2-1 Microalgal strains
These microalgae of Chlorella sp., Nannochloropsis oculata, Skeletonema costatum, Isochrysis galbana and Tetraselmis chui were obtained from Taiwan Fisheries Research
Institute (Tung-Kang, Taiwan). The figures of these microalgae stains are showed in Figure 2-1. At first, these microalgae were screened at the same condition and provision to choose the high-growth and rich-lipid microalgae as the candidates to this study. In our subsequent results showed the Chlorella sp. and N. oculata had the potential for the research of biodiesel production and waste-gas reduction.
Chlorella sp.: The species of Chlorella sp. was isolated in Taiwan but unidentified,
nevertheless, the partial sequence of 18S rRNA (599 bp) of the Chlorella sp. has been amplified and sequenced for species identification within the research. The result of sequence alignment was performed by NCBI nucleotide blast [Wu et al., 2001]. The blast result provides an evidence to prove the Chlorella sp. used in our research is identified as several Chlorella sp. strain, such as KAS001, KAS005, KAS007, KAS012, MBIC10088, MDL5-18 and SAG 211-18.
Nannochloropsis oculata: The microalga, N. oculata NCTU-3, was screened for its
potential ability of growth and biomass production at National Chiao Tung University, Taiwan.
2-2 Microalgae inoculums
The steps of microalgal inoculums, initially, a stock culture of Chlorella sp. or N. oculata
800 mL working volume of modified f/2 medium at 26 ± 1°C and illuminated at 300
μmol/m2/sec. After Six days culture, the microalgal cells were harvested by centrifugation at 3,000 × g for 5 min. After this step, the pelleted cells were re-suspended in 50 mL fresh modified f/2 medium. The density of cells in the culture was then measured and these microalgal cells were arranged for the further experiments.
2-3 Culture medium and nutrients
The microalgae were cultured in modified f/2 medium in artificial sea water which has the following composition (per liter): 29.23 g NaCl, 1.105 g KCl, 11.09 g MgSO4 . 7H2O, 1.21 g Tris-base, 1.83 g CaCl2 . 2H2O, 0.25 g NaHCO3, and 3.0 mL of trace metal solution [Guillard, 1962; Guillard, 1975]. The trace elemental solution (per liter) contains chemicals in Table 2-1.
2-4 Microalgae cryopreservation
The microalgae in the early stationary phase (approximately 4 × 107 cells/mL) form the cultivation culture were obtained and centrifuged to get an approximately ten-fold higher cell density. Then the prepared 2.2 M glycerol was gradually added to an equal volume of freshly concentrated microalgal cell suspension in 1.5 mL cryotubes. After waiting for 20 minutes for the acclimatization of these samples at room temperature, the cryotubes were put into 4, -30, -80°C by turns in every 30 min. Lastly, cryotubes contained microalgae were transferred to freeze in liquid N2 for preservation.
2-5 Experimental system with photobioreactors
The N. oculata NCTU-3 was cultured in a cylindrical glass photobioreactor (30 cm length, 7 cm diameter) with 800 mL of working volume placed at 26 ± 1°C under continuous, cool white, fluorescent lights. The setup of photobioreactor for microalgal culture system was described in the previous research [Chiu et al., 2008]. Light intensity was approximately 300 μmol/m2/sec at the surface of photobioreactors. Gas provided as different
concentrations of CO2 mixed with ambient air was prepared with a volumetric percentage of CO2 and filtered (0.22 μm) to give CO2 concentrations of 2, 5, 10, or 15%. The microalgal cultures were aerated continuously with gas provided via bubbling from the bottom of reactor with an aeration rate of 200 mL/min (i.e., 0.25 vvm, volume gas per volume broth per min).
A pre-cultured N. oculata NCTU-3 was inoculated in cylindrical glass photobioreactor in 800 mL culture volume at an initial biomass concentration (calculated dried weight of microalgal cells per liter, g/L) of 0.01 g/L (approximate 7 × 105 cells/mL) as a batch culture. Different concentrations of CO2 aeration were mixed with air and pure CO2, and adjusted by gas flow meter (Dwyer Instruments, Inc., Michigan, IN, USA) to give a flow rate of 0.25 vvm (volume gas per volume media per min).
