3-1. Chemicals and reagents
Anti-GAPDH (#sc20357) antibody and HRP-labeled secondary antibodies against goat IgG (#sc2020), mouse IgG (#sc2005), and rabbit IgG (#sc2004) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti- phospho-MEK1/2 (#9121) and
anti-phospho-ERK1/2 (#4370) antibodies were purchased from Cell Signaling Technology (Danvers, MA). Anti-ACE2 (#ab59351) antibody was purchased from Abcam (Cambridge, MA, USA). Ang II (#H1705), Ang 1-7 (#H1715) and (D-Ala7)- Ang 1-7 (A779; #H2888) were purchased from Bachem (Merseyside, UK). Valsartan (#1708762) was from USP (Rockville, MD, USA). The promoterless luciferase reporter vectors, pGL3-Basic (#E1751), and luciferase assay system (#E1500) were purchased from Promega (Madison, WI, USA).
All other reagents were purchased from Sigma-Aldrich (Poole, Dorset, UK).
3-2. Cell culture
Primary human cardiac fibroblasts (HCF, #6300) were purchased from ScienCell Research Laboratories (San Diego, CA, USA). The cells were seeded in 100-mm Petri dishes (2 ×106 cells/dish) or 12-well plate (1 × 105 cells/well) coated with 0.01% poly-l-lysine (#P4832; Sigma-Aldrich) and cultured in commercial media (#2301; ScienCell Research Laboratories), according to the manufacturer’s instructions. The cells were incubated in a humidified 5% CO2 atmosphere at 37°C and culture media was changed every 2 days. The cells at passages 5–6 were used in all experiments. The grown cells were placed into serum-free medium for 24 h prior to experimental treatments. The cells were pretreated with/without the selective antagonists valsartan (1 μM) or A779 (1 μM) for 1 h, then stimulated with Ang II (1 μM) or Ang 1-7 (1 μM) for 24 h. The cells pretreated with specific receptor blockers, valsartan and A779, were used to confirm the receptor
specific-effects of Ang II and Ang 1-7, respectively. Ang II, Ang 1-7, valsartan and A779 applied in the present studies were used at the concentration of 1 μM. For examine the regulation of ACE2 by Ang II, diphenyleneiodonium chloride (DPI) and PD98059 were used at concentration of 5 and 10 μM, respectively. Each experiment was performed
independently three times.
3-3. Total RNA extraction
Total cellular RNA was extracted as recommended by the manufacturer of TRIzol™
(GIBCO BRL, Rockville, MD). Briefly, the TRIzol method consists of the addition of 1 mL of the TRIzol reagent to the cells (5 × 106 cells). The mixture was vigorously agitated for 30 sec and incubated at room temperature for 5 min. After this procedure, 200 μL chloroform was added to the tube, and mix well then centrifuged at 12,000 × g for 15 min. The aqueous phase was transferred to a clean tube, precipitated with 500 μL isopropyl alcohol, and
centrifuged at 12,000 × g for 15 min. The resulting RNA pellet was then washed with 1 mL of 75% cold ethanol and centrifuged at 12,000 × g at 4°C for 10 min. The pellet was dried at room temperature in laminar flow, resuspended in 25 μL of diethylpyrocarbonate
(DEPC)-treated water, and stored at −80°C. RNA was quantified by measuring absorbance at 260 nm and 280 nm and electrophoresed on a denaturing 1% agarose gel. The integrity and relative amounts of RNA were evaluated using ultraviolet visualization of ethidium bromide stained RNA.
3-4. Reverse transcription-polymerase chain reaction (RT-PCR)
Semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) was performed as our previous report [Pan et al., 2008]. For cDNA synthesis, 5 μg RNA was supplemented in a total reaction volume of 20 μL with 1 X reverse transcription buffer, 0.5 mM dNTPs, 2.5 μM oligo-dT (TOYOBO, Osaka, Japan), 1 U/μL RNase inhibitor
(TOYOBO), and 5 U/μL ReverTra Ace™ reverse transcriptase (TOYOBO). After
incubation for 60 min at 42°C, the mixture was incubated for 5 min at 99°C to denature the products. The mixture was then chilled on ice for further use.
