Evolutionary Effects of Novel Chimeric Gene Clusters

The chimeric gene clusters of Sciadopitys provide two novel insights into the evolution of plastomes. First, other than the gene cluster rpoB_–

rpoC1

_–

rps18, the

remaining three chimeric gene clusters do not alter their upstream regions, as the neighboring genes of their 5’ regions are the same as those of Cycas (Figure 18A & B).

This finding suggests that the promoter sequences of these gene clusters have not been altered after the associated inversions taken place. Figure 18D shows that the upstream sequence of rpoB harbors a YRTA motif of the nuclear-encoded RNA polymerase (NEP) promoters (Shiina et al. 2005). Furthermore, genes of different origins are able to be co-transcribed in the chimeric gene cluster (Fig. 18C). Therefore, we cannot rule out the possibility that the pre-existing promoters are adopted for transcription of the genes in these chimeric gene clusters.

Second, shuffling between rpoB and petL operons (Figure 18B) has relocated

rpoC2 to join the segment of the 5’petL operon whose transcription are associated with

the plastid RNA polymerases (PEP) promoter (Finster et al., 2013). RpoC2 codes for one of the core units of PEP (Hu and Bogorad, 1990). If the chimeric gene cluster petL–

petG

_–

psaJ

_–

rpl33

_–

rpoC2 is exclusively transcribed by PEP, we would not expect any

transcript of this gene cluster in Sciadopitys. Nonetheless, its associated transcript was observed in Figure 18C. Two possibilities might account for the presence of this transcript. First, the isomeric plastome of the B form (Figure 16) that contains an intact

rpoB operon provides RPOC2 proteins. Second, an alternative promoter has evolved to

perform transcription because many plastid genes are transcribed by both the NEP and PEP promoters (Börner et al., 2015). Third, this transcript may correspond to a read-through transcript which allows the expressions of downstream of 3’ untranslated regions (Quesada-Vargas et al., 2005).

Notably, functionally unrelated genes have been joined together in these chimeric gene clusters. For example, the four photosynthetic genes (psbT, psbH, petB, and petD) of the psbB operon have been relocated and joined with the segment of the 5’rps2 operon whose promoter is of the NEP type (Kapoor and Sugiura, 1999). This suggests that the four photosynthetic genes are not transcribed by PEP, in disagreement with a partition of labor in which PEP transcribes genes associated with photosynthesis and NEP transcribes housekeeping genes (Hajdukiewicz et al., 1997). In contrast, this finding agrees with Liere and Börner (2007) that most of plastid genes can be transcribed by either NEP or PEP.

CHAPTER 4 Conclusions

Plastomes of cupressophytes are highly variable in their size, genome organization, and gene content. These features provide a unique opportunity to study their evolution.

In this study, we sequenced three complete plastomes, A. formosana, T. mairei, and S.

verticillata. By comparing the three newly sequenced plastomes with published

cupressophyte plastomes, we are able to obtain new insights into the plastomic evolution of cupressophytes.

We have shown that plastomic rearrangement events provide useful information for amplifying nupts in Chapter 2. Because it is difficult to avoid the amplification of isomeric plastomic or mitochondrial DNA, examining the origins of PCR amplicons was a prerequisite in this proposed PCR-based study. In angiosperms such as Nicotiana,

nupts were experimentally demonstrated to be eliminated quickly from the nuclear

genome (Sheppard and Timmis, 2009). However, we show that the oldest conifer nupt has been retained for at least 70.8 MY (i.e., since the late Cretaceous period). With an increase of available plastomes in conifers, comparative genomic analyses are expected to reveal more plastomic rearrangements. Using our approach, we are beginning to understand the evolution of nupts in diverse conifer species without the need to sequence and assemble their huge nuclear genomes.

In Chapter 3, we have shown that plastomic rearrangement events in Sciadopitys provide a unique opportunity to understand the evolutionary impact of plastomic rearrangements. The plastome of Sciadopitys is characterized by several unusual features, such as the loss of the typical IRA copy, the duplication and pseudogenization

of four tRNAs, extensive genomic inversions, the presence of isomeric plastomes, and chimeric gene clusters derived from shuffling of remote operons. All these characteristics highlight the fact that the evolution of plastomes may be more complex than previously thought. The highly rearranged plastome of Scidaopitys advances our understanding of the dynamics, complexity, and evolution of plastomes in conifers.

