• 沒有找到結果。

Chapter 1 Introduction

1.5 Research aim

With considerably high protein content, soybean is considered a suitable plant host for expressing recombinant proteins. Combining the capability of hairy roots to grow rapidly in a hormone free liquid culture, soybean hairy roots is thought to be an ideal system for metabolic engineering and a valuable material for specialty chemical production. Previous studies on soybean hairy roots focused on high efficiency hairy roots induction and using soybean hairy roots as a model for soybean root defense system (Cho et al., 2000; Xiang et al., 2005). A more recent study attempted to modify phenolic metabolic pathways in soybean hairy roots by transforming two key enzymes into soybean separately, it resulted in a down regulation due to homology-dependent gene silencing (Lozovaya et al., 2007).

In this study, we attempt to construct an A. rhizogenes-mediated soybean hairy roots induction system. Further, using soybean hairy roots as an expression system for studying the efficiency of multiple genes co-expression. This co-expression system is thought to be a useful tool for soybean isoflavone synthetic pathway research.

13

Chapter 2

Materials and Methods

14

2.1 Plasmid constructions

2.1.1 Binary vectors

Binary vectors pCAMBIA 1201, pCAMBIA 1301, and pCAMBIA 1302 were purchased from CAMBIA (Canberra, Australia). Vector pCAMBIA 1201 and pCAMBIA 1301 both have gusA in the T-DNA region, with chloramphenicol and kanamycin resistance genes on the backbone, respectively. Vector pCAMBIA 1302 contains mgfp5 and kanamycin resistance gene (Figure 2).

For vector conservation and high-copy production of the vector, all vectors were transformed by heat shock into E. coli JM-109 competent cells (Yeastern Biotech, Taipei, Taiwan). Binary vectors were then purified from an over-night incubated E. coli cultures. Vectors were then digested with respective restriction enzyme, the digestion products were resolved on 1.2% agarose gel, and the digested fragments were confirmed after ethidium bromide (EtBr) staining.

Vector pCAMBIA 1201 and pCAMBIA 1302 were used directly without modification in A. rhizogenes transformation and then A. rhizogenes-mediated soybean co-transformation study. The two vectors were transformed into A. rhizogenes individually or simultaneously (the A. rhizogenes transformation method will be described later), resulting in A. rhizogenes containing each one, respectively, or both of the vectors. A. rhizogenes 1201 and A. rhizogenes 1302 were used together for

15

co-transformation of soybean (the soybean transformation method will be described later), this experiment construction was named 2AR for two strains of transformed A.

rhizogenes inducing hairy roots simultaneously (Figure 3). The A. rhizogenes

containing both pCAMBIA 1201 and pCAMBIA 1302 was also used in soybean co-transformation study and named as 2BV for one A. rhizogenes containing two binary vectors (Figure 4).

2.1.2 Two reporter genes in one T-DNA region

The gfp gene containing the upstream CaMV35S promoter and downstream nos terminator was cloned from binary vector pCAMBIA 1302. The forward primer contained a restriction site BamHI, and the reverse primer contained a HindIII site (This primer-pair was designed according to NCBI nucleotide database AF234298). The 1679 base pairs target sequence was amplified by PCR reaction.

F-35SGFPNOS:5’-TTTGGATCCTTTCCGCCTTCAGTTTAGCTTCATGGAGTCAAAGATTCA-3’

R-35SGFPNOS: 5’-TTTAAGCTTTTTCTTTTCTCTTAGGTTTACCCGCCAATATATCCTGTC-3’

The composition of PCR reaction solution:

16

Volume (μl) Final concentration

Template: pCAMBIA 1302 1.0 < 0.1 μg

4 mM dNTP 2.5 400 μM each

10X Reaction buffer 2.5 1X

10 μM primers 2.5 1 μM

Super-Therm Polymerase 0.5 2.5 U

Double distilled H2O 13.5 -

Total volume 25.0 -

PCR amplification was performed for 30 cycles in a thermal cycler (PCR Px2 Thermal Cycler Personal, Thermo Fisher Scientific Inc., Waltham, MA, USA). The PCR program for gfp was: 95°C, 5 min for denaturation; 94°C, 1 min, 55°C, 1 min, 72°C, 2 min for 30 cycles; 72°C 15 min and paused at 4°C.

