abscisic acid. Plant Physiol 142: 1065–1074.
Yu H, Chen X, Hong Y-Y, Wang Y, Xu P, Ke S-D, Liu H-Y, Zhu J-K, Oliver DJ, Xiang C-B (2008) Activated expression of an Arabidopsis HD-START protein
confers drought tolerance with improved root system and reduced stomatal density.Plant Cell 20: 1134–1151.
Zhu J, Fu X, Koo YD, Zhu JK, Jenney FE Jr, Adams MW, Zhu Y, Shi H, Yun DJ, Hasegawa PM, Bressan RA (2007) An enhancer mutant of Arabidopsis salt overly sensitive 3 mediates both ion homeostasis and the oxidative stress response.
Mol Cell Biol 27: 5214–5224.
TABLES
Table 1. Selected genes up- or downregulated at least 1.5-fold in atgstu17 in leaves
identified by the GeneChip analysis.In total, 1320 genes were found to be upregulated > 2-fold, and 888 genes were found to be repressed by < 0.5-fold compared to WT plants.
Agilent probe ID Gene and Descriptiona
Gene codeb
Fold-Changec P-valued A_84_P856259 PI-PLC;phosphoinositide-specific phospholipase C family protein At3g47290 173.17 0.00113 A_84_P576436 ABF2 (ABSCISIC ACID RESPONSIVE ELEMENTS-BINDING
FACTOR 2)
At1g45249 22.74 0.00113
A_84_P14639 AtPLC9 (phosphoinositide-specific phospholipase C family protein) At3g47220 19.98 0.00503 A_84_P258350 KIN2/COR6.6 (COLD-RESPONSIVE 6.6) At5g15970 5.46 0.03633
A_84_P810688 KIN1 (At5g15960, At5g15960 4.59 0.04729
A_84_P784210 FLC (FLOWERING LOCUS C) At5g10140 4.34 0.00674
A_84_P22552 Bax inhibitor-1 family / BI-1 family At5g47130 4.24 0.01850 A_84_P861798 ANNAT1 (ANNEXIN ARABIDOPSIS 1); calcium ion binding /
calcium-dependent phospholipid binding
At1g35720 4.16 0.00843
A_84_P10613 Cor15b At2g42530 3.93 0.04252
A_84_P20589 PIN5 (PIN-FORMED 5); auxin:hydrogen symporter/ transporter At5G16530 3.5 0.03633 A_84_P721975 MYB88 (myb domain protein 88); DNA binding / transcription
factor
At2g02820 2.54 0.01456
A_84_P10941 ATNHX8 (Arabidopsis thaliana Na+/H+ exchanger 8);
lithium:hydrogen antiporter/ sodium ion transmembrane transporter/
sodium:hydrogen antiporter
At1G14660 2.49 0.00503
A_84_P818712 ENH1 (ENHANCER OF SOS3-1) At5g17170 2.42 0.01288
A_84_P14437 XERICO; protein binding / zinc ion binding At2g04240 2.31 0.04018 A_84_P806724 RAP2.4 (related to AP2 4); DNA binding / transcription factor At1g78080 2.23 0.04335
A_84_P16329 APX1 (ASCORBATE PEROXIDASE 1); L-ascorbate peroxidase AT1G07890 2.33 0.00966 A_84_P115992 CIPK1 (CBL-INTERACTING PROTEIN KINASE 1); kinase AT3G17510 1.99 0.02315
A_84_P859093 DHAR2; glutathione dehydrogenase (ascorbate) AT1G75270 1.97 0.06533 A_84_P17139 SNRK2-10/SNRK2.10/SRK2B (SNF1-RELATED PROTEIN
KINASE 2.10); kinase
AT1G60940 1.82 0.015303
A_84_P12104 GSH2/GSHB (GLUTATHIONE SYNTHETASE 2); glutathione synthase
AT5G27380 1.68 0.00055
A_84_P23264 PIL5 (PHYTOCHROME INTERACTING FACTOR 3-LIKE 5);
transcription factor
AT2G20180 0.63 0.00106
A_84_P22559 SAD1(SUPERSENSITIVE TO ABA AND DROUGHT 1) AT5G48870 0.53 0.03693 A_84_P809263 PIP3 (PLASMA MEMBRANE INTRINSIC PROTEIN 3); water
channel
At4g35100 0.48 0.01394
A_84_P13990 protein serine/threonine phosphatase At5g26010 0.46 0.04335 A_84_P803062 ERD5 (EARLY RESPONSIVE TO DEHYDRATION 5); proline
dehydrogenase
At3G30775 0.33 0.00986
A_84_P784337 FT (FLOWERING LOCUS T) At1g65480 0.3 0.03633
A_84_P17245 PIP2;8/PIP3B (plasma membrane intrinsic protein 2;8); water channel
At2G16850 0.13 0.00232
A_84_P21908 ATP binding / kinase/ protein serine/threonine kinase At1g51830 0.04 0.00843 A_84_P17744 auxin-responsive GH3 family protein At5g13380 0.01 0.00503
A_84_P79105 Hydrolase At1g66860 0.01 0.00986
aDescription as given by The Institute for Genomic Research database.
bAGI, Arabidopsis Genome Initiative.
cGenes with fold change (untreated AtGSTU17-knockout plants/untreated Col-0 plants). dChange P value, which measures the probability that the expression levels of each probe set between AtGSTU17-knockout plants versus Col-0 plants are the same.