PCR primer pairs used for RT-PCR were shown in Table 3-1. PCR reaction contains 2 μL cDNA, 2 μL of each primer (10 μM), 5 μL of 10 X PCR buffer, 2 μL of 10 mM dNTP, 1 μL of 5 U/μL Taq polymerase (Promega, Madison, WI) and 36 μL distilled water in a total volume of 50 μL. Thermal cycler (MiniCycler™; MJ Research, Waltham, MA) conditions were as follows: 1 cycle of 5 min at 94°C, 16 ~ 36 cycles of denaturation, annealing and elongation at 94°C for 30 sec, 55°C for 30 sec and 72°C for 45 sec, respectively. The resulting PCR products were visualized on 1.5% agarose gels stained with SYBR Safe DNA
analyzer (Kodak DC290 Digital camera System™; Eastman Kodak, Rochester, NY, USA), and the band intensity was quantified using densitometric analysis by Scion image™. The relative transcript expression of ACE2, AT1R and Mas were calculated as ratio to
glyceraldehyde-3-phophate dehydrogenase (GAPDH) expression.
Table 3-1. The nucleotide sequences of the PCR primers used to assay gene expression by RT-PCR
Gene Accession no. Forward/Reverse primers sequence (5’→3’) PCR amplification protocol (cycle no.) PCR product size (bp)
GAPDH AF_261085 F-TGGCGCTGAGTACGTCGTG
R-TTCAGCTCAGGGATGACCTT
94°C, 5 min → [94°C, 30 sec → 56°C, 30 sec →
72°C, 45 sec] (18) → 72°C, 3 min 413
ACE2 NM_021804 F-ACGACAATGAAATGTACCTGTTCCG
R-TCCGATCTCTGATCCCAGTGAAG
94°C, 5 min → [94°C, 30 sec → 60°C, 30 sec →
72°C, 45 sec] (38) → 72°C, 3 min 399
AT1R NM_004835 F-CCAAAAGCCAAATCCCACTCAAACC
R-TCTGACATTGTTCTTCGAGCAGCC
94°C, 5 min → [94°C, 30 sec → 57°C, 30 sec →
72°C, 45 sec] (24) → 72°C, 3 min 362
Mas NM_002377 F-ACAACACGGGCCTCTATCTG
R-CTCATGGGCATAGCGAAGAT
94°C, 5 min → [94°C, 30 sec → 57°C, 30 sec →
72°C, 45 sec] (26) → 72°C, 3 min 388
ACE2, angiotensin-converting enzyme II; AT1R, angiotensin II type 1 receptor; GAPDH, glyceraldehyde-3-phophate dehydrogenase
3-5. Quantitative Real-time PCR
SYBR Green quantitative real-time reverse transcription-PCR (SYBR Green QPCR) was performed to detect the mRNA expression level of genes AT2R and GAPDH (as an internal control). SYBR Green QPCR was performed as recommended by the manufacturer of SYBR® Green Real-time PCR Master Mix (#QPK-201; TOYOBO). QCR primer pairs used for QPCR were shown in Table 3-2. QPCR amplification was performed on an ABI 7000 Sequence Detection System (Applied Biosystems, Foster City, CA). According to the instructions of Applied Biosystems, the expression of each gene was quantified as △Ct (Ct of target gene - Ct of internal control gene) using GAPDH as the control and applying the formula 2-△△Ct to calculate the relative fold changes [Winer et al., 1999; Schmittgen and Zakrajsek, 2000].
