• 沒有找到結果。

2.1 Strains

E.coli : DH5α

Saccharomyces cerevisae :

Strain Genotype Reference

10560-2B MATa his3 : : hisG ura3–52 leu2 : : hisG

Chen et al.

(2004), Lab of H.-J. Lo 10560-2B-f0 10560-2B was transformed with plasmid

YEP363 This study

10560-2B-f1 10560-2B was transformed with plasmid

YEP363-CaENO1-TP This study

10560-2B-f2 10560-2B was transformed with plasmid

YEP363-CaENO1-EGFP This study

10560-2B-f3 10560-2B was transformed with plasmid

YEP363-CaENO1-EGFP-TP This study

10560-2B-EGFP 10560-2B was transformed with plasmid

YEP363-EGFP This study

10560-2B-

CaENO1[280-1320]

10560-2B was transformed with plasmid

YEP363- CaENO1[280-1320]-EGFP This study 10560-2B-

CaENO1[388-1320]

10560-2B was transformed with plasmid

YEP363- CaENO1[388-1320]-EGFP This study 10560-2B-

CaENO1[451-1320]

10560-2B was transformed with plasmid

YEP363- CaENO1[451-1320]-EGFP This study 10560-2B-

CaENO1[901-1320]

10560-2B was transformed with plasmid

YEP363- CaENO1[901-1320]-EGFP This study 10560-2B-

CaENO1[451-901]

10560-2B was transformed with plasmid

YEP363- CaENO1[451-901]-EGFP This study 10560-2B-

CaENO1[1-150]

10560-2B was transformed with plasmid

YEP363- CaENO1[1-150]-EGFP This study 10560-2B-

CaENO1[1-279]

10560-2B was transformed with plasmid

YEP363- CaENO1[1-279]-EGFP This study

Strain Genotype Reference 10560-2B-

CaENO1[1-387]

10560-2B was transformed with plasmid

YEP363- CaENO1[1-387]-EGFP This study 10560-2B-

CaENO1[1-1450]

10560-2B was transformed with plasmid

YEP363- CaENO1[1-1450]-EGFP This study 10560-2B-

CaENO1[1-511]

10560-2B was transformed with plasmid

YEP363- CaENO1[1-511]-EGFP This study 10560-2B-

CaENO1[1-900]

10560-2B was transformed with plasmid

YEP363- CaENO1[1-900]-EGFP This study

2.2 Plasmids

Plasmid Description Reference

pEGFP-N2 It contained EGFP.

BD Bioscience

Clontech YEP363

It contained selection marker Leu2 gene, lacZ gene, ampR (ampicillin resistance), and 2μ (origin of yeast).

Valenzuela et.,1998

YEP363-CaENO1-TP

YEP363 plasmid contained CaENO1 gene tagged with HA3HIS6 tag and pACT1 promoter

YEP363 plasmid contained CaENO1 gene tagged with EGFP and pACT1 promoter

This study

YEP363-CaENO1- EGFP-TP

YEP363 plasmid contained CaENO1 gene tagged with EGFP and HA3HIS6 tag and pACT1 promoter

This study

YEP363-EGFP YEP363 plasmid contained EGFP and

pACT1 promoter This study

YEP363-

CaENO1[280-1320]-EGFP

YEP363 plasmid contained +280~+1320 bp of CaENO1 gene tagged with EGFP and pACT1 promoter

This study YEP363- YEP363 plasmid contained +388~+1320

This study

Plasmid Description Reference and pACT1 promoter

YEP363-

CaENO1[451-1320]-EGFP

YEP363 plasmid contained +451~+1320 bp of CaENO1 gene tagged with EGFP and pACT1 promoter

This study

YEP363-

CaENO1[901-1320]-EGFP

YEP363 plasmid contained +901~+1320 bp of CaENO1 gene tagged with EGFP and pACT1 promoter bp of CaENO1 gene tagged with EGFP and pACT1 promoter

This study

YEP363- CaENO1[1-150]- EGFP

YEP363 plasmid contained +1~+150 bp of CaENO1 gene tagged with EGFP and pACT1 promoter

This study

YEP363- CaENO1[1-279]- EGFP

YEP363 plasmid contained +1~+279 bp of CaENO1 gene tagged with EGFP and pACT1 promoter

This study

YEP363- CaENO1[1-387]- EGFP

YEP363 plasmid contained +1~+387 bp of CaENO1 gene tagged with EGFP and pACT1 promoter

This study

YEP363- CaENO1[1-450]- EGFP

YEP363 plasmid contained +1~+450 bp of CaENO1 gene tagged with EGFP and pACT1 promoter

This study

YEP363- CaENO1[1-510]- EGFP

YEP363 plasmid contained +1~+511 bp of CaENO1 gene tagged with EGFP and pACT1 promoter

