II. Materials and Methods
3. MtDNA purification of mung bean cotyledons
The B-system isolation buffers for mtDNA were used as described with
modification (Sambrook & Russell, 2001; Dai et al., 2005): B-l buffer [pH 7.2, 0.5 M D-mannitol, 10 mM TES (pH 7.2), 1 mM EGTA, 1% (w/v) PVP-40, 0.1% (w/v) BSA, 0.1 M diethyldithiocarbamate, 10 mM mercaptoethanol, 20 mM sodium ascorbate (the last three added fresh just before use]; B2A buffer [pH 7.2), 0.5 M D-mannitol, 10 mM TES (pH 7.2), 0.1% (w/v) BSA]; B2B buffer [pH 7.2, 0.5 M D-mannitol, 10
mM KH2PO4, 50 mM EDTA, 150 mM NaCl, 0.1% (w/v) BSA]; 1.8 M sucrose/B-3 buffer [pH 7.2, 1.8 M sucrose, 10 mM TES (pH 7.2), 20 mM EDTA, 0.1% (w/v) BSA].
Cotyledons were homogenized and nuclei and plastids were removed in B-1 buffer in the same step as the M-system isolation method. After nuclei and plastids were removed, crude mitochondria were incubated with 27 μg/ml DNase I and 10 mM MgC12 for 30 min at room temperature in B-2A buffer. The DNase-treated mitochondria were washed by adding extraction B2B buffer containing 50 mM EDTA and pelleted at 14000 g for 20 min, then fractionated on a continuous sucrose gradient at 81,000 g for 1 hr. Pure mitochondria was lysed with 1% sarcosyl and incubated with 0.2 mg/ml proteinase K in 50 °C for 1 hr. It was then applied to a 5-μg/ml DAPI (4',6-diamidino-2- phenylindole)-CsCl gradient and centrifuged at 117,000 g 17 hr, then decelerated to 89,000 g 24 hr. The MtDNA-DAPI population in CsCl gradient could be detected under UV light. The mtDNA were recovered by Centricon-100.
4. Flow cytometry of isolated mitochondria
Mitochondria from different stages of cotyledons were stained with 5 μg/ml DAPI for 3 min, then analyzed by use of an Elite ESP flow cytometer (Beckman and Coulter) with a 70-mW 365-nm UV laser for excitation. Fluorescence was measured at 457/50 nm. For each experiment, 50,000 mitochondria were analyzed.
5. Pulsed-field gel electrophoresis
Cotyledon mitochondria at different stages were resuspended in TE buffer (10 mM tris-HCl, 1 mM EDTA, pH 8.0), mixed with an equal volume of 1.5% low
melting-point agarose. The plugs were treated with ESP buffer (1 mg/ml proteinase K,
1% sarkosyl, 0.5M EDTA, pH 9.0) at 50 °C overnight. PFGE was performed at 30–60’ pulse time, 150 V (5 V/cm) on 1% agarose gel for 16 hr in 0.5x TBE buffer (45 mM Tris-borate, 1 mM EDTA) at 13 °C. Gels were then stained with ethidium bromide, de-stained by washing and underwent conventional Southern blotting analysis (Sambrook et al., 1982).
6. Analytical ultracentrifugation analysis
Different-stage cotyledon mitochondria were lysed by 1% sarcosyl and treated with 0.2 mg/ml proteinase K at 50 °C for 1 hr. The mean CsCl density was adjusted to 1.7284 g/cm3 (RI=1.4020). Mitochondria were centrifuged to equilibrium at 44,000 rpm at 20 °C for 24 hr by using the Beckman XL-A analytical ultracentrifuge (Beckman-Coulter, Brea, CA, USA), and absorbance was measured at 260 nm.
Micrococcus lysodeikticus DNA (buoyant density at 1.731 g/cm3) was used as a marker. The buoyant density is calculated from the fragment’s mean distance r from the axis of the ultracentrifuge at sedimentation equilibrium (Ifft et al., 1961):
m r2- r2m)/(2B)
wherem and rm are the buoyant density and radial position of a marker DNA, respectively, is the angular speed, and B is 1.190 x·109 (cgs units) for Beckman models E and XL-A under standard conditions.