Table 2. Stress-related genes up- or downregulated at least 1.5-fold in atgstu17 in
leaves identified by the GeneChip analysis.Agilent probe ID Gene and Descriptiona
Gene codeb
Fold-Changec Induced by ABAd A_84_P751526 disease resistance protein (TIR-NBS class) AT1G72920 336.00 ○ A_84_P750936 disease resistance protein (CC-NBS-LRR class) AT1G59218 219.25
A_84_P19944 disease resistance protein (TIR-NBS class) AT1G72910 177.94 A_84_P13393 disease resistance protein (TIR-NBS class) AT1G66090 137.48 ○
A_84_P302140 disease resistance family protein [AT4G19515.1] AT4G19515 123.60 A_84_P15946 23.5 kDa mitochondrial small heat shock protein (HSP23.5-M) AT5G51440 99.26 ○
A_84_P589554 disease resistance protein (TIR-NBS-LRR class) AT5G36930 95.51 ○ A_84_P800371 disease resistance protein (CC-NBS-LRR class) AT1G58807 68.62
A_84_P12746
RPP13 (RECOGNITION OF PERONOSPORA PARASITICA 13); ATP binding
AT3G46530 66.82
A_84_P22532 disease resistance protein (TIR-NBS-LRR class) AT5G41740 63.32
A_84_P15283 thionin, putative AT1G66100 63.26 ○
A_84_P594938 disease resistance protein (TIR-NBS class) AT5G46490 57.55 A_84_P23777 disease resistance protein (TIR-NBS-LRR class) AT1G63880 56.84
A_84_P20045 disease resistance protein (TIR class) AT1G57630 49.36 ○ A_84_P11136 LIM domain-containing protein / disease resistance protein-related AT5G17890 45.01
A_84_P11679 stress-responsive protein AT2G23680 41.78 ○
A_84_P825937 disease resistance protein (TIR-NBS-LRR class) AT4G16960 32.77 ○
A_84_P10430 disease resistance protein (CC-NBS-LRR class) AT1G61310 28.30 A_84_P829740 disease resistance protein (TIR-NBS-LRR class) AT5G46260 26.41
A_84_P20646 RPP8 (RECOGNITION OF PERONOSPORA PARASITICA 8) AT5G43470 23.03
A_84_P10190
CSA1 (CONSTITUTIVE SHADE-AVOIDANCE1); ATP binding /
protein binding / transmembrane receptor
AT5G17880 20.93
A_84_P15319 ECS1 AT1G31580 17.06
A_84_P13541 disease resistance family protein AT2G15080 13.47 A_84_P16863 disease resistance protein (CC-NBS-LRR class) AT5G43740 13.45
A_84_P22572
HSP81-1 (HEAT SHOCK PROTEIN 81-1); ATP binding / unfolded protein binding
AT5G52640 11.78
○
A_84_P590035 trypsin inhibitor AT2G43535 11.25
A_84_P11793 disease resistance protein RPP1-WsB-like (TIR-NBS-LRR class) AT3G44630 11.11
A_84_P23171
AT-HSFA7A (Arabidopsis thaliana heat shock transcription factor A7A); DNA binding / transcription factor
AT3G51910 9.47
○
A_84_P849621 disease resistance protein (CC-NBS-LRR class) AT1G58602 9.40 A_84_P766643 disease resistance protein (CC-NBS-LRR class) AT5G63020 8.51
A_84_P15440 17.8 kDa class I heat shock protein (HSP17.8-CI) AT1G07400 7.68 ○ A_84_P183744 disease resistance protein (TIR-NBS class) AT1G69550 7.51 ○
A_84_P10439 BIP3; ATP binding AT1G09080 7.50 ○
A_84_P838143 RPP5 (RECOGNITION OF PERONOSPORA PARASITICA 5) AT4G16950 7.44
A_84_P19231
ATHSFA2 (Arabidopsis thaliana heat shock transcription factor A2);
DNA binding / transcription factor
AT2G26150 7.14
○
A_84_P760741 disease resistance family protein / LRR family protein AT3G11010 6.92 ○ A_84_P836180 disease resistance family protein AT2G32680 6.31 ○