The PCR product and vector pCAMBIA 1301 were both digested by restriction enzyme BamHI and HindIII, the two digested fragments were then ligated by T4 DNA ligase according to the user manual. The ligation product was resolved on 1.2% agarose gel, followed by EtBr staining to check the ligated vector. The ligated vector was transformed into E. coli JM-109 by heat shock method, then purified from an over-night incubated culture and sent for DNA sequencing (Tri-I Biotech Co., Taipei, Taiwan). This newly constructed binary vector was named plasmid 2RG for containing two reporter genes, gfp and gus, in a single T-DNA region (Figure 5).

17

2.1.3 Two T-DNA regions in one binary vector

The whole T-DNA region between the left-border and right-border of binary vector pCAMBIA 1302 was cloned by PCR amplification with primers containing restriction site SacII (This primer pair was designed according to NCBI nucleotide database AF234298). The 4336 base pairs target sequence was amplified by ExSel High Fidelity DNA Polymerase (JRM Holdings, Kent, UK).

F-TDNAGFP: 5’-TTTTCCGCGGTGGCAGGATATATTGTGGTGTAAACAAATTGACGCTTAG-3’

R-TDNAGFP: 5’-TTTTCCGCGGTAAACGCTCTTTTCTCTTAGGTTTACCCGCCAATATATC-3’

The composition of PCR reaction solution:

Volume (μl) Final concentration Template: pCAMBIA 1302 1.0 < 0.1 μg

18

PCR amplification was performed for 30 cycles in a thermal cycler. The PCR program for the whole T-DNA region containing gfp was: 95°C, 5 min for denaturation;

94°C, 1 min, 65°C, 30 sec, 72°C, 5 min for 30 cycles; 72°C 15 min and paused at 4°C.

The PCR product and the vector pCAMBIA 1301 were digested by restriction enzyme SacII, and then both dephosphorylated with alkaline phosphatase according to the user manual. The two fragments were then ligated with T4 DNA ligase, and the ligated vector was resolved on 1.2% agarose gel followed by EtBr staining to check the ligated vector. The ligated vector was transformed into E. coli JM-109 by heat shock method, then purified from an over-night incubated culture and sent for DNA sequencing. This newly constructed binary vector was named plasmid 2TD for containing two T-DNA regions in a single binary vector (Figure 6).

2.2 Bacteria transformation methods

2.2.1 Heat shock method for E. coli transformation

E. coli heat shock transformation method was carried out according to the user

manual, describe as follows. Prepare Luria-Bertani (LB) plate containing antibiotics 50 μg ml-1 kanamycin, and 50 μg ml-1 chloramphenicol. Competent cells were thawed from -70°C storage by holding under running tap water for about 20 seconds until half thawed. Two μl of pre-chilled vector or ligation product was added to 100 μl competent

19

cells, mixed by vortex then placed the tube on ice for 5 minutes. Cells were heat shocked for 45 to 90 seconds in a water bath at exactly 42°C, then immediately placed back on ice for 10 minutes. Cell recovery was carried out by incubating the competent cells in 2 ml LB medium without antibiotics in an orbital shaker at 150 rpm, 37°C for 1 hour. Cells were plated on LB plate containing respective antibiotics and incubate at 37°C overnight. Finally, single colony was selected and conserved.

2.2.2 Electroporation for A. rhizogenes transformation

2.2.2.1 Preparation of A. rhizogenes cells

A. rhizogenes 1610 wild-type was cultured in a Hinton flask with 100 ml LB

medium in an orbital shaker at 125 rpm, 30°C. A. rhizogenes was cultured until the cells grown to the middle-log phase with OD600 at 0.6-0.8, the cells were collected by centrifugation at 1000x g, 4°C. The pellet was re-suspended by 100 ml pre-chilled sterile double distilled water, and then collected by centrifugation again. This step was repeated four times and decreasing the re-suspension volume by 50 ml, 25 ml, 10 ml, then 5 ml. The pellet was finally re-suspended in 1 ml pre-chilled sterile double distilled water, placed on ice, and the A. rhizogenes cells were prepared.

