2-1. RT-PCR demonstrated the expression of rmpA in K. pneumoniae CG43.
In previous study, the rmpA2 were transcribed in K. pneumoniae CG43, but we didn’t identity the present of rmpA gene. After pLVPK sequencing, we confirmed the existence of rmpA and rmpA2 genes. To demonstrate expression of the rmpA encoding gene in K. pneumoniae CG43 and the derived rmpA2-, total RNA were isolated and subject to RT-PCR and Southern blotting hybridization. As shown in Fig.
8 the rmpA transcript could be detected in both the K. pneumoniae CG43 and rmpA2-, including an active expression of the rmpA gene.
2-2. Biological role of RmpA.
To investigate the function of RmpA, the rmpA deletion mutant was constructed by the allelic exchange and the deletion confirmed by using Southern blotting hybridization. The deleted DNA fragments included about 527 bp in rmpA. As shown in Fig. 9, 800 bp and 1327 bp signals were obtained respectively in the rmpA- and K.
penumoniae CG43S3. The 4083 bp signals in the rmpA- and K. penumoniae CG43S3 were the fragments including the rmpA2 gene. Both rmpA- and rmpA2- strain displayed similar colony in size with the K. pneumoniae CG43S3. In addition, the growth rate of rmpA- and rmpA-rmpA2- appear to grow faster than both wild type and rmpA2- in LB medium, but not in M9 medium (Fig. 10A). Mucoidy of rmpA- and rmpA2- were significantly reduced as assessed using low-speed centrifugation.
Introducing the plasmid carrying either rmpA or rmpA2 into the mutants appeared to compensate for the deficiency (Fig. 10B).
The amount of CPS produced in wild type and mutant strains were further quantified by measuring the uronic acid content, which serves as an indicator of
Klebsiella K2 CPS. As shown in Fig. 10C, the rmpA-, as well as the rmpA2-, produced much less CPS than wild type strain and the deficiency could be restored by the complements. In previous studies, expression of CPS has been correlated with the regulation of biofilm formation. As shown in Fig. 11, capability of biofilm formation in rmpA- and rmpA2- like that in rcsB- were increased. Transformation of the plasmid carrying rmpA or rmpA2 into the mutants appeared to be able restore the capability of biofilm formation. These results suggested that RmpA as well as RmpA2 could positively regulate the CPS biosynthesis.
2-3. RmpA regulates positively the expression of cpsorf1-2 and cpsorf16-17.
The reducing production of CPS by deletion of rmpA or rmpA2 suggested a regulatory role on cps genes expression, while the three lacZ reporter fusion constructs (Fig. 12A), Porf1-2, Porf3-15, and Porf16-17, were analyzed in the rmpA-. Activity of Porf1-2 and Porf16-17 appeared to decrease 30 % in comparing with wild type bacteria, but in rmpA2- was only reduced 20 %. Compared the activity of Porf3-15 in wild type with either rmpA- or rmpA2- strain, no obvious change of Porf3-15 activity in rmpA- or rmpA2- strains was noted (Fig. 12B).
2-4. Expression of rmpA and rmpA2 in K. pneumoniae CG43.
To analysis the expression of rmpA and rmpA2, the putative promoters of rmpA and rmpA2 were isolated and respectively fusion with the promoterless lacZ in pLacZ15, and be transformed into K. pneumoniae LacZ16. As shown in Fig. 13, activity of PrmpA2 appeared to be much higher than PrmpA. As shown in Fig. 14, 49.2%
identity in nucleotide sequence lower than that of coding region. Analysis the putative promoters of rmpA and rmpA2 showed Fur binding box and RcsAB binding box on PrmpA. Alignment of the putative RcsA-RcsB binding site with 40-bp region of the
Erwinia amylovora ams (amylovoran biosynthesis), E. coli cps (16), and the rmpA promoter using VectorNTI (Invitrogen Vector NTI™ Advance) identified a 28 bp region of RcsAB box. To examine whether RcsAB affect rmpA expression, PrmpA
activity was analyzed in either rcsA- or rcsB-. As shown in Fig. 15, rcsB deletion appeared to reduced PrmpA activity to half of the wild type strain. Interestingly, the deletion of rcsB conferred no effect on the activity of PrmpA2. But no obvious change of PrmpA and PrmpA2 in rcsA- was noted. This indicated a differential regulation of the expression at rmpA and rmpA2.
