV promoter and the EGFP under the con-trol of TRE promoter (Fig. 9)[28]. However, the EGFP signal was present without doxycycline, suggesting that there might be interference between the constitutive CMV and the inducible TRE promoter (Fig. 11A)
To diminish the interference between the two promoters, we chose to test a previously characterized insulator, the DNA sequences at the 5’ end of the chicken β-globin HS4 (cHS4) locus in chicken’s chromosome, to prevent the unexpected signal emanating from their surrounding environment.[24, 25, 29] (Fig.10) We compared the effect of inserting zero, one and two copies of the cHS4 insulator and found that the
cHS4 core element can dose-dependently decrease the interference between the two promoters (i.e. influence from CMV promoter). (Fig.11). Quantifying the expression level of two reporters, the mCherry triggered by CMV promoter shows no different after adding the doxycycline. (Fig.12A) Insulator significantly weaken EGFP expres-sion, and it can be recover after inducer exist.(Fig.12B,12C) In this result, the
trans-fected HeLa cells are observed the lower fluorescent expression level with insulator
than without it. Moreover, we quantify the mCherry triggered by CMV promoter and
EGFP triggered by TRE promoter. mCherry shows same degree no matter the doxycy-cline exist or not, which means the constitutive promoter doesn’t effect by TRE
pro-moter. On the other hand, the expression level of EGFP less about 8-fold of construct without insulator. Then, cultured in the doxycycline-containing medium, the EGFP with insulator is recover the expression level like the no insulator one. Taken together, the insulator actually has the ability of stopping the leakage effect happened of two
promoters.
Taken together, the insulator actually has the ability to block the activation of
two promoters and CMV promoter still can constitutively without effected by insula-tor. TRE promoter can reach the same expression level of EGFP in the medium con-taining doxycycline.
Chapter 4 Discussion and Future Work
This study is inspired by a previous study that uses a customizable set of endogenous microRNAs as the multi-input sensor to achieve selective targeting of HeLa cell among the other cell lines [8]. The synthetic regulatory genetic circuit, called a cell-type
“clas-sifier”, is consisted of several miRNA binding site and LacI-controlled promoter CAGop as the upstream sensors. It is a promising platform that can be a novel anti-cancer treat-ment by using the artificial DNA constructs to specifically turn on the output when cer-tain conditions are matched.
Compared with our design, we only chose one endogenous miRNA (miR-142;
hematopoietic-high) marker and Tet-On system controlled by cell cycle regulatory pro-moter as our sensors to distinguish the dividing hematopoietic cell lines form non-hem-atopoietic cell lines. Whether miR-142 is selective enough is still an open question. Also, some cells transfected with the complete circuit (Fig 6; EGFP+ cells) can still escape
death upon induction. Hence, we also plan to simultaneously express two toxic genes linked by a “self-cleaving” P2A peptide [30, 31] to enhance the killing and to avoid the interference since the bi-directional of vector.
Another problem we encountered was the transfection efficiency of hematopoietic cells. These suspension cells are too difficult to transfect by either lipofectamine or
elec-mCherry+), however, the number of cells that survived the electroporation was too low to do further experiments, especially in this case that we want to compare the degree of cell death (data not shown). We also have attempted to generate stable 342CBP_Te-tOn+mCherry-expressing HL-60 and Jurkat cell lines with transient transfection. Unfor-tunately, in that one experiment, transfected cells were very sick and could not survive
for more than one week. We plan to use lentivirus to solve this problem in the near future.
Chapter 5 Figures
Fig1. The diagram of conception and basic design
As our mainly idea of the specificly selectivity gene circuit apporched by synthestic biology, whetehr the cell division initiated and selection marker exist are the most impotaint characteristics. (A) Schematics of a AND gate between two sensors. (B) An
illustration of actral setup in DNA seqence. hBax-β, an example of output. (C)Selectivity of circuit in different cell line.
A
B
C
Fig.2 The flow chat with fusing 4 repeats miR-142 microRNA binding site.
The sequnces of miR-142 are seperaed into two pairs of pre-annealed oligonucleotides
which contain one sticky end and one blunt end of restrcition enzyme at P1 and P4 sequences (BglII and EcoRV). By using the T4 PNK to transfer the γ-phosphate from ATP to the 5’-OH group, miR-142 MBS can ligate with vector to create a new recombi-nation vector.
Fig.3 The aligements of procaspase-3 and cleaved caspase-3 ; procasepase-7 and
truncated caspase-7.
To accelerate the protein maturation, the prodomain of both caspase-3 and caspase-7 is cleavaged initialy. Morever, we chose the truncated c-caspase-7 mutated at amino acid 57, is reported that triggers apoptosis frequenly than other mutant type. (A) The procaspase-3 gene is cloned form whole genome in the DH5α strain. Compared with the DNA sequence reported online, we construct the activated caspase -3 by removed the
prodomain. (B) To construct the truncated caspase-7, the prodomain is removed first.
Refer to the supporting information from previous study, amino acids 57-303 of caspase-7 shows the morphologies of apoptosis after activated and causes the significant cell A
B
death than others mutant. Hence, we design the primers which can bind on caspase-7 sequence started form amino acid 57 to remove the amino acid 1-56.
A
B
Fig.4 The expression level of reporter triggered by full length (949) or truncated
(342) cyclin B1 promoters at G0 and G2 phase
The first sensor is chosen because the abnormal division and unlimited proliferation are the most common feature in cancer cells. We sythcrozined the transfected HeLa cells by double thymidine assay and relased for 2 hours that allows cells to go into G2 phase. As the control group, we also block cells into G0 phase, let cells have no ability to activate the cell cycle by cultured in certain medium which is lack of nutrients for 72 hours.
Obseved the fluorescence by microscope, the reporter (mCherry) triggered by (A) truncated cyclin B1 promoter (342 CBP) and (B) full length cyclin B1 promoter (949CBP) shows significantly high expression in G2 phase than G0 phase. (C) The percentage of fluorescent-positive cells indicate that the 342 CBP can successfully
regulate the gene accroding the cell cycle.
C
B A
HeLa cells 293T cells
Fig.5 The transfected cancer cells which constitutively express the toxic gene results
in cell apoptosis in HeLa cells and 293T cells.
(A) The illustration of constructs containing different toxic gene and with or without miR-142-5p MBS located at the downstream triggered by CMV promoter. The EGFP reporter is used as transfected maker. (B) The image of cell morphology result that the overexpression of hBax-β gene and truncated caspase-7 gene can efficiently killing the cancer cells. The transfected cells expressing cleavage caspase-3 gene
show the EGFP and caused less cell death after transfected for 24 hours, which means that overexpression the cleavage caspase-3 alone doesn’t have the enough ability of killing the cancer cells. We also co-transfect the two toxic genes to know whether the killing ability is more powerful than expressed alone or not. In this re-sults, the cleavage caspase-3 and truncated caspase-7 shows the significant killing
show the EGFP and caused less cell death after transfected for 24 hours, which means that overexpression the cleavage caspase-3 alone doesn’t have the enough ability of killing the cancer cells. We also co-transfect the two toxic genes to know whether the killing ability is more powerful than expressed alone or not. In this re-sults, the cleavage caspase-3 and truncated caspase-7 shows the significant killing