20 2.2.2.2 Electroporation of A. rhizogenes

Two micro liter purified binary vector (~200 ng) was mixed with 48 μl A.

rhizogenes cells, the mixture was then placed in a pre-chilled sterile Pulser Cuvette

(Bridge Tech., Palo Alto, CA, USA) with a 1 mm electrode gap. The electroporation was performed at 25 μF, 200 Ω, 2.5 kV with a Gene Pulser (Bio-Rad Laboratories Inc., Hercules, CA, USA). The transformed A. rhizogenes was then recovered by cultivating 1 hour in an orbital shaker at 100 rpm, 30°C. After cultivation, the cells were plated on LB plate containing corresponding antibiotics and incubated at 30°C for 48 hours.

Single colony was selected and transformation was confirmed by PCR described later.

2.2.3 Transformation efficiency of A. rhizogenes

Transformation efficiency is the number of transformed cells (transformants) generated by 1 µg of plasmid DNA in a transformation reaction. For wild-type A.

rhizogenes single binary vector transformation, binary vector pCAMBIA 1201 was first

transformed into wild-type A. rhizogenes. The transformed cells were series diluted and plated on LBC plate. After 48 hours of cultivation, colonies on each plate were counted and the transformation efficiency was calculated by dividing the number of colonies on plate by micro grams of plasmid DNA plated. For pCAMBIA 1302, the same process was carried out by using LBK plate instead of LBC plate.

21

Successfully transformed A. rhizogenes 1201 and A. rhizogenes 1302 were then used as recipient strains for the transformation efficiency test of the second binary vector. The transformed cells were planted on LBCK plate, and the transformation efficiency was calculated as mentioned above.

Finally, both pCAMBIA 1201 and pCAMBIA 1302 were transformed simultaneously into wild-type A. rhizogenes for the calculation of transformation efficiency of two plasmids. The transformed cells were planted on LBCK plate, and the transformation efficiency was calculated as mentioned above.

2.2.4 PCR confirmation

Transformants of A. rhizogenes were confirmed by colony PCR with respective primer pairs specific for gfp and gus (Primer pairs were designed according to NCBI nucleotide database AF234293 and AF234298 ).

F-gfp: 5’-GAGAGAACACGGGGGACTCTTGAC-3’

R-gfp: 5’-ACTTTATTGCCAAATGTTTGAACG-3’

F-gus: 5’- TGATGATGATAGTTACAGAACCGACGA-3’

R-gus: 5’- CAGTCAACAGACGCGTGGTTACAGTC-3’

22 The composition of PCR reaction solution:

Volume (μl) Final concentration

A. rhizogenes - -

PCR amplification was performed for 30 cycles in PCR Px2 Thermal Cycler Personal (Thermo Fisher Scientific Inc., Waltham, MA, USA). The PCR program for both gfp and gus was: 95°C, 5 min for denaturation; 94°C, 1 min, 60°C, 30 sec, 72°C, 1 min for 30 cycles; 72°C 15 min and paused at 4°C.

PCR products were then resolved on a 1.2% agarose gel, followed by EtBr staining to check the 638 base pairs gus fragment and 833base pairs gfp fragment.

2.3 Establishment of hairy root clones

2.3.1 Soybean sterile plants germination

Six genotypes of soybean were used in this study to select the soybean as the suitable material for A. rhizogenes-mediated hairy roots induction. Soybean Tainan #2,

23

Tainan #5, Tainan #7, and Kaohsiung #5 were kindly provided by Tainan District Agricultural Research & Extension Station (Tainan, Taiwan). Soybean BS90T60 Minnesota was kindly provided by American Soybean Association IM (Taipei, Taiwan).

In addition, one commercial non-transgenic soybean was also used (Figure 8 (A)).