Discussion
Most of the work on pathogenesis of K. pneumoniae has been limited to studying the polysaccharidic capsule, which protect against serum bactericidal activity and phagocytosis. Recently, many reports indicated the large plasmid is associated with virulence. In our study, many K. pneumoniae clinical isolates were also shown to be carried large plasmids. Furthermore, all liver abscess isolates (19 strains) and some other isolates (39 strains) could carry the pLVPK-like plasmid.
In Southern blotting analysis, the large plasmid in many liver abscess isolates carried rmpA gene could be detected except those of K. pneumoniae TVH 5, TVH 13, and TVH 19. However, the discrepancy, which is not consistent with the finding of the PCR detection (Fig. 3), is likely due to the concentration of the plasmids was too low to be detected. But the rmpA gene could be detected on both chromosome and the large plasmid of K. pneumoniae TVH10 and TVH16. To analyze sequence around the rmpA gene on pLVPK showed many insertion sequences (IS) around the rmpA gene suggesting rmpA gene could be located on a pathgenocity island by horizontal transfer to chromosome, such as SHI-2 island (23). The possibility is being investigated.
All liver abscess isolates carried the pLVPK-like plasmid suggesting the plasmids on those isolates have similar ability with pLVPK. In CAS assay, many liver abscess isolates could synthesis siderophore, except K. pneumoniae TVH13 and TVH15, indicating that siderophore synthesis pathway in some of the pLVPK carrying isolates may be deficient. In sedimentation test, all the liver abscess isolates containing pLVPK-like plasmid displayed more mucoid than the plasmidless isolates K. pneumoniae TVH33, and TVH34, suggesting the large plasmid is associated with the mucoid phenotype. Biofilm formation capability of isolates appeared to be
variable, which revealed that, in addition to the virulent plasmid, other factors encoding by the genes reside in bacterial chromosome also play roles in regulation of the biofilm formation, such as rcsA and rcsB reported to repress the biofilm formation (40).
Fang et al. has reported that the strains carrying rmpA were significantly associated with the hypermucoviousity phenotype and purulent tissue infections, such as liver abscess (20, 48). In the study, we have shown that the rmpA gene located on pLVPK or pLVPK-like plasmid could be correlated with liver abscess suggesting the RmpA located on pLVPK could regulate other virulence factors involved in the K.
pneumoniae pathogenesis.
To investigate the functional role of rmpA, the rmpA deletion mutant was generated. The rmpA deletion mutant reduced the CPS production and increased the growth rate. Although rmpA2- also affected negatively the CPS production, no effect on the bacterial growth indicating a differential role of the two transcription factors suggesting RmpA play more important role than RmpA2 on CPS synthesis.
Nevertheless, analysis of expression of the cps gene revealed that RmpA as well as RmpA2 appeared to reduce the expression of cps gene orf1-2 and orf16-17. Analysis of the ORF showed that orf1 is a homolog of S. typhimurium LT2 galF and E. coli galU, which encodes the enzyme UDP-glucose pyrophosphorylase that regulates the supply of UDP-galactose and UDP-glucose, two major precursors for the biosynthesis of CPS (45, 46). While the orf16 and orf17 encoding respectively by the manC and manB genes, which encode mannoas-1-phosphate guanylytransferase (GDP-mannose pyrophosphorylase) and phosphomannomutase respectively that have been reported to be involved in the biosynthesis of mannose (2, 45, 46).
Notably, the cps expression was regulated by many factors, such RcsAB and RmpA2 (18). Previous study was determined that the E. coli co-transformed with
Klebsiella K2 cps gene cluster, rmpA, and rcsB could produce Klebsiella K2 CPS. But E.coli co-transformed with only K2 cps gene cluster and rmpA could not produce Klebsiella K2 CPS (24). Analysis of RmpA revealed a LuxR-like C-terminus as RcsA (21, 24), implying that RmpA in analogy with the role of RcsA interacts with RcsB to activate cps gene in K. pneumoniae. However, this hypothesis awaits to be investigated.
The activity of PrmpA and PrmpA2 after time course showed that the expression of RmpA and RmpA2 were under different regulation. Analysis of the putative promoter of rmpA was found a putative RcsAB box and Fur box, but not rmpA2, suggesting the expression of rmpA could be regulated by RcsAB complex and Fur. This hypothesis was demonstrated by analysis the activity of PrmpA in wild type and rcsB- strain. But comparison of the activity of PrmpA or PrmpA2 under iron-limit and iron-rich medium were not obvious difference. We presumed that rmpA belonged to Rcs regulon is under the phosphoryl-RcsB control, but not rmpA2. To further identify the RcsAB binding region on PrmpA, the deletion fragment of PrmpA could be fused with LacZ reporter and analyzed.