A_84_P19706 transmembrane receptor AT5G45000 5.43 ○
A_84_P812454
ATGSTF6 (EARLY RESPONSIVE TO DEHYDRATION 11);
glutathione transferase
AT1G02930 5.23
A_84_P855121 leucine-rich repeat family protein AT5G45510 5.23
A_84_P859300
HSP81-1 (HEAT SHOCK PROTEIN 81-1); ATP binding / unfolded
protein binding
AT5G52640 4.65
A_84_P18999 ATP binding / protein binding / transmembrane receptor AT1G72840 4.48
A_84_P23899 17.6 kDa class I small heat shock protein (HSP17.6B-CI) AT2G29500 4.27 A_84_P831135 disease resistance protein (TIR-NBS-LRR class) AT4G12010 4.27
A_84_P10611 trypsin inhibitor AT2G43530 4.23
A_84_P15908 disease resistance protein (TIR-NBS-LRR class) AT5G40910 4.19 ○
A_84_P14320 ATHSP101 (HEAT SHOCK PROTEIN 101); ATP binding / ATPase AT1G74310 4.03 ○ A_84_P10251 ATPP2-A6 (Phloem protein 2-A6); transmembrane receptor AT5G45080 3.97 ○
A_84_P14579 disease resistance family protein AT3G23110 3.87 ○
A_84_P11731
ATMBF1C/MBF1C (MULTIPROTEIN BRIDGING FACTOR 1C);
DNA binding / transcription coactivator/ transcription factor
AT3G24500 3.84
○
A_84_P826776 stress-inducible protein AT4G12400 3.82 ○
A_84_P806805 heat shock cognate 70 kDa protein 3 (HSC70-3) (HSP70-3) AT3G09440 3.76 A_84_P21539 disease resistance protein (TIR-NBS-LRR class) AT5G18360 3.76 ○
A_84_P18032 17.4 kDa class III heat shock protein (HSP17.4-CIII) AT1G54050 3.73 A_84_P13057 THI2.2 (THIONIN 2.2); toxin receptor binding AT5G36910 3.67
A_84_P87609 universal stress protein (USP) family protein AT1G48960 3.64 A_84_P23046 disease resistance family protein AT3G05650 3.45 ○
A_84_P556555 heat shock cognate 70 kDa protein 2 (HSC70-2) (HSP70-2) AT5G02490 3.40 A_84_P10415 MBP2 (MYROSINASE-BINDING PROTEIN 2) AT1G52030 3.38
A_84_P20795 disease resistance protein (CC-NBS-LRR class) AT1G15890 3.16 ○ A_84_P18240 similar to HSP18.2 (HEAT SHOCK PROTEIN 18.2) AT2G19310 3.03
A_84_P177914 disease resistance protein (CC-NBS-LRR class) AT1G59124 2.98
A_84_P305000 defense-related protein AT2G23960 2.96
A_84_P811289
HSP81-2 (EARLY-RESPONSIVE TO DEHYDRATION 8); ATP
binding
AT5G56030 2.73
A_84_P21612 disease resistance protein (CC-NBS-LRR class) AT5G48620 2.64
A_84_P287150 HSP81-3 (Heat shock protein 81-3); ATP binding AT5G56010 2.54
A_84_P750716 ATP binding / protein binding AT1G58848 2.50
A_84_P23712 17.6 kDa class I heat shock protein (HSP17.6A-CI) AT1G59860 2.41 ○
A_84_P23491
RRS1 (RESISTANT TO RALSTONIA SOLANACEARUM 1);
transcription factor
AT5G45260 2.36
A_84_P16329 APX1 (ASCORBATE PEROXIDASE 1); L-ascorbate peroxidase AT1G07890 2.33
A_84_P830125
BAG6 (ARABIDOPSIS THALIANA BCL-2-ASSOCIATED ATHANOGENE 6); calmodulin binding / protein binding
AT2G46240 2.29
○
A_84_P10998 SGT1A (Suppressor of G2 (Two) 1A); protein binding AT4G23570 2.27 A_84_P763160 disease resistance protein (TIR-NBS-LRR class) AT4G19510 2.15
A_84_P839521 CW9; ATP binding AT1G59620 2.14 ○
A_84_P162633 ATEGY3 AT1G17870 2.10 ○
A_84_P108732 BIP1; ATP binding AT5G28540 2.05
A_84_P806024 HSC70-1 (heat shock cognate 70 kDa protein 1); ATP binding AT5G02500 2.04
A_84_P792961 APX1 (ASCORBATE PEROXIDASE 1) AT1G07890 2.01