CHAPTER 5 Future Prospectives

In the first project, we proposed a PCR-based strategy to identify nupts. Although DNA transfer from plastomes to the nuclear genome is highly frequent, it is very rare to observe a functional organelle gene in the nuclear genome (Lloyd and Timmis, 2011).

Most nupts are quickly deleted, decays, or alternatively scrapped during the plant evolution (Lloyd and Timmis, 2011). A nupt must acquire additional genetic elements if it is functional and can be retained in its new environment. The functional nupts should include at least three features. First, their DNA sequences should contain an intact open reading frame and could be transcribed correctly. Second, they should acquire a specific nuclear promoter and this promoter can regulate the nupt transcription during the plant development. Third, they should obtain a transit peptide of plastome-target to import plastome-specific proteins back to plastomes. It would be of interest to study if these newly identified nupts in gymnosperms have developed any novel functions.

Our study presented new insights into the plastome arrangements and intracellular gene transfer in non-model systems. After the completion of Sciadopitys plastome, at least one representative species for each gymnosperm families have been published.

These plastomes provide an opportunity to systematically examine the plastid DNA evolution and to model plastomic orientation changes in gymnosperms. With the advent of new sequencing and bioinformatic technologies, such large scale systematic plastomic studies would be possible in near future, enabling a new era of the comparative genomics of organellar evolution.

FIGURES

Figure 1

The phylogenetic tree of endosymbiotic evolution. (Image adapted from Timmis et al., 2004)

Figure 2

Fate of cyanobacterial genes and the intracellular targeting of their products in the flowering plant Arabidopsis thaliana. (Image adapted from Kleine et al., 2009)

Figure 3

A schematic explanation for the amplification of ancestral plastomic DNAs transferred from plastids to the nucleus. Top left: an ancestral plastomic fragment that includes F1 and F2 sub-fragments with a head-to-tail arrangement was transferred to the nucleus (top right) in the past. After this transfer, an inversion of F2 occurred, which resulted in a head-to-head arrangement of F1 and F2 in the extant plastome. Primers based on distinctive arrangements between ancestral and extant plastomes can facilitate specific amplification of transferred ancestral plastomic fragments and avoid contaminants from amplification of the extant plastome.

Figure 4

Hypothetical evolutionary scenarios for plastomic rearrangements in Taxaceae.

Plastomes are circular but here are shown in grey horizontal bars (beginning at psbA) for pairwise comparisons. Color triangles within the grey horizontal bars denote locally collinear blocks with their relative orientations. Grey bars from top to bottom indicate the corresponding plastomes in the common ancestor of Taxaceae, intermediate ancestors, and extant representative species. Inversions between two plastomes are linked by orange curved lines. Ancestral gene orders before the occurrence of specific inversions are shown along tree branches. Primer pairs (black arrows) for amplification of the corresponding ancestral fragments are labeled: Tax-1 to 4 for Taxus mairei, Ame-1 to 2 for Amentotaxus formosana, and Cep-1 to 5 for Cephalotaxus wilsoniana (see Table S1 for primer sequences).

Figure 5

An alignment revealing two premature stop codons in the chlB sequence of Cep-2. The aligned position marked with a grey triangle indicates a point mutation in Cep-2, which results in a stop codon and cannot be replaced by RNA-editing. Positions of aligned sites are labeled with numbers. The translated amino acid for each codon of Cep-2 sequence is indicated.

Figure 6

A dot-plot comparison of the plastomes of Amentotaxus formosana and Taxus mairei.

Three relocations are revealed with their flanking genes. Transfer RNA genes,

trnQ-UUG, inside the trnQ-IRs are highlighted in red circles.

Figure 7

A neighbor-joining tree inferred from a whole-plastome alignment showing the relative relationship between T. mairei in this study and the other three published ones. A.

formosana was used as the outgroup. Support values estimated from 1,000

bootstrapping analyses are indicated.