Table 3-2. The nucleotide sequences of the PCR primers used to assay gene expression by Real-time PCR
Gene Accession no. Forward/Reverse primers sequence (5’→3’) PCR amplification protocol (cycle no.) PCR product size (bp)
GAPDH NM_008084 F- AGGTTGTCTCCTGCGACTTCA
R- CCAGGAAATGAGCTTGACAAAGTTGTC
95°C, 1 min → [95°C, 15 sec → 60°C, 1 min]
(40) 101
AT2R NM_000686 F- CCTCGCTGTGGCTGATTTACTC R- CTTTGCACATCACAGGTCCAA
95°C, 1 min → [95°C, 15 sec → 60°C, 1 min]
(40) 101
AT2R, angiotensin II type 2 receptor; GAPDH, glyceraldehyde-3-phophate dehydrogenase
3-6. Protein extraction and electrophoresis
The cultured cardiac cells (about 4 × 105 cells) were washed with 1 X PBS and lysed by adding 100 μL of PRO-PREP™ protein extraction solution (Intronbio, Gyeonggi-do, Korea), according to the manufacturer’s instructions. The cell lysates were then centrifuged at 12,000 × g at 4°C for 10 min, and the supernatant was collected for sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE). Protein concentration was measured by the Bio-Rad protein assay kit (Bio-Rad, Hercules, CA, USA) with bovine serum albumin (BSA) as a standard. Aliquots containing 30 μg protein were resolved on 10% slab SDS-PAGE gels.
3-7. Western blotting
The extracted proteins of the cardiac cells were electrophorized on SDS-PAGE and then transferred to PVDF membranes (POLYSCREEN™; PerkinElmer, Boston, MA). Briefly, nonspecific binding sites were blocked by incubating membranes in 5% non-fat milk.
Primary antibodies against proteins were diluted as follows: 1:1,000 for ACE2,
phosphorylated ERK1/2, phosphorylated MEK1/2 and GAPDH. The secondary antibodies were applied using a dilution of 1:2,000. Substrates were visualized by using ECL according to the manufacturer’s instructions (Western Lightning Chemiluminescence Reagent Plus™;
PerkinElmer, Boston, MA, USA) and by exposing the membranes to X-Ray film (Super Rx Medical X-Ray Film; Fujifilm, Kanagawa, Japan). The bands were detected at the expected size. The band intensity was quantified using densitometric analysis by imaging software (Scion image™; Scion, Frederick, MD). The amounts of ACE2, phosphorylated ERK1/2 and phosphorylated MEK1/2 are expressed relative to the amount of GAPDH in respective
samples.
3-8. Human ACE2 promoter constructs
Human genomic DNA extracted by genomic DNA extraction kit (Geneaid, Taipei, Taiwan) was used as the template to obtain the promoter fragment of ACE2 genes by PCR-based approach. The upstream regulatory regions of the human ACE2 gene were constructed into a promotorless luciferase-based reporter vector, pGL3-Basic, to generate
pGL3-ACE2 (Figure 3-1). For amplify promoter fragment, the primers were introduced specific recognition sequence of restriction enzyme to facilitate cloning. The
oligonucleotides used for amplify ACE2 promoters were shown in Table 3-3. All constructs used in this study were checked with restriction-mapped and sequenced to confirm their authenticity.
Figure 3-1. The vector map of the pGL3-ACE2 constructs. The cloned human ACE2 promoter region was inserted into the multi-cloning site (XhoI / HindIII) of a promotorless luciferase reporter vector, pGL3-Basic, to generate pGL3-ACE2. Luc+, luciferase structural gene; Ampicillin r, ampicillin resistance gene; ori, origin of replication.