In previous study, the RmpA2 could be autoregulated (18). Whether the RmpA could be autoregulated or cross-regulated with RmpA2, the activities of PrmpA and PrmpA2 in rmpA- and rmpA2- strain were analyzed. The activities of PrmpA in LacZ16, rmpA- and rmpA2- strain or PrmpA2 in LacZ16, rmpA- and rmpA2- strain were no obvious difference (Data not show) suggesting RmpA or RmpA2 could not directly cross-regulate the expression of RmpA or RmpA2 and RmpA could not be autoregulated. However, this hypothesis awaits to be investigated.
In conclusion, as shown in Fig. 16, we propose a regulatory circuit that RmpA belong to Rcs regulon, but not RmpA2. RcsB activates the expression of rmpA. The RmpA could interact with RcsB to activate CPS synthesis. But RmpA2 could directly
bind to cps genes without RcsB. In addition, expression of rmpA could be activated with osmotic shock or metal ion. The signal to activate the expression of rmpA2 is unknown. However, this pathway is yet to be identified.
Reference
1. Arakawa Y, Ohta M, Wacharotayankun R, Mori M, Kido N, Ito H, Komatsu T, Sugiyama T, Kato N. Biosynthesis of Klebsiella K2 capsular polysaccharide in Escherichia coli HB101 requires the functions of rmpA and the chromosomal cps gene cluster of the virulent strain Klebsiella pneumoniae Chedid (O1:K2). Infect Immun. 1991 Jun;59(6):2043-50.
2. Arakawa Y, Wacharotayankun R, Nagatsuka T, Ito H, Kato N, Ohta M.
Genomic organization of the Klebsiella pneumoniae cps region responsible for serotype K2 capsular polysaccharide synthesis in the virulent strain Chedid. J Bacteriol. 1995 Apr;177(7):1788-96.
3. Borremans B, Hobman JL, Provoost A, Brown NL, van Der Lelie D.
Cloning and functional analysis of the pbr lead resistance determinant of Ralstonia metallidurans CH34. J Bacteriol. 2001 Oct;183(19):5651-8.
4. Brown NL, Barrett SR, Camakaris J, Lee BT, Rouch DA. Molecular genetics and transport analysis of the copper-resistance determinant (pco) from Escherichia coli plasmid pRJ1004. Mol Microbiol. 1995 Sep;17(6):1153-66.
5. Chen YT, Chang HY, Lai YC, Pan CC, Tsai SF, Peng HL. Sequencing and analysis of the large virulence plasmid pLVPK of Klebsiella pneumoniae CG43.
Gene. 2004 Aug 4;337:189-98.
6. Der Vartanian M. Differences in excretion and efficiency of the aerobactin and enterochelin siderophores in a bovine pathogenic strain of Escherichia coli.
Infect Immun. 1988 Feb;56(2):413-8.
7. Domenico P, Schwartz S, Cunha BA. Reduction of capsular polysaccharide production in Klebsiella pneumoniae by sodium salicylate. Infect Immun. 1989 Dec;57(12):3778-82.
8. Ebel W, Trempy JE. Escherichia coli RcsA, a positive activator of colanic acid capsular polysaccharide synthesis, functions to activate its own expression. J Bacteriol. 1999 Jan;181(2):577-84.
9. Ghosh A, Singh A, Ramteke PW, Singh VP. Characterization of large plasmids encoding resistance to toxic heavy metals in Salmonella abortus equi. Biochem Biophys Res Commun. 2000 May 27;272(1):6-11.
10. Gupta A, Matsui K, Lo JF, Silver S. Molecular basis for resistance to silver cations in Salmonella. Nat Med. 1999 Feb;5(2):183-8.
11. Guan S, Clarke AJ, Whitfield C. Functional analysis of the galactosyltransferases required for biosynthesis of D-galactan I, a component of the lipopolysaccharide O1 antigen of Klebsiella pneumoniae. J Bacteriol. 2001 Jun;183(11):3318-27.
12. Han, S.H.B. Review of hepatic abscess from Klebsiella pneumoniae. An association with diabetes mellitus and septic endophthalmitis. West. J.