The surface-sterilization solution was prepared by adding 3 ml commercial hydrogen peroxide (~35%) into 21 ml commercial ethanol solution (~97%) in a sterile 50 ml tube. Soybean seeds were dipped in the solution and surface-sterilized by inverting the tube for 2 minutes. The seeds were washed with sterilized distilled water for 10 times, and then dipped in sterilized distilled water for 1 hour to remove residue detergents. Sterilized seeds were placed on sterilized vermiculite, and sterilized distilled water was added to moisturize the vermiculite. Seeds were germinated in the culture box with a cycle of illumination at 28°C for 12 hours, and at 25°C for another 12 hours in the dark.

2.3.2 Preparation of A. rhizogenes for induction of soybean hairy roots

A. rhizogenes harboring the binary vector was cultured overnight in LB medium

containing corresponding antibiotics in an orbital shaker at 125 rpm, 30°C.

Subsequently, 20 μl of the A. rhizogenes culture was inoculated to 2 ml fresh LB medium containing antibiotics, A. rhizogenes was cultured for 12 hours. Acetosyringon

24

was added to a final concentration of 200 μM to enhance the virulence of A. rhizogenes.

This culture was then cultured for another 12 hours, and then A. rhizogenes was ready for soybean infection.

Before using A. rhizogenes to induce soybean hairy roots, cells of A. rhizogenes strains were measured. Both strains 1201 and 1302 of A. rhizogenes underwent series dilution and their OD600 was measured by spectrophotometer (Hitachi, Pleasanton, CA, USA). The same diluted series were also plated on LB plates, colonies were counted after overnight cultivation. Calibration curve of A. rhizogenes OD600 versus colony number was used to estimate the colonies for A. rhizogenes-mediated soybean hairy root induction (Figure 7).

2.3.3 Induction of soybean hairy roots

One-week old soybean plants were about 8-10 cm in height and the cotyledons were green and expanded, soybean explants at this time are most suitable for A.

rhizogenes infection (Kereszt et al., 2007). The soybean shoots were cut into ~2 cm

segments, and cotyledons were cut at both ends to make wounded exposure.

Subsequently, A. rhizogenes was applied to one end of the shoot or cotyledon, then the segments were placed on fresh 1/2 MS (Murashige and Skoog, 1962) plate with the

25

“clean” end. A. rhizogenes and soybean tissue were co-cultivated at dark, 22°C for hairy root induction.

2.3.4 Sterilization of hairy roots

After co-cultivation for 14 to 21 days, the induced roots were picked up individually and placed on fresh 1/2 MS plates containing 300 μg ml-1 cefotaxime for sterilization of A. rhizogenes. After 7 days, roots were transferred to a fresh plate also containing cefotaxime and incubated for another 7 days. After two rounds of sterilization, roots were transferred to liquid cultures.

2.3.5 Liquid cultures of hairy roots

The roots were transferred individually to 50 ml 1/2 MS medium containing cefotaxime in 250 ml flasks and cultivated in an orbital shaker at 70 rpm, 25°C in the dark. Root clones were weighted at day 0, and weighted again after 21 days of cultivation. The root clones were then transferred to fresh 1/2 MS medium without cefotaxime and cultivated for another 21 days.

26

2.4 Confirmation of foreign DNA in root clones

2.4.1 Extraction of genomic DNA

Fresh root tissues were grounded into powder with liquid nitrogen, and genomic DNA was extracted using Wizard® Genomic DNA Purification Kit (Promega, Madison, WI, USA) according to the user manual with a few modifications: (1) Place 50 mg of root tissue powder in a 1.5 ml microcentrifuge tube, add 600 μl of Nuclei Lysis Solution and mix by vortexing 3 seconds. (2) Incubate the tube at 65°C for 15 min and invert the tube every 3 to 5 minutes. (3) Add 3 μl RNase Solution to cell lysate and mix by inverting the tube, incubate the tube at 37°C for 15 minutes. (4) After cooling the sample to room temperature, add 200 μl Protein Precipitation Solution and vortex vigorously for 20 seconds. (5) Centrifuge for 10 minutes at 12,000 rpm and then carefully transfer the supernatant to a clean tube containing 600 μl isopropanol. (6) Mix the solution by inversion until DNA form thread-like visible mass, centrifuge at 12,000 rpm for 3 minutes. (7) Carefully remove the supernatant then add 600 μl 70% ethanol and wash the DNA by inverting the tube, centrifuge at 12,000 rpm for 3 minutes. (8) Carefully remove the supernatant, invert the tube on clean absorbent paper and air-dry the pellet for 15 minutes. (9) Add 100 ml Rehydration Solution and incubate the tube at 65°C for 1 hour. (10) Store Genomic DNA at -30°C.