2-6 Microalgal cell counting and biomass
A direct microscopic count was performed with Brightline Hemocytometer (BOECO, Hamburg, Germany) and a Nikon Eclipse TS100 inverted metallurgical microscope (Nikon Corporation, Tokyo, Japan). Cell density (cells/mL) was measured by an Ultrospec 3300 pro UV/Visible spectrophotometer (Amersham Biosciences, Cambridge, UK) at the
absorbance of 682 nm (A682). Each sample was diluted to give an absorbance in the range 0.1-1.0 if optical density was greater than 1.0. Microalgal dry weight per liter (g/L) was measured according to the method previously reported [American Public Health Association,
water. Microalgal pellet was dried at 105°C for 16 hr for dry weight measurement [Takagi et al., 2006].
2-7 Growth rate of Microalgae
A regression equation of the cell density and dry weight per liter of culture was obtained by a spectrophotometric method [Guillard, 1973; Chiu et al., 2008]. Biomass was calculated from microalgal biomass produced per liter (g/L). Specific growth rate (μ, 1/d) was calculated as follows:
t W W
f o= ln( Δ / ) μ
where Wf and W0 were the final and initial biomass concentration, respectively. △t was the cultivation time in day [Ono and Cuello, 2007].
2-8 Measurement of nitrogen concentration in culture
Consumption of nutrients in microalgal culture was monitored by the determination of medium nitrate content [Tonon et al., 2002]. Nitrate concentration was determined according as the method reported by Collos et al. [1999]. A sample form cultures was centrifuged at 3,000 × g for 5 min. Take out the supernatant solution and measure the absorbance of supernatant was at 220 nm by UV-visible spectrometer. The standard curve was determined and calculated from authentic sodium nitrate at concentrations from 0 to 440 μM.
2-9 Lipid analysis
2-9-1 Measurement of lipid content by lipid extraction
To extract the lipid from the microalgae, the collected microalgal sample from the cultures were centrifuged at 3,000 × g for 15 min. The cells were washed with deionized water twice, and then obtained microalgal dry biomass by lyophilizing the samples. About weighted 30 mg sample was precipitated in methanol/chloroform in the ratio of 2:1 (v/v), following that sonicated for 1 hr. Chloroform and 1% NaCl were added to give the mixture to a ratio of methanol, chloroform, and water of 2:2:1. The mixture was centrifuged at 1,000 × g for 10 min and the chloroform phase was collected. Chloroform was removed under vacuum in a rotary evaporator to eliminate the organic solvent [Takagi et al., 2006]. The remaining from the evaporation was weighed as microalgal lipid. The lipid content (%) is calculated by the formula: weight of lipid (g)/weight of sample (g) ×100%.
2-9-2 Saponification and esterification for GC analysis
Lyophilized microalgal cells 0.1 g were mixed with 8 ml of 0.5N KOH in methanol and sonicated for 3 min. Firstly saponification, the mixture was heated to 100 °C for 15 min and then cooled to room temperature. And then, 8 mL of 0.7N HCl in methanol and 14% (v/v) BF3/CH3OH were added to the mixture and heated to 100 °C for 15 min for esterification.
After cooling to room temperature, 2 ml of a saturated solution of NaCl was added for
washing and emulsification. The fatty acid methyl esters formed were extracted by using of n-hexane. The upper hexane layer was separated by centrifugation and analyzed for fatty acid methyl esters [Su et al., 2007].
2-9-3 GC analyzer
Fatty acid methyl esters were analyzed by standard gas chromatography (HP5890 series II)
0.25 µm, and 0.25 mm) was suitable for the analysis of fatty acid methyl esters and a flame ionization detector (FID). Helium with a flow rate of 1.5 mL/min was used as the carrier gas.