A_84_P242433 disease resistance family protein AT3G25020 1.99 ○
A_84_P15197 dehydrin family protein AT1G54410 1.89
A_84_P122072 BIP (LUMINAL BINDING PROTEIN); ATP binding AT5G42020 1.88
A_84_P753650 disease resistance protein (CC-NBS-LRR class) AT1G58602 1.86 A_84_P15339 disease resistance protein (CC-NBS-LRR class) AT1G63360 1.84
A_84_P832193 disease resistance protein (TIR-NBS-LRR class) AT4G19530 1.77 A_84_P12697 UVH3 (ULTRAVIOLET HYPERSENSITIVE 3); nuclease AT3G28030 1.70
A_84_P19202
ATGSTF9 (Arabidopsis thaliana Glutathione S-transferase (class phi) 9);
glutathione transferase
AT2G30860 1.61
A_84_P18775 disease resistance protein (TIR-NBS class) AT5G48780 1.58 ○
A_84_P15928
ATP binding / nucleoside-triphosphatase/ nucleotide binding / protein binding / transmembrane receptor
AT5G46520 0.60
○
A_84_P21536 disease resistance protein (TIR-NBS-LRR class) AT5G17680 0.59 ○ A_84_P17895 MLO10 (MILDEW RESISTANCE LOCUS O 10); calmodulin binding AT5G65970 0.58 ○
A_84_P829422 disease resistance protein (CC-NBS-LRR class) AT1G61190 0.56 A_84_P20891 disease resistance protein (TIR-NBS-LRR class) AT1G72860 0.56
A_84_P157715
TIR (TOLL/INTERLEUKIN-1 RECEPTOR-LIKE); transmembrane receptor
AT1G72930 0.55
A_84_P799368 disease resistance protein (TIR-NBS-LRR class) AT3G44400 0.55 ○ A_84_P825746 HSA32 (HEAT-STRESS-ASSOCIATED 32); catalytic AT4G21320 0.55
A_84_P819339
ATP binding / nucleoside-triphosphatase/ nucleotide binding / protein binding / transmembrane receptor
AT3G44670 0.50
A_84_P20454 disease resistance-responsive family protein / dirigent family protein AT4G23690 0.50
A_84_P14460
LCR68/PDF2.3 (Low-molecular-weight cysteine-rich 68); protease
inhibitor
AT2G02130 0.49
A_84_P247205 protein kinase family protein AT5G57670 0.49 ○
A_84_P15572 RPP1 (RECOGNITION OF PERONOSPORA PARASITICA 1) AT3G44480 0.45 A_84_P22827 RFL1 (RPS5-LIKE 1); ATP binding / protein binding AT1G12210 0.42
A_84_P750611 disease resistance protein (CC-NBS-LRR class) AT1G50180 0.42 ○ A_84_P18631 disease resistance family protein / LRR family protein AT4G13920 0.42 ○
A_84_P17823 disease resistance protein (CC-NBS-LRR class) AT5G47250 0.41 A_84_P23544 HSP18.2 (HEAT SHOCK PROTEIN 18.2) AT5G59720 0.40 ○
A_84_P21463 disease resistance-responsive family protein AT4G38700 0.38 ○
A_84_P13792 disease resistance protein (TIR-NBS-LRR class) AT4G09430 0.35 A_84_P17039 disease resistance protein (CC-NBS-LRR class) AT1G61180 0.34
A_84_P168393 mob1/phocein family protein [AT4G19050.1] AT4G19050 0.28 A_84_P233429 disease resistance protein (CC-NBS-LRR class) AT1G58390 0.24
A_84_P15125 disease resistance protein (CC-NBS-LRR class) AT1G51480 0.14 ○
aDescription as given by The Institute for Genomic Research database.
bAGI, Arabidopsis Genome Initiative.
cGenes with fold change (untreated AtGSTU17-knockout plants/untreated Col-0 plants). dA hollow circle means the gene activated by ABA treatment to 1.3-fold compared to those without treatment from the two websites, the Arabidopsis eFP Browser and AtGenExpress Visualization Tool
Table 3. Primers used in the qRT-PCR experiments.