Figure 8

Stacked histogram for single-nucleotide polymorphisms (SNPs), indels, and indel lengths of the T. mairei plastome (AP014575) showing their relative proportions in coding, intronic, and intergenic regions.

Figure 9

Distribution of single-nucleotide polymorphisms (SNPs), indels, and simple sequence repeats (SSRs) in the plastomes of Taxus mairei. The outermost circle is the plastome map of T. mairei (AP014575) with genes that are transcribed counter-clockwise (outer boxes) and clockwise (inner boxes), respectively. The immediately next circle denotes a scale of 5-kb units beginning at psbA gene (the 3 o’clock position). In the grey zone, three histograms from outer to inner are 1) counts of SNPs, 2) counts of indels, and 3) total indel lengths within non-overlapping 200-bp bins across the entire plastome.

Triangles mark locations of SSRs.

Figure 10

An unrooted tree inferred from the locally collinear block matrix generated from comparative plastomes among three Taxaceae and four Cupressaceae species. Values along branches denote numbers of rearrangements required for specific taxa or clades.

Figure 11

Origin of the obtained PCR amplicons examined by maximum-likelihood phylogenetic analyses. PCR amplicons are labeled “PCR”, and their plastomic counterparts and orthologs of other gymnosperms are labeled “pt”. Taxa of the same conifer family are in the same color. Cycas and Ginkgo together are the outgroup. Bootstrapping values assessed with 1,000 replicates are shown along branches.

Figure 12

Alignment of seven rps8 sequences. The left orange arrow highlights a specific C-to-U RNA-editing site at the second codon position of the initial codon in the four sampled T.

mairei plastomes. A normal initial codon, ATG (black rectangle), was common among Cephalotaxus, Amentotaxus, and Tax-4. These data imply the creation of the “ACT”

RNA-editing site after the transfer of Tax-4. The red rectangle denotes the initial codon annotated in the sequences from NCBI GenBank.

Figure 13

Percentage of nucleotide mutation classes in nupts and their plastomic counterparts.

Types of mutations are divided into six classes. For example, the class AT-to-GC

denotes the pooled percentage of the A-to-G mutations and its complement T-to-C. Data are mean ± SD.

Figure 14

Plastome map of Sciadopitys verticillata. Colored boxes represent genes with

counterclockwise (outer boxes) and clockwise (inner boxes) transcriptional directions.

Syntenic blocks of genes between Cycas and Sciadopitys are depicted by thick black bars with Arabic numerals, where pluses or minuses indicate the corresponding syntenic blocks with the same or opposite directions between the two species, respectively. Pairs of dispersed repeats are connected by blue (direct repeats) or red (inverted repeats) lines, with their width proportional to the repeat size. Pseudogenes are bold and marked with a

“Ψ.” Intron-containing genes are indicated with an “*.”

Figure 15

Comparison between the two copies of trnI-CAU genes in the Sciadopitys plastome. (A) Predicted cloverleaf structure of trnI-CAU located between ycf2 and rpl23 and (B) that of the other gene located between trnC-GCA and psbA. Pairwise substitutions of nucleotides between the two copies are highlighted in gray.

Figure 16

Co-existence of two isomeric plastomes in Sciadopitys. The A form is the plastome map obtained from our genome assembly and is shown in Figure 14. The B form differs from the A form by an inversion of the rpoC2-rps18 (or rpl33-rpoC1) fragment. Light green areas are the 370-bp IRs involved in homologous recombination that allows for

conversion between the two forms. Paired open arrows are primers specific for the PCR amplification of each form. The corresponding PCR amplicons are shown, and the numbers above each lane of gel photos denote the PCR cycles conducted.

Figure 17

Postulated scenarios for the plastomic inversions in Sciadopitys. The plastome of Cycas with IRA moved (designated as Cycas without IRA) was used in comparison. Eight plastomic inversions that distinguish Sciadopitys from Cycas are revealed. Gray bars labeled with Arabic numerals represent syntenic blocks of genes between the two species. Syntenic blocks are not drawn to scale.