27

2.4.2 Confirmation of foreign genes with PCR

Genomic DNA extracted from transgenic root clones were used for PCR analysis.

For foreign genes confirmation, conditions of PCR reactions were the same as A.

rhizogenes. To detect the hairy roots specific gene, rolC specific primers were used for

PCR reaction. (Primers were designed according to the NCBI nucleotide database E03275.)

F-rolC: 5’- ATGGCGGAATTTGACCTATGTGCTCTCTTTTCC – 3’

B-rolC: 5’- CCTCACTCCATTCCAAATTTGCATTCGCCATGCC – 3’

The composition of PCR reaction solution:

Volume (μl) Final concentration

Genomic DNAextracts 2.5 < 1 μg

28

PCR amplification was performed for 30 cycles in a thermal cycler. The PCR program for rolC was: 95°C, 5 min for denaturation; 94°C, 1 min, 56°C, 30 sec, 72°C, 40 sec for 30 cycles; 72°C, 10 min and paused at 4°C. The amplified fragment was resolved on a 1.2% agarose gel, followed by EtBr staining to check the PCR products.

2.5 Functional GFP and GUS confirmation

2.5.1 Direct observation of GFP

Green Fluorescence Protein (GFP) has two excitation peaks, a major one at 395 nm and a minor one at 475 nm. Its emission peak is at 509 nm in the lower green portion of the visible spectrum. Fluorescence of roots was observed directly on 1/2 MS plate by fluorescence microscopy (Nikon E600,Tokyo, JP) combined with a digital camera. The fluorescence microscope has a fluorescence filter combination of excitation wavelength:

450-490 nm; dichroic mirror wavelength: 495 nm; barrier wavelength: 500-550 nm. The digital camera was Olympus C7070 wide-zoom (Olympus, Tokyo, Japan) set to full manual mode with aperture at 4.8, shutter at 30 sec, and ISO at 80. The image was taken with 1600 x 1200 pixels, and then resized without further modification of the image.

29 2.5.2 GUS activity assay

β-Glucuronidase (GUS) was detected by a histochemical assay using 5-bromo-4-chloro-3-indolyl glucuronide (X-Gluc) for qualitative assay (Jefferson et al., 1987). Fresh roots were washed several times with 50 mM NaH2PO4 (pH 7.0) to clean up culture medium, then transferred to 24 well plates. The 1 mM indigogenic substrate X-Gluc in 50 mM NaH2PO4 (pH 7.0) was added and incubate at 37°C overnight. After staining, roots were rinsed in 70% ethanol for 5 min, then roots were examined both bare eyes and under microscopy.

2.6 Protein quantification

2.6.1 Extraction of cytosol protein

Fresh roots were grounded into powder in liquid nitrogen, and 50 mg was taken for extraction of total intracellular protein by a homogenizer with 500 μL protein extraction buffer. After centrifugation at 12000x g for 10 min at 4°C, supernatant was collected, and then total intracellular protein extract was stored at -30°C.

30 2.6.2 Quantification of total protein

The total protein content was measured with Bradford’s reagent (Bio-Rad Laboratories Inc., Hercules, CA, USA) with bovine serum albumin (BSA) as the standard.

2.6.3 Western blotting for detection of GFP

2.6.3.1 Gel electrophoresis

Protein extract was mixed with 2X loading buffer for SDS-PAGE analysis. After the sample was boiled at 95°C for 10 min, it was loaded into the well of SDS-PAGE (resolving gel: 15.0%, stacking gel: 5.0%). The electrophoresis was performed in 150 V for 1 hour. For western blot analysis, the prestained molecular weight marker was utilized in SDS-PAGE in order to evaluate the efficiency of protein transfer.