Gene Gene code Forward primer Reverse primer
ABI1 At4g26080 GTCGAGATCCATTGGCGATAGA TGCCATCTCACACGCTTCTTC
Act8 At1g49240 GAGGATAGCATGTGGAAGTGAGAA AGTGGTCGTACAACCGGTATTGT AnnAt1 At1g35720 TGATTCTGTTCCTGCTCCTTCTG TCGTGGTATGCTTGCCTGATG AREB1/ABF2 At1g45249 GGTGGAGGTGGAGGGTTGACTA CCATGGCTTGTGTTTCTTCAGC AREB2/ABF4 At3g19290 AACAACTTAGGAGGTGGTGGTC CTTCAGGAGTTCATCCATGTTC AtMYB88 At2g02820 ATCTCTAGCAGCAGGCATCC GCAAGGAGGTGGTTGTGAAG AtMYC2 At1g32640 TCATACGACGGTTGCCAGAA AGCAACGTTTACAAGCTTTGATTG
ATP binging
protein
At1g51830 CCCGATTGAAGGTGAAACTC TGATGATCTCTAACAATACGACTC
Bax inhibitor 1 At5g47130 TTCTCGGCAGTGGCAATG CCACGAAGAGCAGGAGTC
CAT1 At1g20630 CGCCATGCCGAAAAATACC TCTTGCCTGTCTGAATCCCA
Cor15b At2g42530 GCCAATGAAACTGCGACTGAG GGACTTTGTGGCATTCTTAGCC ERD5 At3g30775 GCATTGTCCTTCGGGTTAAAGAG CATCCTCATGAGTTGACGGTCAT
Gstu17 At1g10370 ATGCGTTTCTGGAGAAGGCG AGCTTTGCAGTCTCGGGCAT
Hydrolase At1g66860 CAGAGGAAGGCTATGAACATAATG TTGAGGAGTTAGATTGAGGTCAC
NCED3 At3g14440 CAACGGAGCTAACCCACTTCA ACCCTATCACGACGACTTCATCT
PIP2;8 At2g16850 GGAGTTGGACTCGTTAAGGCCT TCAGTGGCGGAGAAGACAGTGTA
PI-PLC At3g47290 CGATCGGTGACCAGGTTCATC ACCCTCACACCCTGTTCAAGTG
RD22 At5g52610 AGGTGGCTAAGAAGAACGCACC TGGCAGTAGAACACCGCGAAT
RD29A At5g52310 TGCACCAGGCGTAACAGGTAA TTGTCCGATGTAAACGTCGTCC RD29B At5g52300 GCGCACCAGTGTATGAATCCTC TGTGGTCAGAAGACACGACAGG XERICO At2g04240 TCAAGTCTTCCTGGTCCATCAGA GAAGAAGGCGAGGATGAAGACG GSH2 At5g27380 GCTAGGCTGCTTATTGAGGAGTC GAGGCTTCATAACAAACAATCCG
DHAR2 At1g75270 CGAGAAGGCTTTGGTTGATGAG CGACTCCCTAGAGAACAAAGCCT
SAD1 At5g48870 ATGGCGAACAATCCTTCACAG CAGAATGGCGATGTTGTTGC
FIGURES
Figure 1. Location of T-DNA insertions in the AtGSTU17 gene and analysis of AtGSTU17 knockout and overexpressed transgenic lines.
(A) AtGSTU17 gene structure and insertional mutation sites of SALK_139615 (atgstu17-1) and SALK_025503 (atgstu17-2). Square boxes represent exons, and black bars represent introns. T-DNA insertions in the two mutant lines are shown as triangles.
(B) AtGSTU17 transcripts in Col-0 and two AtGSTU17 knockout mutants identified by RT-PCR analysis. The expression levels of AtGSTU17 using specific primers (GST30-L: caaagaagatctttcctaagccgc, GST30-R: caccaaacctgatacatacgtaac) were compared with the UBQ10 expression (UBQ10-L:
gatctttgccggaaacaattggaggatggt, UQB10-R: cgacttgtcattagaaagaaagagataacagg).
(C) RNA-blot analysis of AtGSTU17 in Col-0 and two transgenic lines overexpressing AtGSTU17. 10μg of total RNA was loaded in each lane. cDNA probes used were DIG-labeled Arabidopsis AtGSTU17 and rRNA were used as a loading control.
Figure 2. Flowering time of AtGSTU17-mutant lines.
(A) 28-day-old plants growing under 16-h light/8-h dark conditions of the Col-0, two knockout mutants, atgstu17-1 and atgstu17-2.
(B) 24-day-old plants growing under 16-h light/8-h dark conditions of the Col-0, two overexpressing lines, GSTU17OE-1 and GSTU17OE-2.
Figure 3. Phenotypes of AtGSTU17-mutant lines.
(A) Six-week-old plants growing under 12-h light/12-h dark conditions of the Col-0, two knockout mutants, atgstu17-1 and atgstu17-2, and two overexpressing lines,
GSTU17OE-1 and GSTU17OE-2.
(B) Eight-week-old plants. Growth condition is same as A.
(C) Leaf sizes and numbers beginning from the oldest one on the right hand side for different lines of 6-week-old plants under 12-h light/12-h dark.
Figure 4. Tolerance to drought and salt stresses of AtGSTU17-mutant lines.
(A) and (B) Plants (Col-0, atgstu17-1 and atgstu17-2) were grown in a single pot under 16-h light/ 8-h dark conditions. Watering of 3-week-old plants was withdrawn for 10~12 days and then resumed watering. The photograph and figure showing the differences in the reactions of plants to the short-term drought were taken after 5 days of re-watering.