Figure 18

Birth of chimeric gene clustres in the Sciadopitys plastome. (A) Shuffling between rps2 and psbB operons and (B) between rpoB and petL operons. Syntenic genes in the corresponding operons of Cycas are used as references. Operons and their

transcriptional directions are indicated by solid arrows. Syntenic blocks of genes are connected with gray lines. Paired open arrows are primers for amplifying cDNA fragments across junctions between two recombined operons. The expected sizes of amplicons are shown in parentheses. (C) RT-PCR analysis for detecting the transcripts

assays are shown above the gel panel, with minus and plus signs (in parentheses) denoting the use of RNA (negative control) and cDNA (experimental set) as templates, respectively. (D) YRTA motif of the NEP promoter upstream of rpoB.

TABLES

Table 1

Plastid and mitochondria RNA polymerases in higher plants^a. (Table adapted from Shiina et al., 2005)

a Original names for RpoT genes in Hedtke et al. (1997, 2000) are shown in parentheses

Table 2

PCR primers used in the nupt study

Primer name Primer sequence (5’--->3’)

Ame-1 & Cep-1 15F2 CAGTRGAAGAACAAATAGCTAYKATTTATRC

4R1 GAATAGCTTCCGTTGAGTCTCTGC

Ame-2 &Cep-2 1F2 TRGCYGCRTACATTACTTCRAYAGTAAT

2R2 TTGTCATTTYTYTGAGATCTAGGCAT

Cep-3 -16F3 GCTAAGGCTCATGGRGGBG

-5R2 TGAAYAGCRTCGGKTAAACCTG

Cep-4 14F2 CGAACCAAAATYTCYGGATGART

1R2 GGTTACGARGGTACKAATCAAATAGC

Cep-5 20F1 GCATGAGCCATTCCMGTRATRG

13R1 ATGACYGCAATTYTAGAAAGACGC

Cep-6 13F1 TTACGYTCGTGCATMACTTCCA

14R2 AYTCATCCRGARATTTTGGTTCG

Tax-1 3F2 ATGGAAGTAAATAHYCTYGCATTTMTTG

15R2 TSTCCVACTCTTTYYCCATTAGGTA

Tax-2 2F1 TTAAAGAGCGTTTCCACGGG

3R3 ATGGATATAGTYRDTATYGCTTGGGC

Tax-3 -5F3 GGTGGAGTSACTGCTAGTTTYGG

-17R4 CYRTTAAACRAGCTCGTATTCTMTSTT

Tax-4 Rpl14F2 GGAACYCGRGTTTTTGGTTC

Rps11R1 GAGGTCTACATCCRTTATGYGG

Table 3

Characteristics of obtained PCR amplicons in the nupt study

ID¹ Taxon Accession Length (bp) Potential coding sequence Ame-2 A. formosana AB936749 3,965 partial chlB, rps4, trnQ-UUG,

trnG-UGU, trnS-GGA

Cep-2 C. wilsoniana AB936745 3,796 partial chlB² rps4,trnQ-UUG, trnS-GGA

Cep-5 C. wilsoniana AB936746 3,788 partial psbA, chlL, partial chlN,trnI-CAU, trnH-GUG

Cep-6 C. wilsoniana AB936747 2,717 partial psbA, partial matK, exon 2 of trnK-UUU

Tax-4 T. mairei AB936748 2,298 partial rps11, rps36, infA, rps8, partial rpl14

1 ID refers to the corresponding primer pairs in Figure 4.

2 Reading framewith premature stop codons.

Table 4

Mutations in nupts and their plastomic counterparts

Nupt

Identity¹

(%)

Length² (bp)

No. of mutations

Total Potential protein-coding gene

N S

Cep-2 99.08 2,961 29 (1)

chlB

19 (0) 7 (1)

rps4

0 (0) 2 (0)

Cep-5 88.15 3,380 117 (75)

psbA

2 (4) 16 (10)

chlL

3 (4) 24 (17)

chlN

12 (15) 38 (42)

Cep-6 89.84 2,207 100 (67)

psbA

0 (2) 14 (12)

matK

45 (37) 29 (10)

Tax-4 61.71 1,466 42 (135)

rpl14

2 (2) 0 (3)

rps8

5 (9) 3 (12)

infA

4 (26) 1 (22)

rpl36

0 (1) 1 (1)

rps11

13 (10) 14 (9)

1 Refers to sequence identity between nupts and their plastomic counterparts. Gaps were included in calculating identity.