Table 3-3. Sequences of the primers used for construction of human ACE2 promoter plasmids, pGL3-ACE2
Constructs Forward/Reverse sequence (5’→3’) Restriction Enzyme Promoter region Amplicon length (bp) pGL3 (-2069/-49) F- AACCCTCGAGTTTCATTTAGGA
R- CTCATAAGCTTTTCTCTCTTATCA XhoI / HindIII -2069~ -49 2021
pGL3 (-2069/+20) F- AACCCTCGAGTTTCATTTAGGA
R- GAGCTAAGCTTCGTCCCCTGTG XhoI / HindIII -2069 ~ +20 2089
pGL3 (-1493/+20) F- GTTTCTCGAGATGCTCAAATGA
R- GAGCTAAGCTTCGTCCCCTGTG XhoI / HindIII -1493 ~ +20 1513
pGL3 (-1110/+20) F- TGACCTCGAGTGAGTTTTGAAT
R- GAGCTAAGCTTCGTCCCCTGTG XhoI / HindIII -1110 ~ +20 1130
pGL3 (-516/+20) F- TAAAGACTCGAGCAAAGTCATG
R- GAGCTAAGCTTCGTCCCCTGTG XhoI / HindIII -516 ~ +20 536
Restriction enzyme recognization sequences within primers are shown in red letters.
The promoter region is defined according to the position relative to the transcription start site (+1) in ACE2 mRNA sequence (GenBank No.
AF_291820
3-9. Transient transfection and luciferase reporter assay
The cells were transfected with plasmid DNA using Turbofect™ in vitro transfection reagent (Fermentas, Glen Burnie, MD, USA) according to the manufacturer’s instructions for the reverse transfection. Briefly, 2 μg DNA was diluted in 200 μL of cell growth medium.
Add 4 μL of TurboFect to the diluted DNA and mix gently, and then the mixture was
incubated for 15-20 min at room temperature. Gently layer 2 mL of fresh trypsinized cells (1 × 105 cells/well) on top of the TurboFect/DNA mixture in 12-well culture plate. Incubate cells at 37°C in CO2 incubator for 24 h prior to testing for transgene expression.
Luciferase-based reporter gene assay was performed according to the manufacturer’s instructions (Promega). Before harvesting, cell monolayers were rinsed twice with ice-cold 1 × PBS. Cells were, subsequently, scraped in 1 × luciferase cell culture lysis reagent (CCLR; Promega), then cell lysates were centrifuged at 4°C for 2 min. Total protein concentration of the supernatants was measured by the protein assay kit (Bio-Rad). To mix 20 μL of the supernatant containing equal amounts of total protein with 100 μL of luciferase assay reagent (Promega) prior to analysis. Luciferase enzymatic activities were measured with Lumat LB9507™ single tube luminometer (Brethold Techonologies, Bad Wildbad, Germany).
3-10. Immunocytochemistry
Human cardiac fibroblasts (HCF, #6300) were grown overnight on coverslips (1.2 mm, 0.01% Poly-L-Lysine treated 1 h) in commercial media (#2301; ScienCell Research
Laboratories) and incubated in a humidified 5% CO2 atmosphere at 37°C. The coverslips were washed in PBS, fixed with 4% formaldehyde for 15-20 min, treated with 0.5% Saponin (Sigma-Aldrich) for 10-15 min and nonspecific sites were blocked with 1% BSA for 30 min.
Coverslips were then treated with anti-ACE2 and anti-AT1R antibody (1:100 dilution) at 37°C for 1 h followed by Alexa Fluor 488 and 594 second antibody (#A11032, #A11034;
Invitrogen, Eugene, OR) (1:200 dilution) at 37°C for 1 h in a humidified chamber.
Coverslips were also counterstained with DAPI (1:10000 dilution) at 37°C for 5 min in a humidified chamber. After washing in PBS, cover slips were mounted by DakoCytomation Fluorescent Mounting Medium (DakoCytomation, Denmark A/S) on glass slides and
TM
Tokyo, Japan).
3-11. Statistics
All values are expressed as mean ± standard deviation (SD). Data were compared with one-way analysis of variance (ANOVA) test to evaluate differences among multiple groups.
A value of P < 0.05 was considered statistically significant.