(C) Same as A but for Col-0 and GSTU17OE-2.
(D) and (E) Three-week-old plants (Col-0, atgstu17-1 and atgstu17-2) were watered for 12 days at 4-day intervals with increasing concentrations of NaCl of 100, 200, and 300 mM. The photograph and figure were taken 18 days after the salt treatments. Only the plant having the inflorescence base remaining green
was considered as survivor.
(F) Same as D but for Col-0 and GSTU17OE-2.
The survival rates (%) were calculated from the numbers of surviving plants per total plants tested. Data are presented as the means ±standard deviation (SD). Five independent experiments were performed with similar results.
Figure 5. Tolerance to Freezing of AtGSTU17-mutant lines.
Plants (Col-0, atgstu17-1 and atgstu17-2) were grown in a single pot at 22 oC under 16-h light/ 8-h dark conditions. Three-week-old plants were cold-acclimated (2
oC) for 12 hours. The samples were transferred into freezer at -6 oC for 18 hours. After freezing treatment, the plants were grown in normal condition for 10 days and calculated survival rate. The survival rates (%) were calculated from the numbers of surviving plants per total plants tested. Data are presented as the means ±standard deviation (SD). Three independent experiments were performed with similar results.
Figure 6. Complementation experiment of AtGSTU17 in atgstu17-1 and atgstu17-2
plants.(A) Delayed flowering time in atgstu17-1 and atgstu17-2 were rescued in
35S:GSTU17OE-5/atgstu17-1 and 35S:GSTU17OE-3/atgstu17-2 transgenic
plants. Photographs were taken of 25-day plants growing in a growth chamber at 22 oC under a 16-h light, 8-h dark photoperiod.(B) Drought tolerant phenotype in atgstu17-1 and atgstu17-2 were lost in
35S:GSTU17OE-5/atgstu17-1 and 35S:GSTU17OE-3/atgstu17-2 transgenic
plants. Plants were initially grown on soil under a normal watering regime for 3 weeks. Watering was then halted for 10 d and the photographs were taken.
Figure 7. Effects of abiotic stresses and ABA treatments on AtGSTU17 gene
expression.Quantitative RT-PCRs representing the relative mRNA accumulation of
AtGSTU17 were normalized to those of different known stress-inducible genes. The
amplification of Actin8 was used as an internal control to normalize all data. The level of each gene transcript in wild-type before stress or ABA treatments was set to 1.0.Three independent experiments were performed with similar results. Marker genes were RD29A for dehydration and cold, RD22 for salt, NCED3 for ABA, and AOX1 for oxidative stress.
Figure 8. Subcellular localization of AtGSTU17 protein.
(A) Vector construction of AtGSTU17-GFP in pEarlyGate 103.
(B) Confocal images of onion epidermal cells. Constructs of 35S:GFP or 35S:
AtGSTU17-GFP were translocated into onion epidermal cells by particle
bombardment.(C) 35S:AtGSTU17-GFP fusion were transiently expressed in Arabidopsis protoplasts and visualized by bright-field and fluorescence microscopy. The expression of the introduced genes was detected after 16 hours. Scale bars represent 50 μm.
Figure 9. Tissue-specific expression of the AtGSTU17 protein.
(A) The construction of AtGSTU17 promoter fused GUS gene in pCAMBIA 1391Z vector.
(B) Patterns of AtGSTU17 promoter-driven GUS expression in vascular cells and trichomes in normal growth condition.
(C) GUS expression in the root in normal growth condition.
(D) GUS expression in the leaf with an insert to show the enlarged stomata in normal growth condition
(E) GUS expression in a leaf treated with 5 μM ABA for 6 h.
(F) GUS expression in a leaf treated with 200 mM mannitol for 6h.
(G) GUS expression in a leaf treated 300 mM NaCl for 6 h.
Two-week-old plants grown on MS agar plates were used for the treatments.
Figure 10. AtGSTU17 mutation on water loss rates and ABA-mediated stomatal
closure.Progressive water loss from detached leaves as a function of time in 3-week-old Col-0 and AtGSTU17-mutant plants.Detached leaves were placed on weighing dishes, and allowed to slowly dry on a laboratory bench (25oC, 60% relative humidity).
Weights of the samples were recorded at regular intervals. Error bars represent the standard deviation (SD). Data are presented as the means of water loss percentage ± SD. Three independent experiments were performed with the same trends.
Figure 11. AtGSTU17 mutation on water loss rates and ABA-mediated stomatal
closure.(A) Effect of the AtGSTU17 mutation on ABA inhibition of light-induced stomatal opening. Stomata were pre-opened under light for 2.5 h, and then incubated in the indicated concentrations of ABA for 2.5 h under light. Stomatal apertures were measured on epidermal peels. Values are the means and SD (n > 60).