7. EM examination of mtDNA
MtDNA were purified from DAPI-CsCl-gradient. The Kleinschmidt method was used for surface spreading DNA (Thresher & Griffith, 1992). A 50-l aliquot of DNA
in water was mixed with ammonium acetate to a final concentration of 0.25 M.
Cytochrome c was added to 4 μg/ml and then dropped on parafilm for 20 to 40 min. A collodion film covering the EM grid was touched to the drop and washed with 75%
and 90% ethanol, then air-dried and rotary shadowed with platinum at a 15° angle in a JEOL JEE-420T high-vacuum evaporator (JEOL, Peabody, MA, USA). Before
observation, the grid was coated with carbon to support the film. Samples were examined under a Philips CM100 electron microscope (Philips, Eindhoven, Netherlands) at 80 kV.
8. PCR analysis
Three sets of primers were used for organelle DNA amplification:
1. Mitochondria-encoded gene cox 3: cx3-34U, gtagatccaagtccatggcct and cx3-458L, gcatgatgggcccaagttacggc
2. Nucleus-encoded gene cox 2: cx2-527U, tcccacaaaggattgttcatgg and cx2-994L, cctaactcttaccacgttatat
3. Chloroplast-encoded gene rbcL: rbcL-1049A, tggactgatggacttaccagtcttgatcg and rbcL-4S, acttcgcaagcagcagctaa ttca ggact
The template DNA was amplified by PCR with an initial 95 °C-1 min heating period; 20 or 30 cycles of 94 °C for 30 sec, 55 °C for 30 sec. and 72 °C for 1 min; and finally 72 °C for 5 min to terminate the reaction.
9. In vivo mtDNA synthesis
As described, cotyledon mitochondria of various ages were dissolved in IO buffer (50 mM Tris, 20 mM MgCl2, 40 mM KCl, 2 mM DTT, 1 mM ATP, 50 µM dATP, 50 µM dGTP, 50 µM dTTP). Then, 50 µCi of [α-32P]dCTP (3000 Ci/mmol)
was added to each reaction, and the reaction was mixed well and incubated at 30 °C with shaking for 1 hr. The reaction was stopped by adding 100 μM dCTP and 25 mM EDTA. The mixture was then centrifuged at 14,000 g for 10 min, and the pellet was dissolved in 100 μl TE buffer. Next, 0.5% Triton-X100 was added, and the mixture was incubated at 25 °C for 5 min, then centrifuged at 20,000 g for 1 hr to remove bacterial contamination. The supernatant was then applied to PFGE as described.
Additionally, the gel was dried before development of X-ray films (Dai et al., 2005).
10. LC-MS/MS
Cotyledon mitochondria of various stages were treated with 1% NP-40 and 1%
sarcosyl, then underwent PFGE fractionation. The well-bound (wb) and fast-moving (fm) mtDNA–protein complex (wb- and fm-nucleoid, respectively) was spliced from PFGE gel and underwent trypsin digestion, as we previously described (Lo et al., 2011). The pellet of tryptic peptides was dissolved in 10 to 20 μl of 0.1% (w/v) formic acid for LC-MS/MS. The data were analyzed by using an in-house search with
Mascot v2.2.06 (Matrix Science) against the UniProtKB/Swiss-Prot Viridiplantae database (green plants, 28,773 protein entries) as described (Lo et al., 2011).
11. Mung bean nuclease and RNaseH treatment for mtDNA
Day-1 mtDNA purified by CsCl gradient was used for mung bean nuclease treatment. An amount of 0.2-μg mtDNA for each treatment was incubated with 0 to 10 units mung bean nuclease (M2025S, New England BioLabs) at 30 °C for 30 min. In RNaseH treatment, mtDNA was incubated with 0 to 3 units RNaseH (M4281, Promega Corp.) at 37 °C for 1 hr. MtDNA was separated on 0.5% agarose gels at 1 V/cm and 21 °C for 20 hr in 0.5x TBE buffer after nuclease treatment and underwentconventional Southern blotting analysis.