Temperature was programmed from 70°C to 170°C at 30°C/min and thereafter to 220°C at 2°C/min. Injector and detector were maintained at 220°C and 300°C, respectively. Fatty acid methyl ester (or lipids) contents were determined from their peak areas. The data presented are the average of three estimates.
2-9-4 Measurement of lipid content by fluorescent spectrometry
For fast determination of lipid content, a fluorescent spectrometric method was applied.
In the method, the microalgal cells were stained with Nile Red (Sigma, St. Louis, MO, USA) followed the protocol reported by de la Jara et al. [2003]. In brief, 1 mL of 1 × 106 cells suspension was added 50 μL of Nile Red in acetone working solution as a concentration of 0.1 mg/mL for lipid staining. The mixture was gently inverted for mixing and incubated at 37°C in darkness for 10 min. In the detection, the fluorometer with a 480 nm excitation filter and a 580 nm emission filter was used. Non-stained cells were used as an
auto-florescence control. The relative florescence intensity of Nile Red was calculated as florescence intensity of Nile Red stained subtracted auto-florescence intensity signal [Lee et al., 1998; Liu et al., 2008]. The following equation of the correlation curve indicated
fluorescent intensity of Nile Red staining vs. lipid content measured by gravimetric method.
y = 1.680x + 5.827 R2 = 0.994 (p < 0.001)
The value y is total lipid content determined by gravimetric method. The value x is the relative arbitrary unit obtained Nile Red fluorescent spectrometric method.
2-10 Setup of semicontinuous culture system
Before the N. oculata NCTU-3 cultures applied to the semicontinuous system aerated with various CO2 concentrations, the microalga was grown in a batch culture and aerated with air.
When the cell density in the batch culture reached to about 1 × 107 cells/mL, the culture was changed into the aeration of 2% CO2. After 4-6 days cultivation aerated with 2% CO2, cell density of the culture reached up to about 1 × 108 cells/mL. The culture was then replaced half of broth with fresh medium each day and performed for 3 days. After that, the culture was also replaced half of broth with fresh medium at the forth day and aerated with 2, 5, 10, and 15% CO2. After 4 days culture, the sampling time was at 6,12, and 24 hr everyday and the culture was replaced half of broth with fresh medium daily. This following method is published by Chiu et al. [2009].
2-11 Autotrophic, heterotrophic, and mixotrophic growth in microalgal cultures
The initial inoculum was prepared with 2 × 107 cells/mL of N. oculata incubated in an Erlenmeyer cylindrical flask (22 cm length, 7 cm diameter) containing 800 mL working volume of modified f/2 medium and incubated at 26 ± 1°C. In heterotrophic growth, cultures in the reactor were supplemented with each different kind of carbon source and aerated with filtered (0.22 μm) ambient air continuously. Whereas, for the mixotrophic growth, cultures were added with each different kind of carbon source and aerated with the filtered ambient air mixing with CO2 that give the CO2 concentrations of 2%. The cultures under photoautotrophic condition which represented the control for these studies were not supplemented with any organic carbon source in the medium. All the cultures for all of the growth conditions were aerated continuously at a rate of 200 mL/min (i.e., 0.25 vvm).
2-12 Effect of organic carbon on the growth
For the purpose to test the growth of N. oculata on different organic carbon sources, experiment was carried out in the dark (heterotrophic condition) and in the light
(mixotrophic condition) with the presence of four organic carbon substrates, which were glucose, citric acid, sucrose and sodium acetate in the same concentration (10 mM) [Bouarab et al., 2004], and with 2% CO2 aeration. The cultures were incubated at 26 ± 1°C under continuous, cool white, fluorescent light which is 300 μmol/m2/s at the surface of the cultures for mixotrophic condition and photoautotrophic condition. For the heterotrophic condition, the reactors were wrapped with aluminum foil to maintain in the total darkness.
All organic nutrients were prepared in water sterilized by filtration through a 0.22 μm Millipore filter. The growth of N. oculata was measured according to a standard curve between cell density and absorbance at 682 nm.