This study

YEP363- CaENO1[1-900]- EGFP

YEP363 plasmid contained +1~+901 bp of CaENO1 gene tagged with EGFP and pACT1 promoter

This study

2.3 Primers

Name Sequence (5’→3’) Location

EGFP-L-XbaⅠ

Name Sequence (5’→3’) Location EGFP-R- PstⅠ AACTGCAGTTACTTGTACAG

CTCGTCC

EGFP gene:

Nucleotide: +720~+702 pACT1 -F CATTCATTCCCGGAATTCCC YEP363-CaENO1-TP

Nucleotide:+10509~+8

2.4 Chemicals, enzymes, and regents

Alpha Biosciences : LB agar (Cat. No.L12-111)

(Cat.No.0854-1L-PTM), Tris base (Cat. No.0826), Tris-Hydrochloride (Cat.

No.0234-500G), Acryl/Bis 37.5:1 solution (Cat. No.0524)

Amersham Biosciences : Nitrocellulose Membrane (Cat. No.FM0053-1) Anchor : Non fat milk (Cat. No.EMB53084-D)

ApplinChem : Ampicillin (Cat. No.A2839)

Bio-Rad : Ammonium persulfate (APS) (Cat.No.161-0700)

Difco: Bacto agar (Cat. No.143175), Yeast nitrogen base w/o aminol acid (Cat. No.145368) ,YPD broth (Cat. No.135141XB)

Fermentas : T4 DNA ligas (Cat. No.1812)

Fluka : Acetic acid (Cat. No.33209), Calcofluor White Stain (Cat. No.18909), Phenyl methey sulfonyl fluoride (PMSF) (Cat.No.78830), Urea (Cat.

No.SK-2644U)

Invitrogen : Image-iT ™ LIVE Plasma Membrane and Nuclear Labeling Kit (Cat. No.I34406)

J.B.Baker : Dextrose (Cat. No.1916-01)

Kodak : GBX Developer and Replenisher (Cat. No.8875569) ,GBX Fixer and Replenisher (Cat. No.1749837), X-film (Cat. No.1651454)

Merck : Dodecy Sulfate Sodium (SDS) (Cat. No.1.12012.0500) ,Ethanol (Cat.

No.1.00983.2500), Tris –HCL (Cat. No.1.01547.1000), Sodium acetate (Cat.

No.1.06267.0500), β-mercaptoethanol (Cat. No.1.1543.0100) Mallinckrodt : Methanol (Cat.No.3016-08)

MILLIPORE : Amicon Ultra-15 (Cat. No.UFC9 010 08), Amicon Ultra-4 (Cat. No.UFC9 010 24), HRP substrate (Cat. No.WBKLS0500)

NEB : Restriction Enzyme (in this study)

NOVUS : pAb anti-EGFP[HRP] (Cat. No.NB600-313 ) Protech : ProTaqTMDNA polymeras (Cat. No.PTM525)

Promega : Shrimp Alkaline Phosphatase (SAP) (Cat. No.M8201)

Premier: ExcelPureTM Plasmid Minutesi kit (Cat. No.PM250), ExcelPureTM PCR Cleanup kit (Cat. No.CU250), PCR clean-up/Gel Extraction kit (Cat.

No.N-DCE050)

Riedel-de Haen : Sodium Chloride (Cat. No.13423), Sodium hydroxide (Cat.

No.30620), CaCl2(Cat. No.31307), Fomaldehyde (Cat. No.33220) Santa Cruz : HA-probe(F-7)HRP (Cat. No.SC-7392)

Scharlau: LB broth (Cat. No.02-385)

Schleich&Schue II: Nitrocellulose Transfer Membrane (Cat.No.10401396) SibEneyme: 1kb DNA leader (Cat. No.SEM11C001)

Sigma: Crystal violet (Cat. No.C-3886), Ethidium bromide (Cat. No.E-7637) Glass Beads(Cat.No.G-9286), Lithium Acetate (Cat. No.L-6883), L-Histidine(Cat. No.H-8125), Polyethylene Glycol3350(Cat. No.P-4338), 2-propanol(Cat.No.I9516), Uridine (Cat. No.U-0750), Lyticase (Cat. No.