12. DNA purification from PFGE gels
The method of mtDNA purification from PFGE gel for analytical
ultracentrifugation analysis was previously described (Li et al., 2010). A 100-mg gel slice was incubated in tubes with 300 μl 6 M NaI, and the tube was heated at 70 °C 3 min to dissolve the gel. Then 10-μl silica matrix from silicon dioxide-removed fine silica particle was added for incubating for 2 min at room temperature. The matrix was centrifuged at 16,000 g for 10 sec, washed with washing buffer (50% ethanol, 10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA), then resuspended in 30 μl sterile water and heated at 70 °C for 2 min and centrifugred at 16,000 g for 2 min and the supernatant was collected as DNA eluate.
13. Real-time PCR analysis
Real-time PCR involved use of FastStart Universal SYBR-Green Master Mix (Rox) (Roche) in a AB QuantStudio 12K Real Time PCR System (Life Technologies) programmed to hold at 50 °C for 2 min, then run at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 sec, then 60 °C for 1 min. Specific primers for Vigna radiata mtDNA were designed and are in Table 1. Cox3 level was an internal control.
Fluorescence signal of SYBR-Green dye and the Ct value for each reaction were determined by using QuantStudio 12K Flex (Life Technologies), setting the threshold fluorescence into the exponential phase of the amplifications.
14. Immunoblot Analysis
Proteins from mitochondria at different cotyledon stages were separated by SDS-PAGE, then transferred to polyvinylidene fluoride membranes (Millipore), which were incubated with antiSSB and antiATPase 1 hr at room temperature to identify MtSSB and ATPase (GTMA). Immunoprotein complexes were detected by using the Amersham ECL Plus-Western Blotting Detection System (GE Healthcare).
III. Results
1. Altered quantity of mtDNA at different stages of cotyledon development
To check the mtDNA quantity, mitochondria were isolated from cotyledons at different stages and stained with DAPI for fluorescence microscopy observation (Zeiss Axio Imager Z1, detected by CoolSnap HQ) (Fig. 1A) and flow cytometry (Fig.
1B) to indicate the amount of DNA from isolated cotyledon mitochondria. MtDNA content increased in cotyledons, from 4 °C-12 hr samples, and peaked in 27 °C-12 hr samples. The high content was sustained in day-1 and -2 mitochondria after
germination and steeply decreased in day -3 mitochondria.
The mtDNA content in cotyledon mitochondria was analyzed by PFGE. The same amount of mitochondria in terms of protein content (0.5 mg for serial aged mitochondria) was used. Mitochondria from different stages of cotyledons were lysed and treated with protease K. MtDNA separated into two sub-populations by PFGE as previously reported (Bendich, 1996; Dai et al., 2005): one stayed in the sample loading well (well-bound, wb) and the other one migrated as a smeared zone to the area equivalent to 50 to 200 kb of linear DNA (the fast-moving component, fm). The mobility of fm mtDNA was the same among different stages of cotyledons (Fig. 2A).
The mtDNA content was detected by Southern blot analysis (right panel of Figs 2A and B). As for flow cytometry, with Southern blot analysis, 4 °C-12 hr immersed cotyledons showed less mtDNA content, especially in the wb fraction. The wb mtDNA appeared in 27 °C-12 hr mitochondria and increased in day-1 mtDNA, followed by some decrease in day-2 mtDNA. A small amount of the wb form was found in day-3 cotyledons. In 4 °C-12 hr immersed cotyledon, a large amount of fm
fluctuations of wb and fm parts indicate these two sub-populations may have a different structure and therefore different functions.
Without protease treatment in the same PFGE assay, the mtDNA–protein complex (mt-nucleoids) also separated into two sub-populations. As for protease treatment assay in 4 °C-12 hr immerse cotyledons, the wb form was not detected in dry seeds, or in 4 °C-2, -6 or -12 hr immersed cotyledons by Southern blot analysis (Fig. 2B-b, lanes 1-4). The wb component emerged unambiguously in the 27 °C-12 hr mitochondria and its relative amount increased in day-1 and -2 mtDNA (Fig. 2B-b, lanes 5-7). In addition, the fm component mobility fluctuated during cotyledon development. The retarded fm–protein complex was observed during migration as a smear zone in the area equivalent to 50 to 300 kb linear double-stranded DNA (Fig.