2 Refers to lengths of unambiguous alignments where gaps and ambiguous sites were excluded. These alignments were used for calculating mutations.

Note: numbers in parentheses indicate mutations in corresponding plastomic sequences;

N, nonsynonymous; S, synonymous.

Table 5.

Primers used in Sciadopitys project

Primer name Primer sequence (5’--->3’)

rpoC2 TCATTCCAAATTGATTTATAAATCTGGTA

rpl33 ACAAACATACCATTCACGGAGAAATA

rpoC1 AAAATAATATTGTTTCCTATAATAAACCTTCG

rps18 TTGGTCGCGGACGTTTACG

psbB-2 TAGTCCGAGGGGTTGGTTTACTT

atpA-2 ACTAATTCCCCTGCCATTACTTGAT

psbT TTTTCTCCTCTATCCGGAACTTTG

atpF-1 AGAATTCAAAGAATGAGACCATTCACT

SpsbN ATATCTCGTTTACTTGTAAGCTTTACTGGTT

SatpA TTTTCTCGAAGTAGGAAAAGTTCGATAT

SrpoC2 CTATTTTTTTACTTGTCGTTTCAAATTTG

Table 6.

Genes predicted in the plastome of Sciadopitys

Functional category Gene¹

Photosynthesis-related

Photosystem I & II

psaA, psaB, psaC, psaI, psaJ, psaM, psbA, psbB, psbC, psbD, psbE, psbF, psbH, psbI, psbJ, psbK, psbL, psbM, psbN, psbT, psbZ

ATPase

atpA, atpB, atpE, *atpF, atpH, atpI

Cytochrome b6/f complex

petA, *petB, *petD, petG, petL, petN,

NADH dehydrogenase

*ndhA, *ndhB, ndhC, ndhD, ndhE, ndhF,

ndhG, ndhH, ndhI, ndhJ, ndhK

RuBisCO synthesis

rbcL

Gene expression

Ribosomal protein

*rpl2, rpl14, *rpl16, rpl20, rpl22, rpl23, rpl32, rpl33, rpl36, rps2, rps3, rps4, rps7, rps8, rps11, 5’rps12, *3’rps12, rps14, rps15, *rps16, rps18, rps19

RNA polymerase

rpoA, rpoB, rpoC1, rpoC2

RNA structural gene

Ribosomal RNA

rrn4.5, rrn5×2, rrn16, rrn23

Transfer RNA

*trnA-UAC, trnC-GCA, trnD-GUC,

trnE-UUC, trnF-GAA, trnfM-CAU, trnG-GCC, *trnG-UCC, trnH-GUG, trnI-CAU×2, *trnI-GAU, *trnK-UUU, trnL-CAA, *trnL-UAA, trnL-UAG, trnM-CAU, trnN-GUU, trnP-UGG, trnQ-UUG×2, trnR-ACG, trnR-CCG, trnR-UCU, trnS-GCU, trnS-GGA, trnS-UGA, trnT-GGU, trnT-UGU, trnV-GAC, *trnV-UAC, trnW-CCA, trnY-GUA

Other

ccsA, cemA, chlB, chlL, chlN, clpP, infA,

matK, ycf1, ycf2, *ycf3, ycf4

Pseudogene

ΨrpoC1, ΨtrnV-GAC, ΨtrnP-GGG×2,

ΨtrnQ-UUG

1 ”*”: intron-containing genes; “×2”: two copies

Table 7.

Presence of trnI-CAU copies in the plastomes of cupressophytes

Family Species (GenBank Accession) Copy¹ Seq. identity Score Cupressaceae

Calocedrus formosana

(NC_023121)

Taxaceae

Taxus mairei

(AP014575)

Cephalotaxaceae

Cephalotaxus wilsoniana

(NC_016063)

(+)trnI-CAU

- 77.31

- Sciadopityaceae

Sciadopitys verticillata

(AP017299)

(+)trnI-CAU

86.30% 48.48

(+)trnI-CAU 78.15

Podocarpaceae

Nageia nagi

(NC_023120) Araucariaceae

Agathis dammara

(NC_023119)

1 “+” and “-“ in parentheses denote the transcriptional directions

REFERENCS

Alkatib S, Fleischmann TT, Scharff LB, Bock R. 2012. Evolutionary constraints on the plastid tRNA set decoding methionine and isoleucine. Nucleic Acids Research 40:6713–6724.