Med.162:220-224.
13. Hantke K, Nicholson G, Rabsch W, Winkelmann G. Salmochelins, siderophores of Salmonella enterica and uropathogenic Escherichia coli strains, are recognized by the outer membrane receptor IroN. Proc Natl Acad Sci U S A.
2003 Apr 1;100(7):3677-82. Epub 2003 Mar 24.
14. Huang YH, Ferrieres L, Clarke DJ. The role of the Rcs phosphorelay in Enterobacteriaceae. Res Microbiol. 2006 Apr;157(3):206-12. Epub 2006 Jan 4.
15. Kado CI, Liu ST. Rapid procedure for detection and isolation of large and small plasmids. J Bacteriol. 1981 Mar;145(3):1365-73.
16. Kelm O, Kiecker C, Geider K, Bernhard F. Interaction of the regulator proteins RcsA and RcsB with the promoter of the operon for amylovoran biosynthesis in Erwinia amylovora. Mol Gen Genet. 1997 Sep;256(1):72-83.
17. Koehler TM. Bacillus anthracis genetics and virulence gene regulation. Curr Top Microbiol Immunol. 2002;271:143-64. Review.
18. Lai YC, Peng HL, Chang HY. RmpA2, an activator of capsuleb biosynthesis in Klebsiella pneumoniae CG43, regulates K2 cps gene expression at the transcriptional level. J Bacteriol. 2003 Feb;185(3):788-800.
19. Lee, C.C., C. Y. Chen, F. H. Chen, R. A. Zimmerman, and H. S. Hsiao.
Septic metastatic endophthalimitis from Klebsiella pneumoniae liver abscess:
CT and MR imaging characteristics-report of three cases. Radiology.
20. Lin JC, Chang FY, Fung CP, Xu JZ, Cheng HP, Wang JJ, Huang LY, Siu LK. High prevalence of phagocytic-resistant capsular serotypes of Klebsiella pneumoniae in liver abscess. Microbes Infect. 2004 Nov;6(13):1191-8.
21. Majdalani N, Gottesman S. The Rcs phosphorelay: a complex signal transduction system. Annu Rev Microbiol. 2005;59:379-405.
22. Miller, J. H. (1972) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
23. Moss, J.E., Cardozo, T.J., Zychlinsky, A., Groisman, E.A. The selC-associated SHI-2 pathogenicity island of Shigella flexneri. Mol Microbiol.
1999 Jul;33(1):74-83.
24. Nassif X, Honore N, Vasselon T, Cole ST, Sansonetti PJ. Positive control of colonic acid synthesis in Escherichia coli by rmpA and rmpB, two virulence-plasmid genes of Klebsiella pneumoniae. Mol Microbiol. 1989 Oct;3(10):1349-59.
25. Nassif X, Fournier JM, Arondel J, Sansonetti PJ. Mucoid phenotype of Klebsiella pneumoniae is a plasmid-encoded virulence factor. Infect Immun.
1989 Feb;57(2):546-52.
26. Pannucci J, Okinaka RT, Sabin R, Kuske CR. Bacillus anthracis pXO1 plasmid sequence conservation among closely related bacterial species. J Bacteriol. 2002 Jan;184(1):134-41.
27. Peng HL, Wang PY, Wu JL, Chiu CT, Chang HY. Molecular epidemiology of Klebsiella pneumoniae. Chinese Journal of Microbiology 1991
28. Podschun, R., and U. Ullmann. Klebsiella spp. as nosocomial pathogens:
epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin.
Microbiol. Rev. 11:589-603.
29. Pristovsek P, Sengupta K, Lohr F, Schafer B, von Trebra MW, Ruterjans H, Bernhard F. Structural analysis of the DNA-binding domain of the Erwinia amylovora RcsB protein and its interaction with the RcsAB box. J Biol Chem.
2003 May 16;278(20):17752-9. Epub 2003 Mar 5.
30. Pullinger GD, Lax AJ. A Salmonella dublin virulence plasmid locus that affects bacterial growth under nutrient-limited conditions. Mol Microbiol. 1992 Jun;6(12):1631-43.
31. Rahn A, Whitfield C. Transcriptional organization and regulation of the Escherichia coli K30 group 1 capsule biosynthesis (cps) gene cluster. Mol Microbiol. 2003 Feb;47(4):1045-60.