2B). The migration retardation of the fm mtDNA–protein complex became obvious in 27 °C-12 hr mitochondria increased in day-1 mitochondria and remained
approximately the same up to day-2 mitochondria. As a control, proteinase K treatment was applied to an extra day-1 mitochondrial sample (Fig. 2B, lanes 8); the electrophoresis mobility of the fm component was increased in the resulting mtDNA sample (Fig. 2B, lanes 6-8).
2. Physical characteristics of cotyledon mtDNA during seed germination
PFGE analysis revealed two sub-populations in mung bean mtDNA that were presumably caused by differences in DNA conformation and organization (Gerhold et al., 2010). To understand the altered mtDNA conformation/organization, different aged cotyledon mitochondria were lysed and underwent analytical ultracentrifugation (AUC) analysis in a CsCl gradient. The DNA buoyant density estimated by the
marker DNA for Micrococcus lysodeikticus is 1.731 g/cm3. Two sub-populations of mtDNA, peak a, ρ= 1.696 and peak b, ρ= 1.709 g/cm3, were observed by measuring the optical density (OD) at 260 nm after 24-hr centrifugation. Peak b was consistently detected in all mtDNA samples throughout seed germination. Peak a was considered the co-purified chloroplast DNA (cpDNA) as previously described (Wells & Ingle, 1970; Kolodner & Tewari, 1972). It was not detected in 4 ºC- 2 hr and day-3 mitochondria but was seen in other samples (Fig. 3). Southern blot hybridization analysis showed slight chloroplast DNA contamination in 27 °C-12 hr and day-1 mitochondria, but most of the DNA population in 27 °C-12 hr to day 1 mitochondria was mtDNA (Fig. 4A). The mitochondria from day 3 seedlings, as a control, showed peaks at a and b in the AUC analysis, but no chloroplast DNA was detected by Southern blot analysis. The PCR analysis shown in Fig. 4B also shows only a small amount of plastid DNA present in isolated cotyledon mtDNA. These results indicate that peak a may be the mtDNA and cpDNA mixed population. The ratio of peak a to peak b quantity decreased from day-1 to -3 mitochondria, so peak a and b may be two sub-populations of mtDNA with different physical conformation/organization and physiological function.
3. Fluctuation of cotyledon mtDNA synthesis in organello during seed germination
The resuts from PFGE and AUC assay indicated the mtDNA in different growth stages may have different organization for different physiologic functions. To
examine the correlation between mtDNA content/mtDNA complexity and mtDNA synthesis ability during cotyledon development, 32P-dCTP incorporation was used as described (Dai et al., 2005). At the early seed immersion stage, the newly synthesized
mtDNA was clearly in the fm form in isolated 4 °C-12 hr mitochondria after PFGE fractionation of newly synthesized mtDNA (Fig. 5A, lane 1), whereas the relative amount of the newly synthesized wb form increased gradually after an additional 2 and 6 hr incubation at 27 °C (Fig. 5A, lane 2 and lane 3). 27 °C-12 hr to day-2 cotyledon mtDNA showed a much higher DNA synthesis in both fm and wb forms (Figs 5A, lane 4 and 5B, lane 1-3). Day-3 mitochondria showed a sharp decline in mtDNA synthesis activity (Fig. 5B, lane 4). This result suggests that cotyledon mtDNA with 27 °C-12 hr immersed seed and day 1 after germination has high DNA synthesis ability.
MtDNA synthesis was inhibited with three DNA polymerase inhibitors, aphidicolin, N-ethylmaleimide (NEM), and ddCTP, to assess the nature of the polymerase responsible for the observed in organello mtDNA synthesis (Fig. 5C).
After 1-hr pulse-labeling, in organello cotyledon mtDNA synthesis was strongly inhibited by NEM and ddCTP (Fig. 5C, lane 4-8), with no effect of aphidicolin treatment, even at high concentration (100 μM; Fig. 5C lane 2, 3). Thus, the in organello DNA synthesis activity of mung bean mitochondria may be driven by an
organello localized γ-like DNA polymerase rather than a nucleus-localized α-like polymerase (Sala et al., 1980; Heinhorst & Cannon, 1993; Dai et al., 2005; Zhang et al., 2011). Furthermore, during cotyledon development, the fluctuation detected for
the in organello mtDNA synthesis was substantial, especially for the wb form, which suggests that the observed mtDNA synthetic activity reflected a replicative mtDNA synthesis not just a repair/recombination event, which may also be involved. (The DNA synthesis data were generated by Dr. Annamalai and me).