*Significantly differs from the Col-0 (p < 0.05), by Student’s t-test. These blind experiments were repeated at least three times.
(B) Micrographs representing the dynamics of ABA-mediated stomatal closure in Col-0 and AtGSTU17-mutant plants.
Figure 12. AtGSTU17 regulates seed germination in response to ABA.
Germination percentage of Col-0 and AtGSTU17-mutant lines. Data are presented as the means ±standard deviation (SD). Three independent experiments were performed with the same trend. Seedlings were germinated and grown on half-strength MS agar plates with or without ABA for 3 days.
Figure 13. AtGSTU17 regulates lateral root growth in response to ABA.
(A) Seedlings were germinated and grown on 1/2 MS agar plates without ABA for 3 days and were transferred to the same MS medium without ABA for 1 week.
(B) Same as A but the medium supplemented with 3 μM ABA for 2 weeks.
(C) Same as A but the medium supplemented with 5 μM ABA for 3 weeks.
(D) and (G) Comparison of the primary root length.
(E) and (H) Lateral root number per cm of primary root. Only lateral roots longer than 0.5 cm were used for the calculation.
(F) and (I) Average lateral root length.
atgstu17-mutant (D, E and F), GSTU17OE (G,H and I) and Col-0 plants grown
on vertical 1/2 MS agar plates supplemented with ABA concentrations as indicated for 2 (D, E and F) or 3 weeks (G, H and I). Thirty plants at each ABA concentration were counted and averaged for (D and G). Ten plants at each ABA concentrationwere counted and averaged for (E, F, H and I). Three independent experiments were performed with the same trends.Error bars represent the standard deviation (SD) (t test; *, p<0.05; **, p<0.01).
Figure 14. ABA and GSH contents in Col-0 and AtGSTU17-mutant plants.
(A) Determination of GSH levels in shoot and root under non-stressed conditions in Col-0 and AtGSTU17-mutant plants. Values are presented as the mean ± SD from five samples for each time point. Two independent experiments were performed with similar results. Plants of 3-week-old grown in a growth chamber of 22 oC under 16-h light/ 8-h dark conditions were used in this study. Three independent experiments were performed with the same trends. Error bars represent the standard deviation (SD) (t test; *, p<0.05; **, p<0.01).
(B) Determination of ABA levels under non-stressed conditions in 3-week-old Col-0 and AtGSTU17-mutant plants.Plants were grown in a growth chamber of 22 oC under 16-h light/ 8-h dark conditions. Values represent the means ± standard deviation (SD) from three independent sets of samples. Three independent experiments were performed with similar results. aba2 was used as a reference.
Figure 15. Effect of exogenous GSH on ABA accumulation in leaf tissues.
Col-0 were grown in water containing GSH (200 and 400 μM) in a growth chamber of 22 oC under 16-h light/ 8-h dark conditions. ABA levels were determined using 3-week-old plants. Values represent the means ± standard deviation (SD) from three samples. Three independent experiments were performed with similar results.
Three independent experiments were performed with the same trends.Error bars represent the standard deviation (SD) (t test; **, p<0.01).
Figure 16. Effect of exogenous GSH and ABA on seed germination and stomata
aperture.(A) GSH reduced seed germination sensitivity to ABA inhibition. Col-0 seeds were germinated and grown on 1/2 MS agar plates containing ABA or GSH for 4 days.
Data are presented as the means ±standard deviation (SD). Five independent experiments were performed with similar result.
(B) GSH reduced the intrinsic stomata aperture size. Leaves of 5-week-old Col-0 plants growing in the water solution containing indicated concentration of GSH were peeled and floated on water under light for 2.5 h, and stomatal apertures were measured. Values are the means and SD (n > 60). **Significantly differs from the Col-0 (p < 0.01), by Student’s t-test. These experiments were repeated at least three times.
(C) Micrographs representing the dynamics of GSH-mediated stomatal closure in B.
Figure 17. Effect of exogenous GSH, ABA on the root architecture.
(A) Image of seedlings of 2-week-old Col-0 plants growing in 1/2 MS agar plate (left), or supplemented with 25 μM GSH (central), or supplemented with 3 μM ABA (right).
(B) Comparison of the primary root length. Thirty plants at each condition were counted and averaged.
(C) Lateral root number per cm of primary root. Only lateral roots longer than 0.5 cm were used for the calculation.
(D) Average lateral root length.
Ten plants at each condition were counted and averaged for C and D. Error bars represent the standard deviation (SD) (t test; **, p<0.01).
Figure 18. Effect of exogenous BSO on the root architecture.
(A) BSO treatment reduces GSH content of atgstu17-1 and atgstu17-2 leaves. Plants were grown under 16-h light/ 8-h dark conditions with or without BSO, and leaves of 2-week old plants were used for GSH assay. These experiments were repeated twice and gave comparable results.