32. Sahly H, Podschun R, Oelschlaeger TA, Greiwe M, Parolis H, Hasty D, Kekow J, Ullmann U, Ofek I, Sela S. 2000. Capsule impedes adhesion to and invasion of epithelial cells by Klebsiella pneumoniae. Infect Immun. Dec;
68(12):6744-9
33. Sambrook, J., Russell, D.W. Molecular coloning: a laboratory manual-3rd edition. Cold Spring Habor Laboratory Press, Cold Spring Harbor, New YorK.
34. Schaberg DR, Culver DH, Gaynes RP. Major trends in the microbial etiology of nosocomial infection. Am J Med. 1991 Sep 16;91(3B):72S-75S.
35. Schwartz, D.C., and Cantor, C.R. Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell 37, pp. 67-75 .
36. Schwyn B, Neilands JB. Universal chemical assay for the detection and determination of siderophores. Anal Biochem. 1987 Jan;160(1):47-56.
37. Silver S, Phung LT. Bacterial heavy metal resistance: new surprises. Annu Rev Microbiol. 1996;50:753-89. Review.
38. Taylor DE, Rooker M, Keelan M, Ng LK, Martin I, Perna NT, Burland NT, Blattner FR. Genomic variability of O islands encoding tellurite resistance in enterohemorrhagic Escherichia coli O157:H7 isolates. J Bacteriol. 2002 Sep;184(17):4690-8.
39. Tsay RW, Siu LK, Fung CP, Chang FY. Characteristics of bacteremia between
community-acquired and nosocomial Klebsiella pneumoniae infection: risk factor for mortality and the impact of capsular serotypes as a herald for community-acquired infection. Arch Intern Med. 2002 May 13;162(9):1021-7.
40. Vianney A, Jubelin G, Renault S, Dorel C, Lejeune P, Lazzaroni JC.
Escherichia coli tol and rcs genes participate in the complex network affect affecting curli synthesis. Microbiology. 2005 Jul;151(Pt 7):2487-97.
41. Wacharotayankun R, Arakawa Y, Ohta M, Hasegawa T, Mori M, Horii T, Kato N. Involvement of rcsB in Klebsiella K2 capsule synthesis in Escherichia coli K-12. J Bacteriol. 1992 Feb;174(3):1063-7.
42. Wacharotayankun R, Arakawa Y, Ohta M, Tanaka K, Akashi T, Mori M, Kato N. Enhancement of extracapsular polysaccharide synthesis in Klebsiella pneumoniae by RmpA2, which shows homology to NtrC and FixJ. Infect Immun. 1993 Aug;61(8):3164-74.
43. Wandersman C, Delepelaire P. Bacterial iron sources: from siderophores to hemophores. Annu Rev Microbiol. 2004;58:611-47.
44. Wehland M, Bernhard F. The RcsAB box. Characterization of a new operator essential for the regulation of exopolysaccharide biosynthesis in enteric bacteria.
J Biol Chem. 2000 Mar 10;275(10):7013-20.
45. Whitfield C, Paiment A. Biosynthesis and assembly of Group 1 capsular polysaccharides in Escherichia coli and related extracellular polysaccharides in other bacteria. Carbohydr Res. 2003 Nov 14;338(23):2491-502. Review.
46. Whitfield C, Roberts IS. Structure, assembly and regulation of expression of capsules in Escherichia coli. Mol Microbiol. 1999 Mar;31(5):1307-19. Review.
47. Yarng, S.S., C. L. Hsieh, and T. L. Chen. Vitrectomy for endogenous Klebsiella pneumoniae endophthalmitis with massive subretinal abscess.
Ophthalmic. Surg. Lasers 28:147-150.
48. Yu WL, Ko WC, Cheng KC, Lee HC, Ke DS, Lee CC, Fung CP, Chuang YC. Association between rmpA and magA genes and clinical syndromes caused by Klebsiella pneumoniae in Taiwan. Clin Infect Dis. 2006 May 15;42(10):1351-8. Epub 2006 Apr 11.