Taken together, the results indicate that cotyledon mtDNA content per
mitochondrion, the structural complexity of mtDNA, and its replication activity all
fluctuated in parallel with each other during cotyledon development. This line of evidence further suggests that the increase in structural complexity of mtDNA is linked to its replication activity as reflected by the increase in mtDNA content per mitochondrion.
4. The difference between wb and fm mtDNA in terms of buoyant density, ultrastructure and restriction enzyme patterns
To clarify the correlation of the populations on PFGE gel and AUC assay data, wb and fm 27 °C-12 hr cotyledon mtDNA was eluted from PFGE gel for AUC assay.
Both wb and fm DNA still showed low density peaks (~1.6981 and 1.7006 g/cm3, respectively) and high density peaks (~1.7094 and 1.71124 g/cm3, respectively). Both low and high density peak profiles showed as very broad peaks (Fig. 6B), which may have been caused by high fragmentation during re-purification of wb/fm DNA from PFGE gel. EM revealed a more complex DNA structure in wb than fm mtDNA (Fig.
6C). The restriction enzyme digestion pattern indicated the similarity between wb and fm mtDNA, except in some minor bands (Fig. 6D, arrows; the data were generated by Yih-Shan Lo ).
5. MtDNA ultrastructural dynamics during cotyledon development
To further elucidate to the issue of mtDNA structural change during different cotyledon stages, mtDNA from different-aged cotyledons purified by CsCl-DAPI gradient ultracentrifugation were examined on EM. Before seed germination, mtDNA was observed as a short linear fragment or branch structure, most just 3-5 kb long in dry seeds (Fig. 7A and Table 2). After 4 °C-2 hr immersion, the linear fragments were slightly longer, and a high proportion was converted to a simple rosette structure incotyledons (89% of total length, Fig. 7B, Table 2). Most of these rosettes were 20 to 40 kb. These rosette structures maintained a similar but looser structural conformation in up to 4 °C-6 hr immersed samples; however, the rosettes plus reticular rosettes (rosettes comprise small reticular network) decreased from 91% to 69% of the total mtDNA length (Fig. 7C and Table 2). After 4 °C-12 hr imbibition, nearly all of the mtDNA was converted to a longer linear form and the rosette core disappeared simultaneously (Fig. 7D). The 4 °C-12 hr long linear mtDNA molecules were much longer than the individual rosettes for 4 °C-2 hr and 4 °C-6 hr mtDNA; only 5% of the total length of mtDNA maintained a rosette-like structure. The large linear mtDNA converted back into rosette structures when seeds were returned to 27 °C for 2 hr and 6 hr, after a 4 °C-12 hr imbibition; nearly 87% and 90% of the total length consisted of simple or regular rosette molecules, respectively (Figs. 7E, F and Table 2).
A much more complex rosette structure appeared with 27 °C-12 hr culture for day-1 and -2 mtDNA (Figs. 8-10). These complex rosette structures were often attached to linear, branched and circular mtDNA structures. Obvious core(s) were visible at the centers of rosettes or sub-rosettes. Nearly 86% of the total mtDNA length in 27 °C-12 hr and day-1 mitochondria were complex rosette plus reticular rosette structures. More reticular networks were found around the core structure, and most appeared in the early mtDNA synthesis stages (Figs. 8, 9, long dotted arrow).
The remaining parts were simple long linear or branchlinear forms. An independent circular structure was nearly absent in our observations. In day-2 cotyledon mtDNA, more than 50% of mtDNA remained as complex rosette structures (Fig. 8C). The giant rosettes were found in highly mtDNA-replicating mitochondria (Figs. 9 and 10).
In day-3 mtDNA, the compact rosette molecules mostly disappeared. Instead, linear DNA with/without attachments to looser networks and branch structures appeared;
only 19% of mtDNA maintained a very loose rosette structure in day-3 cotyledon mitochondria (Fig. 8D). These results indicate that the extent of mtDNA structural complexity is closely associated with the magnitude of synthesis activity during cotyledon development.