2.6.3.2 Protein transfer

After electrophoresis, the gel was taken for protein transfer. It was transferred to Amersham Hybond polyvinylidene difluoride (PVDF) membrane (GE Healthcare Bio-Sciences Corp., Piscataway, NJ, USA) membrane in 80 V for 1 h by PowerPac HC Power Supply (Bio-Rad Laboratories Inc., Hercules, CA, USA). The presence of prestained molecular marker ensured that the protein transfer was successful.

31 2.6.3.3 Immunoblotting

The membrane was blocked at room temperature for 1 h by blocking reagent buffer.

Anti-penta His HRP conjugate was added on the membrane, incubated at room temperature for 1 h. The membrane was then washed with TBS-T buffer twice and TBS buffer once. Chemifluorescence reagent was used at a ratio of 1:1 for the chemilumogenic substrate and oxidizing reagent, and then analyzed by AutoChemi BioImaging System (UVP LLC, Upland, CA, USA).

32

33

Chapter 3

Results

34

3.1 A. rhizogenes transformation

The transformation efficiency for transforming pCAMBIA 1201 into wild type A.

rhizogenes (harboring only Ri plasmid) was 5.5 x 105, and 8.25 x 105 for transforming pCAMBIA 1302 (Table 3). The transformation efficiency was 8.5 x 102 for transforming pCAMBIA 1201 into A. rhizogenes 1302 (harboring Ri plasmid and pCAMBIA 1302), and 1.05 x 103 for pCAMBIA 1302 into A. rhizogenes 1201 (harboring Ri plasmid and pCAMBIA 1201). The efficiency for transforming two binary vectors, pCAMBIA 1201 and pCAMBIA 1302, simultaneously into wild-type A.

rhizogenes was 2.75 x 102.

3.2 Selection of soybean materials

Among the six soybean genotypes tested, after 7 days of germination, soybean Tainan

#2 and Tainan #7 showed the highest germination rate of 96.5% and 90.2%, average plant height of 3.05 cm and 4.35 cm, respectively (Figure 8

(Utilization factor = total usable tissue fragments per seed planted)

Figure 8 (B)). Because of the need of cutting soybean plant into segments for Agrobacterium infection, the higher the plant is, the more usable materials are. We

created a “utilization factor” here combining soybean germination rate and plant height,

35

which was calculated by dividing total usable fragments by total planted soybeans, resulting 2.62 and 2.64 for soybean Tainan #2 and Tainan #7.

Although soybean Tainan #7 showed slightly better results on calculation, but its plant shoot was much thinner than that of Tainan #2, considering this fact soybean Tainan #2 was the most suitable soybean material for fast and efficient obtaining materials for further studies.

3.3 Establishment and selection of transgenic root clones

After A. rhizogenes were applied to the wounded soybean tissues, roots were induced from tissue wound sites. The wild-type A. rhizogenes-mediated soybean Tainan

#2 root induction rate was 48.0% on cotyledons and 15.4% on the lower-shoots (Table

4). Root induction rate of A. rhizogenes 2BV (harboring pCAMBIA 1201 and 1302) was 39.6% and 14.8% on cotyledons and lower-shoots, respectively. Root induction rate raised to 68.2% and 32.6% on cotyledons and lower-shoots respectively when infecting simultaneously with A. rhizogenes 1201 and A. rhizogenes 1302. The results above were calculated each with over 50 cotyledons and shoot segments in each construction. Most

A. rhizogenes infected tissues induced more than one root. The fast elongating, branched

roots were considered candidates for transgenic hairy roots (Table 4), these roots were removed from the soybean tissue and placed on plates with cefotaxime.

36

After detached from the original soybean tissues, several root clones didn’t’

propagate anymore after two rounds of A. rhizogenes sterilization. Thirty candidate root clones were picked from each group according to the growth on solid 1/2 MS plate, transferred to liquid 1/2 MS medium containing antibiotic for mass cultivation.

3.4 Liquid cultures of transgenic root clones

Root clones induce by wild-type A. rhizogenes showed very poor growth after 21

Root clones induce by wild-type A. rhizogenes showed very poor growth after 21

相關文件