(B) Image of seedlings of 2-week-old Col-0 and atgstu17-mutant plants growing in 1/2 MS agar plate with or absence of 3 μM BSO. For photograph purpose plants from separated plates were arranged side by side.
(C) Comparison of the primary root length. Thirty plants at each condition were
counted and averaged.
(D) Lateral root number per cm of primary root. Only lateral roots longer than 0.5 cm were used for the calculation.
(E) Average lateral root length.
Ten plants at each condition were counted and averaged for D and E. Error bars represent the standard deviation (SD) (t test; **, p<0.01).
Figure 19. Effect of exogenous GSH and ABA on drought and salt tolerance.
Three-week-old Col-0 plants were incubated in water solution containing ABA, or GSH or different combinations of ABA and GSH at 22 oC under 16-h light/ 8-h dark conditions. Newly prepared solution was supplied every two days. Mock indicates plants growing in water solution only. Each treatment consisted of 3 pots with 20 plants in each pot. Five independent experiments were performed with similar results. Watering was stopped for 10 days and then resumed watering. The
photographs were taken before re-watering. The survival rates after re-watering for 5 days were indicated (upper panel). Plants were watered for 12 days at 4-day intervals with increasing concentrations of NaCl of 100, 200, and 300 mM along with the ABA and GSH as indicated. The photographs were taken at 18 days incubation. The
survivors were quantified as described for Fig. 4D (lower panel).
Figure 20. Drought tolerance test and flowering time of atgstu17-mutant and Col-0
plants grown in the solution with or without BSO.(A) BSO treatment confers reduced tolerance of the atgstu17-1 and atgstu17-2 to short-term drought. Plants were grown under 16-h light/ 8-h dark conditions with or without BSO. Watering of 2-week-old plants was withdrawn for 10~12 days and then resumed watering. The photograph showing the differences in the reactions of plants to drought were taken after 5 days of re-watering. The survival rates (%) were calculated from the numbers of surviving plants per total plants tested. Data are presented as the means of 3 pots each treatment. Three
independent experiments were performed with similar results.
(B) BSO treatment reduces the bolting time of the atgstu17-mutant plant. Growth condition is same as A.
These experiments were repeated three times and gave comparable results.
Figure 21. Clustered display of Gene expression from atgstu17-2 microarray data.
Each experiment shows consistent expression profiling using Hierarchical Clustering.
Figure 22. Expression of selected genes from the microarray dataset in the AtGSTU17-mutant lines and Col-0 plants.
RNAs were prepared from atgstu17 mutants, GSTU17OE lines and Col-0 plants
under normal growth conditions that are described in Table S1. DNA primers for amplification of each specific gene are listed in the Supplemental Table S2. XERICO (At2g04240), AREB1 (At1g45249), PI-PLC (At3g47290), Bax inhibitor-1
(At5g47130), AnnAt1 (At1g35720), COR15b (At2g42530), GSH2(At5g27380),
DHAR2(At1g75270) and AtMYB88 (At2g02820) were upregulated genes, while
hydrolase (At1g66860), ATP-binding kinase protein (At1g51830), ERD5 (At3g30775, proline dehydrogenase), SAD1(At5g48870) and PIP2.8 (At2g16850) were
downregulated genes. The amplification of Actin8 was used as an internal control to normalize all data. The level of each gene transcript in the Col-0 was set to 1.0. Three independent experiments were performed with similar results.
Figure 23. AtGSTU17 regulating downstream gene expressions and AtGSTU17
induction in ABA-deficient mutant plants.(A) Real-time PCR assay of the accumulation of specific gene transcripts obtained from Col-0 plants and AtGSTU17-mutant lines by withholding water for 5 d from 3-week-old soil-grown plants grown in a growth chamber under 16-h light/8-h dark conditions.
(B) Real-time PCR assay of the expression of AtGSTU17 obtained from Col-0 plants, and aba2- and nced3-mutant lines by withholding water for 5 d from 3-week-old soil-grown plants grown in a growth chamber under16-h light/8-h dark conditions.
Amplification of Actin8 was used as an internal control to normalize all data. The
level of each gene transcript in the Col-0 before dehydration was set to 1.0. Three independent experiments were performed with similar results.
Figure 24. A model for the atgstu17 modulation of drought and salt stress tolerance
and other phenotypes.The underlying mechanism linking loss-of-function mutation of the ATGSTU17 with phenotypes is mainly because the accumulation of GSH in the atgstu17 mutants which might associate with increased level of ABA in planta. Some of the phenotypes, i.e., sensitivity of seed germination to ABA and delayed flowering are specific to the GSH accumulation. Other phenotypes like, stomatal aperture, root architecture, gene expression, and drought and salt stress tolerance are resulting from the combined action of GSH and ABA.