6. Structural characteristics of giant mtDNA rosette complex
On EM, a rosette-like structure of mtDNA was obvious in different stages. These individual rosette genome sizes were about 20 to 200 kb, much smaller than the 401 kb reported by other investigators (Alverson et al., 2011b). A giant rosette-like
complex was observed occasionally, especially at the height of the replicative mtDNA synthesis period during cotyledon development. EM revealed giant rosette mtDNA present in 27 °C-12 hr (Fig. 9A) and day-1 (Fig. 9B) mitochondria. Various-sized petal-like structures extended from the central core (arrows in Fig. 9). Around the core region, concentric-like petals were affiliated with putative “RDR forks”
(Oldenburg & Bendich, 1996; Backert & Borner, 2000; Oldenburg & Bendich, 2001;
Gerhold et al., 2010). The RDR forks are represented by the red sketches drawn in the upper left box of panels A and B in Figure 9, respectively. The satellite cores are indicated with arrowheads in panels A and B. Both the central core and satellite core presented as a single or multiple form. Petal-like structures and/or linear DNA structures extended outward from the central or satellite cores. The small reticular networks, marked by long dotted arrows, were often found in giant rosettes. A Holliday junction is indicated by a short dotted arrow in the upper left box of the figure. Generally, the size of the giant rosette structural molecule was larger than the single mtDNA genome size and could be as large as 2-6 genome units per molecule.
The DNA connection between rosettes could be visualized on EM (Fig. 10),
showing mtDNA rosette structures with similar (panel B-a) or varied (panel B-b) complexities in structure and organization linked to each other by DNA junctions.
The DNA junction connecting the rosette structure clearly shows that the connection passes from core to core between the rosettes (Fig. 10A, box b, and 10B). A putative RDR fork (red sketch), Holliday junction (short dotted arrow) and D-loop (short arrow) are also visible in Figure 10.
A complicated giant rosette molecule in the form of relaxed multi-rosette units was found in day-1 mtDNA (Fig. 10A). This irregular giant rosette structure differs from that in Figure 9 and rarely appeared in the investigation. This extremely large and complicated mtDNA molecule may be relaxed or converted from the RDR intermediate shown in Figure 9 during mtDNA purification. The enlarged boxed area A of Figure 10A in the upper right corner exhibits multi-cores, replication forks, a Holliday junction (short dotted arrow), and a D-loop structure (short arrow). All features point to the RDR, for example, branching linear mtDNA (double arrowhead), and a looping circular structure (arrowhead). Some reticular networks were also found near the core (long dotted arrow). The box b of Figure 10A indicates the linkage of three sub-rosettes, from core to core by DNA junctions, similar to Figure 10B. The large complex mtDNA molecule in Figure 10A is > 1000 kb.
7. Unraveling the mtDNA rosette structure by freeze-thaw treatment
in vitroThe expansion and relaxation of the day-1 cotyledon DNA molecule was induced by a long freeze-thaw treatment in water. Day-1 rosette mtDNA (40~200 kb in general) is shown in Figure 11A-a. As compared with the regular rosette-like structure, the rosette components converted into a huge, complicated and loose
mtDNA molecule (panel A-b) after the freeze-thaw treatment in water. The b1, b2 and b3 images at the bottom of Panel A-b represent enlarged images of the corresponding boxed areas displayed in panel A-b (the red sketch presents the mtDNA EM image of Fig. 11A-b). Decomposed mtDNA rosette-like structures appear as a large linear form and are attached with various decomposed replicating structures. The sizes of these large linear structures were > 2000 kb and could not be estimated correctly because
mtDNA molecule (panel A-b) after the freeze-thaw treatment in water. The b1, b2 and b3 images at the bottom of Panel A-b represent enlarged images of the corresponding boxed areas displayed in panel A-b (the red sketch presents the mtDNA EM image of Fig. 11A-b). Decomposed mtDNA rosette-like structures appear as a large linear form and are attached with various decomposed replicating structures. The sizes of these large linear structures were > 2000 kb and could not be estimated correctly because