To see whether rssA and rssB was conserved among S. marcescens strains, a total of 67 S. marcescens strains collected from National Taiwan University Hospital, one strain (S. marcescens NewCDC) isolated from Germany, and three strains (S.
marcescens 1324E, S1220 and 4444) isolated from U.K. were subject to PCR
amplification using the primer pairs (5’CCATCATCGTCACCTTGCTGTTTACC3’/GAGCGACAGTTCCACATCCTTTT
CCA3’)and(5’TGCTGGATCTCACGCTGCCG3’/5’CCGGTTGACAGCCTTGACG C3’) designed from within the open reading frame region of rssA and rssB for amplifying rssA and rssB, respectively. We have detected both rssA and rssB DNA fragments from 68 out of the 71 S. marcescens strains tested (data not shown), suggesting that the rssA-rssB gene pair was conserved among S. marcescens strains.
Long chain SFAs regulate swarming of P. mirabilis and S. typhimurium
To see whether swarming of another two bacterial strains, P. mirabilis P19 and S.
typhimurium LT2 was also inhibited by SFAs, SFAs and UFAs at the concentration of
0.01%(w/v) was incorporated into 2% Eiken agar LB plates and 0.5% Eiken agar LB plates followed by swarming assay of P. mirabilis and S. typhimurium, respectively, at 37°C. We found that a similar inhibitory effect of SFAs on swarming of both bacteria was observed and that UFAs showed either stimulate or inhibit the swarming of both bacteria (data not shown). The effect of myristic acid and myristoleic acid on swarming of both bacteria was shown in Figure 11. Both myristic acid and myristoleic acid significantly inhibited swarming of both bacteria. The results suggested a common regulatory effect of fatty acids on swarming bacterial species.Discussion
Bacteria that differentiate and demonstrate multicellular behaviour as part of the regulated expression of gene networks required for the complex processes underlying morphological and physiological changes are commonly observed (Shimkets 1990;
Matsuyama and Matsushita 1993; Shapiro 1995; Shapiro 1998 Rice et al., 1999; Alavi and Belas 2001). Regulation of these multicellular behaviours usually involves interaction between cells and/or cells to environment signals. Examples include Gram-positive bacterial antimicrobial peptide production (Kleerebezem and Quadri 2001), sporulation in Bacillus (Ryan and Shapiro 2003), light emission in Vibrio (Meighen 1999), biofilm formation in Pseudomonas (Costerton et al., 1999; Costerton 2001), production of nitrogen-fixing cells in cyanobacterium (Adams 2000), and also populational surface migration of many bacterial species (Velicer and Yu 2003;
Horng et al., 2002; Romling 2001; Macfarlane et al., 2001; Fraser and Hughes 1999;
Eberl et al., 1999; Harshey 1994; Shapiro 1998; McCarter and Silverman 1990).
Although a large body of information concerning the swarming mechanisms has been accumulated in Serratia and related bacterial species, the molecular mechanism(s) of swarming is far from understood. This is because the wide spectrum effects of physiology in swarming bacteria make it difficult to study the mechanisms directly. Furthermore, a potential specific and conserved regulator governing initiation of swarming has not been clearly identified, albeit a regulator of swarming behaviour of P. mirabilis, RsbA, has been reported by Belas et al., (1998). The identification of such a swarming regulator gene is thus an essential step in understanding the underlying mechanism of swarming. In this paper we present strong evidence that determination of S. marcescens swarming is controlled by acclimation of membrane fluidity, which is affected by environmental factors including temperature and nutrients, especially the provision of SFA substrates. We propose that the change of membrane fluidity is sensed by a pair of two-component regulatory proteins, RssA and RssB, which subsequently govern the expression of hemolysin gene shlA and fabGSm gene coding for the NADPH-dependent 3-ketoacyl-ACP reductase, an enzyme involved in fatty acid synthesis (Rawlings and Cronan 1992). In
P. aeruginosa, FabG is also reported to be involved in rhamnolipid synthesis and
3-oxo-homoserine lactone acyl chain length determination (Campos-Garcia et al., 1998; Hoang et al., 2002). Although kinase-response regulator pairs of this type were frequently reported as governors of a wide variety of pathways in response to a myriad of environmental signals (Dutta et al., 1999; Hoch et al., 2000), we have for the first time shown the requirement for temperature- and SFAs- dependent regulation of swarming via these genes. The genetic studies shown in this work indicate that RssA-RssB may form a signal transduction pathway controlling the fatty acidprofile-dependent regulation of fabGSm gene expression and subsequently fatty acid profile, shlA hemolysin gene expression and initiation of swarming.