Allen JF. 2003. Why chloroplasts and mitochondria contain genomes. Comparative and Functional Genomics 4:31–36.

Allison LA. 2000. The role of sigma factors in plastid transcription. Biochimie 82:537–

548.

Allison LA, Simon LD, Maliga P. 1996. Deletion of rpoB reveals a second distinct transcription system in plastids of higher plants. The EMBO Journal 15:2802–2809.

Archibald, JM. 2009. The puzzle of plastid evolution. Current Biology: CB. 19:R81–88.

Baba K, Schmidt J, Espinosa-Ruiz A, Villarejo A, Shiina T, Gardeström P, Sane AP, Bhalerao RP. (2004). Organellar gene transcription and early seedling development are affected in the rpoT; 2 mutant of Arabidopsis. The Plant Journal 38:38–48.

Barkan A. 1988. Proteins encoded by a complex chloroplast transcription unit are each translated from both monocistronic and polycistronic mRNAs. The EMBO Journal 7:2637–2644.

Bergthorsson U, Adams KL, Thomason B, Palmer JD. 2003. Widespread horizontal transfer of mitochondrial genes in flowering plants. Nature 424:197–201.

Birky CW. 1995. Uniparental inheritance of mitochondrial and chloroplast genes:

mechanisms and evolution. Proceedings of the National Academy of Sciences 92:11331–11338.

Blazier JC, Guisinger MM, Jansen RK. 2011. Recent loss of plastid-encoded ndh genes within Erodium (Geraniaceae). Plant Molecular Biology 76:263–272.

Bligny M, et al. 2000. Regulation of plastid rDNA transcription by interaction of CDF2 with two different RNA polymerases. The EMBO Journal 19:1851–1860.

Bourque G, Pevzner PA. 2002. Genome-scale evolution: reconstructing gene orders in the ancestral species. Genome Research 12:26–36.

Börner T, Aleynikova AY, Zubo YO, Kusnetsov VV. 2015. Chloroplast RNA

polymerases: role in chloroplast biogenesis. Biochim Biophys Acta. 1847:761–769.

Bryant, DA, Frigaard, NU. 2006. Prokaryotic photosynthesis and phototrophy illuminated. Trends in Microbiology 14:488–496.

Buschiazzo E, Ritland C, Bohlmann J, Ritland K. 2012. Slow but not low: genomic comparisons reveal slower evolutionary rate and higher dN/dS in conifers compared to angiosperms. BMC Evolionary Biology 12:8.

Cai Z, et al. 2008. Extensive reorganization of the plastid genome of Trifolium

subterraneum (Fabaceae) is associated with numerous repeated sequences and novel

DNA insertions. Journal of Molecular Evolution 67:696–704.

Chaw SM, Parkinson CL, Cheng Y, Vincent TM, Palmer JD. 2000. Seed plant

phylogeny inferred from all three plant genomes: monophyly of extant gymnosperms and origin of Gnetales from conifers. Proceedings of the National Academy of Sciences 97:4086–4091.

Chaw SM, Chang CC, Chen HL, Li WH. 2004. Dating the monocot-dicot divergence and the origin of core eudicots using whole chloroplast genomes. Journal of Molecular Evolution 58:1–18.

Cheng Y, Nicolson RG, Tripp K, Chaw SM. 2000. Phylogeny of Taxaceae and

Cephalotaxaceae genera inferred from chloroplast matK gene and nuclear rDNA ITS region. Molecular Phylogenetics and Evolution 14:353–365.

Conway S. 2013. Beyond pine cones: an introduction to gymnosperms. Arnoldia 70/4.

Corriveau JL, Coleman AW. 1988. Rapid screening method to detect potential biparental inheritance of plastid DNA and results for over 200 angiosperm species. American Journal of Botany 1443–1458.