2-13 Transesterification of microalgal oil
The reaction of transesterification by three types of catalysts: acid, base, and enzyme (lipase). The acid catalyst is 1.5% H2SO4 and the base catalyst NaOH is also 1.5%. The highest oil/methanol molar ratio in acid catalysis and alkali catalysis is 1:30 and 1:6. The transesterification reactions of acid and alkali catalysis are in 60°C for 1 hour by sonication.
And in the transesterification of enzyme, catalysis is 10% Rhizopus oryzae to oil weight.
The reaction performs in 30°C for 72 hour by 150 oscillations/min.
2-14 RNA extraction of microalgae
Freezing microalgae in liquid nitrogen or -80°C was grind with liquid nitrogen in a
pre-cooled mortar and pestle to a fine powder. Added 10 ml extraction buffer in 1g microalgae, mixed vigorously in the room temperature at least 30 min and extracted with 1 volume of chloroform/isoamyl alcohol (24/1) for 3 minute. After that, centrifuged at 12,000g and room temperature for 20 min, and then recovered the aqueous phase (upper phase). 0.2 - 0.3 volumes of ethanol were added to mix gently and extracted with 1 volume of chloroform for 3 minute. And then, centrifuged at 12,000 g and room temperature for 20 min and recovered the upper phase and added 0.25 volume of 12 M LiCl with
mercaptoethanol to 1% final concentration to mix vigorously and place at -20° overnight.
Centrifuged at 12,000g and 4°C for 1 hour, carefully removed the aqueous phase and inverted the tube on some absorbent paper. Dissolved the pellet in 1 ml of TE on ice and extracted with phenol/chloroform (50/50, pH 4.3). And then, precipitated the RNA from the aqueous phase by adding 0.1 volumes of 3M sodium acetate and 2.5 volumes of ethanol and placed it at -20°C for at least 6 hours before centrifuging for 20 minutes in 10,000g.
Finally, washed the pellet 80% ethanol and re-suspended the RNA in TE or ultrapure water.
2-15 ACCase expression
N. oculata was cultured for ACCase (Acetyl-coenzyme A carboxylase) expression. The
microalgal total RNA was extracted and then determine the cDNA via reverse transcription.
PCR amplification was used to obtain 241-base pairs ACCase-encoding fragments. The following oligonucleotides were used in this study as primers for DNA amplification of ACCase. Forward primer (PR1) is TTTATGGGGGGAAGTATGGGCTC. The reverse primer (PR2) is CCAACAACAGGTGGTGTAACTGC (all sequences are written 5’→3’).
The PCR reaction mixture 25μL included of 50 ng DNA, 0.1μM concentration of each primer species, 10 mM Tris-C1 (pH 8.3), 50 mM KCl, 1 mM MgCl, 0.2 mM dNTPs, and 1
min; Step 2, 94 ℃ for 1 min; Step 3,45℃ for 2 min; Step 4, 2℃/s to 72℃; Step 5, repeat steps 2 to 4 for 30 times total; and Step 6,72℃ for 8 min.
However, the ACCase expression is compared with the expression of actin as an internal control. The following oligonucleotides were used as primers for actin (all sequences are written 5’→3’); forward primer (PR3) is GACGCAGATCATGTTTGAGACCTTC and the reverse primer (PR4) is GACATCAAGGAGAAGCTGGGC.
2-16 Parameter analyses
Sample pH was directly determined with an ISFET pH meter KS723 (Shindengen Electric Mfg Co. Ltd., Tokyo, Japan) and the pH meter was calibrated daily using pH 4 and 7
solutions.
The CO2 concentration in airstreams, CO2 (g), was measured using a Guardian Plus Infra-Red CO2 Monitor D-500 (Edinburgh Instruments Ltd, Livingston, UK).
Light intensity was measured from the light-attached surface of the photobioreactor using a Basic Quantum Meter (Spectrum Technologies, Inc., Plainfield, IL, USA).
2-17 Statistics
All values are expressed as mean ± standard deviation (SD). A Student’s t test was used to evaluate differences between groups of discrete variables. A value of p < 0.05 was considered statistically significant.