L4025-25KU), Tween 20 (Cat. No.P-1379), N,N,N,, N,,-tetramethylenediaminutese (TEMED) (Cat. No.T-9281)

TBB : Prestain Protein marker (Cat. No.0901) Thermo : POLYSINESLIDES (Cat. No.2209-01)

2.5 Buffers

1% crystal violet solution

5 g crystal violet solution, 50 ml 37% formaldehyde, 450 ml H2O 1M Lithium Acetate

40.8 g Lithium Acetate added ddH2O to 400 ml (pH 7.5) 2X SDS-PAGE loading dye

5% Blocking buffer

2.5 g nonfat powdered milk dissolved in 50 ml 1X TBS buffer 5M EDTA stock solution

186.1 g EDTA added ddH2O to 800 ml (pH 8.0) 10% (v/v) Glycerol

12.6 g glycerol (density = 1.26 g/ml), make to 100 ml with dH2O 10X Running buffer (also called Laemmli buffer)

30.3 g Tris base, 144 g Glycine, 10 g SDS, make to 1L with dH2O 10X TE buffer

100 mM Tris-HCl (pH 8.0), 10mM EDTA 10X Transfer buffer

39 mM Glycine, 48mM Tri base, 10% SDS, 20% methanol 40% Dextrose

40g Dextrose added ddH2O to 100 ml 50% PEG3350

75 g polyethylene glycol3350 added ddH2O to 150 ml 50X TAE buffer

48.4g Tris base, 0.5M EDTA (pH 8.0) 20ml, 11.42 ml acetic acid added ddH2O to 200 ml

Breaking buffer

100 mM Tris-HCl (pH 8.0), 1% (w/s) SDS, 2% (v/v) Triton X-100, 100 mM NaCl, 10mM EDTA

LATE buffer

0.1 M Lithium acetate, 10 mM Tris-HCl (pH 7.5), 1mM EDTA Lyticase digestion solution (in PBS)

100μg/ml Lyticase (Sigma L4025; 50kU $45; 500U/mg solid), 3μg/ml PMSF,

2μl/ml β-ME (13.8M stock at 4℃) TBS buffer (Tris-buffered saline)

10 mM Tris-HCl (pH 8.0), 150 mM NaCl TBST buffer

10 mM Tris-HCl (pH 8.0), 150 mM NaCl, 0.05% Tween

PBS buffer

8 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4, 0.24 g KH2PO4

in 800 ml of distilled H2O. Adjust the pH to 7.4 with HCl. Add H2O to 1 liter.

PLATE buffer

40% polyethylene glycol3350 in LATE buffer

2.6 Medium

LB (Luri-Bertni) agar

1% tryptone, 0.5% yeast extract, 1%NaCl, 1.5% agar LB agar /Ampicilline

1% tryptone, 0.5% yeast extract, 1% NaCl, 1.5% agar, 50μg/ml Ampicillin LB broth

1% tryptone, 0.5% yeast extract, 1% NaCl LB broth/Ampicilline

1% tryptone, 0.5% yeast extract, 1% NaCl, 50μg/ml Ampicillin SD agar

0.67% Bacto-yeast nitrogen base w/o aminol acid, 2% dextrose, 2% agar SD broth

0.67% Bacto-yeast nitrogen base w/o aminol acid, 2% dextrose SD agar/Uridine. Histidine

80 mg/l uridine, 100 mg/l histidine SD broth/Uridine, Histidine

0.67% Bacto-yeast nitrogen base w/o aminol acid, 2% dextrose, 80 mg/l uridine, 100 mg/l histidine

YPD agar

2% Bacto-peptone, 1% yeast extract, 2% dextrose 2% agar YPD broth

2% Bacto-peptone, 1% yeast extract, 2% dextrose

2.7 Equipments

4℃ refrigerator KS-101MS (MINUTESI KINGCON)

-20℃ low temperature refrigerator (WHITE-WESTINGHOUSE) -80℃ low temperature refrigerator 925/926 (FRISTEK SCIENTIFIC) Bench top orbital shaker S101 (FIRSTEK)

Certrifuge model 5100 (Kubota Corporation) Digital scale PB153-S (METTLER TOLEDO) Digital scale TB-214 (DENVER INSTRUMENT)

Fluorescence Microscope ECLIPSE TE2000-U (NIKON)

GeneQuant pro DNA/RNA calculator (AMERSHAM PHARMACIA BIOTECH) Gene CycleTM (BIO-RAD)

Image system GEL DOC 2000 (BIO-RAD)

Microcentrifuge MICRO 240A (DENVILLE SCIENTIFIC INC.)

Olympus FluoView Confocal Laser Scanning Microscopes - FV500 (OLYMPUS) Orbital shaker IKA-VIBRAX-VXR

pH meter Φ360 (BACKMAN)

Spectrometer 20GENESYSRT (SPECTRONIC INSTRUMENT)

Shaker VORTEX-GENIE2 G560 (SCIENTIFIC INDUATRIC) Thermal Cycler PTC-100RT (MJ RESEARCH INC.)

Water bath B206-T1 (FIRSTEK SCIENTIFIC) TRANS-BLOT® SD CELL 221BR (BIO-RAD)

相關文件