Cosner ME. 1993. Phylogenetic and molecular evolutionary studies of chloroplast DNA

variation in the Campanulaceae. PhD thesis, The Ohio State University, Columbus.

Cosner ME, Raubeson LA, Jansen RK. 2004. Chloroplast DNA rearrangements in Campanulaceae: phylogenetic utility of highly rearranged genomes. BMC Evolutionary Biology 4:27.

Crisp MD, Cook LG. 2011. Cenozoic extinctions account for the low diversity of extant gymnosperms compared with angiosperms. New Phytologist 192:997–1009.

Cui L, Leebens-Mack J, Wang LS, Tang J, Rymarquis L, Stern DB. 2006. Adaptive evolution of chloroplast genome structure inferred using a parametric bootstrap approach. BMC Evolutionary Biology 6:13.

Darling AC, Mau B, Blattner FR, Perna NT. 2004. Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Research 14:1394–403.

Darling AE, Mau B, Perna NT. 2010. progressiveMauve: multiple genome alignment with gene gain, loss and rearrangement. PLoS One 5:e11147.

de Laubenfels, David J. 1988. Coniferales. Flora Malesiana, Series I, Dordrecht: Kluwer Academic 10:337–453.

de Vries J, Stanton A, Archibald JM, Gould SB. 2016. Streptophyte terrestrialization in light of plastid evolution. Trends in Plant Science 21:467–476.

Deusch O, Landan G, Roettger M, et al. 2008. Genes of cyanobacterial origin in plant nuclear genomes point to a heterocyst-forming plastid ancestor. Molecular Biology and Evolution 25:748–761.

Downie SR, Palmer JD. 1992. Use of chloroplast DNA rearrangements in

reconstructing plant phylogeny. In Molecular systematics of plants. Springer US.

14–35.

Doyle JJ, Doyle JL, Palmer JD. 1995. Multiple independent losses of two genes and one intron from legume chloroplast genomes. Systematic Botany 272–294.

Doyle JJ, Doyle JL, Ballenger JA, Palmer JD. 1996. The distribution and phylogenetic significance of a 50-kb chloroplast DNA inversion in the flowering plant family Leguminosae. Molecular Phylogenetics and Evolution 5:429–438.

Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high

throughput. Nucleic Acids Research 32:1792–1797.

Finster S, Eggert E, Zoschke R, Weihe A, Schmitz-Linneweber C. 2013.

Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA. The Plant Journal 76:849–860.

Frazer KA, Pachter L, Poliakov A, Rubin EM, Dubchak I. 2004. VISTA: computational tools for comparative genomics. Nucleic Acids Research 32:W273–279

Gantt JS, Baldauf SL, Calie PJ, Weeden NF, Palmer JD. 1991. Transfer of rpl22 to the nucleus greatly preceded its loss from the chloroplast and involved the gain of an intron. The EMBO Journal 10:3073–3078.

Graur D, Li WH. 2000. Fundamentals of Molecular Evolution. Sinauer Associates, Sunderland, MA.

Gray MW, Lang BF. 1998. Transcription in chloroplasts and mitochondria: a tale of two polymerases. Trends Microbiol 6:1–3

Guisinger MM, Kuehl JV, Boore JL, Jansen RK. 2008. Genome-wide analyses of Geraniaceae plastid DNA reveal unprecedented patterns of increased nucleotide substitutions. Proceedings of the National Academy of Sciences 105:18424–18429.

Guisinger MM, Kuehl JV, Boore JL, Jansen RK. 2011. Extreme reconfiguration of plastid genomes in the angiosperm family Geraniaceae: rearrangements, repeats, and codon usage. Molecular Biology and Evolution 28:583–600.

Guo W, et al. 2014. Predominant and substoichiometric isomers of the plastid genome coexist within Juniperus plants and have shifted multiple times during cupressophyte

Guo W, et al. 2014. Predominant and substoichiometric isomers of the plastid genome coexist within Juniperus plants and have shifted multiple times during cupressophyte

在文檔中 紅豆杉科與傘松科植物色質體基因組分析:洞悉其核質 體DNA 與重組基因群 (頁 51-0)