Strain Genotype or relevant property Reference or source E. coli:
NovaBlue(DE3) endA1 hsdR17(rk12-mk12+) supE44 thi-1 recA1 gyrA96 relA1 lac[F，pro AB lacqZ△M15:: Tn10](DE3);Tetr
Novagen
JM109 RecA1 supE44 endA1 hsdR17 gyrA96 rolA1 thi △ (lac-proAB)
Laboratory stock
S17-1λpir Tpr Smr recA, thi, pro, hsdR－M＋ [RP4-2-Tc::Mu:KmrTn7] (pir)
De Lorenzo et al., 1994
ICC188λpir △(ara-leu) araD △lac×74 galE galK phoA20 Taylor et al.,1989 K. pneumoniae:
CG43 Clinical isolate of K2 serotype Laboratory stock CG43-101 Curing the large plasmid pLVPK from CG43 Laboratory stock
CG43-S3 △rspl, Smr Laboratory stock
rmpA- CG43-S3△rmpA Smr This study
rmpA2- CG43-S3△rmpA2 Smr Laboratory stock
rcsA- CG43-S3△rcsA Smr This study
rcsB- CG43-S3△rcsB Smr Laboratory stock
LacZ16 CG43S3△lacZ Smr Laboratory stock
rmpA-Z16 LacZ16△rmpA Smr This study
rmpA2-Z16 LacZ16△rmpA2 Smr Laboratory stock
rcsA-Z16 LacZ16△rcsA Smr This study
rcsB-Z16 LacZ16△rcsB Smr Laboratory stock
Table 1. Bacterial strains used and constructed in this study
Plasmids Relevant characteristic Source or reference
yT&A vector PCR cloning vector, Apr Sigma
pKAS46 Suicide vector, Apr Kmr Novagene
pRK415 Shuttle vector, mob+, Tcr Laboratory stock
pLacZ15 A derivative of pYC016, containing lacZ as a reporter, Cmr Laboratory stock
pRmpA1-4 pKAS46 carrying a △rmpA fragment This study
pRmpA02 A 1.1 kb PCR product of the rmpA locus with the putative promoter cloned into yT&A This study
pRmpA03 A HindIII/EcoRI fragment of pRmpA02 cloned into the pRK415 This study
pRmpA04 A 0.5 kb PCR product of the rmpA putative promoter region cloned into yT&A This study
pRmpAZ15 A BamHI/BglII fragment of pRmpA04 cloned into the pLacZ15 This study
pRmpA2Z15 A 0.5 kb fragment of the rmpA2 putative promoter region cloned into the pLacZ15 Laboratory stock porf1Z15 A 0.8 kb fragment of the cps orf1-2 promoter region cloned into the pLacZ15 Laboratory stock porf3Z15 A 0.9 kb fragment of the cps orf3-15 promoter region cloned into the pLacZ15 Laboratory stock porf16Z15 A 0.4 kb fragment of the cps orf16-17 promoter region cloned into the pLacZ15 Laboratory stock
pYC084 A XbaI/HindIII fragment cloned into the pRK415 Laboratory stock
pAEE40 A 7 kb fragment of pLVPK cloned into pUC18
Table 2. Plasmids used and constructed in this study
Primer Sequence
rmpA1p-01 5'-GTCGGATCCATCGCCAAATA-3' rmpA1p-02 5'-CAG TCA ACA CGG TGC TTT ACA T-3' rmpA01 5'CTCTAGATAAGGCGGCCTTCG-3’
rmpA02 5’-ATAGTCGACGCTATGCTTTACA-3’
rmpA03 5’-TGGTCGACGAAAGATGGCTC-3’
rmpA04 5’-ATGAGCTCAATGTATGCCAAGG-3’
rmpA05 5’-GGCCGAAAGCAGTTAACTG -3’
rmpA06 5’-TTACCTAAATACTTGGCATGA GC -3’
rmpA07 5’- GGCCGAAAGCAGTTAACTG -3’
rmpA08 5’- TTACCTAAATACTTGGCATGAGC -3’
Yu-05 5’-CCTTCACATCCCCTCCCCTT -3’
Yu-06 5’-GTCGGATCCATCGCCAAATAA-3’
iutA01 5'- GAACAGCACAGAGTAGTTCA -3' iutA02 5'- CAGTACACTGAAAACAAGATTG -3'
iroB01 5'- CTTTCTGTACCATCGCGATC -3'
iroB02 5'- TCATTCTTCAGCGAAGAGAT -3'
silS01 5'- ATCAGCCTGTCCACGATACT -3'
silS02 5'- GTCAAACATGACCCTGTCAG
terA01 5'- GGGGGCAATGCCCCTTTAATAGCT -3' terA02 5'- AGACGGGCAATCGCACACAG -3'
Table 3. Primers used in this study
45.67 (58) carry mpA, iutA, iroB, sils, and
isolation (No. of
isolation (No. of