We hypothesized that when S. marcescens cells are growing into stationary phase at 30°C, no phosphorelay signaling is transferred between the RssA-RssB pair so RssB is mostly in a unphosphorylated form (inactive repressor) and at 37°C, the phosphorelay occurs and RssB is mostly phosphorylated (active repressor):(i) at 30°C, RssB in stationary phase cells is potentially in a unphosphorylated form in the presence or absence of RssA, expression of fabG Sm and shlA is not down-regulated, and bacteria swarm; when rssB is mutated, CH-1∆B thus showed a swarming, albeit
“slow-swarming” phenotype. (ii) at 37°C, compared with CH-1 whose RssB is potentially phosphorylated to become an active repressor, fabGSm expression is inhibited and cells do not swarm, both CH-1∆A and CH-1∆B show a decrease in
fabG
Sm expression and super-swarming phenotype, although CH-1∆A swarms faster and CH-1∆B slower. On the basis that no response regulator has yet been identified to be active in the unphosphorylated form (Hoch, 2000), we propose that RssB may act as an active repressor binding to the promoter of fabGSmwhen phosphorylated at 37°C,
and binds to nearby promoter DNA region at 30°C (Lai et al., unpublished data). The role of RssA would then be to act as a phosphatase that selectively dephosphorylates RssB at 30°C. However, after a temperature upshift RssA would function as a specific kinase phosphorylating RssB, the cognate response regulator, which inhibits fabGSmexpression and also swarming initiation on LB swarming plate. The results in this report strongly suggest that the sensor protein RssA is a bifunctional enzyme having both kinase and phosphatase activities. These two opposite activities of the sensor protein have been demonstrated in different two-component systems (for a review see Dutta et a., 1999). We have further shown that the transcriptional activity of the
fabG
Sm promoter and subsequently the “swarming” or “non-swarming” fatty acid profile can be regulated by not only temperature shift, but also SFAs at a constant temperature. Temperature downshift or SFA deficiency may mediate activation of RssA phosphatase activity, leading to dissociation of unphosphorylated RssB, and subsequently RssB binding to another fabGSm promoter DNA region (Lai et al., unpublished data). Currently experiments are being performed to confirm these questions.A provisional model accounting for our results is shown in Figure 12. We envisage that RssA could assume different signaling states under varying growth temperatures and nutrient conditions which lead to different membrane fatty acid composition for the sake of homeostasis. This could be accomplished by regulating the ratio of kinase to phosphatase activities, such that a kinase-dominant state is present at high growth temperature or SFA-rich nutrients. RssA possesses a single
transmembrane domain and either the periplasmic domain or cytoplasmic domain would function to propagate a conformational change that is sufficient to significantly alter its activity. This conformational change could be governed by the physical state of the membrane lipid bilayer. Lipids in biological membranes are usually maintained in the fluid, liquid-crystalline state (Vigh et al., 1998). The correct physical state of membrane lipids is required for optimal membrane structure and function.
Temperature markedly affects membrane lipid composition, and changes in lipid composition are thought to occur in order to maintain an appropriate liquid crystalline state. The major way in which bacteria, generally lacking cholesterol, maintain this functional membrane physical state is by changing their fatty acid composition (Vigh et al., 1998). As the growth temperature decreases, the proportion of low-melting-point fatty acids in the membrane lipids increases. The phenomenon of membrane fluidity affected by environmental temperature is also shown in the cyanobacterium Synechocystis, where low-temperature signals are shown to induce the desaturation of fatty acids in the cell membrane, thus changing the membrane fluidity (Sakamoto and Murata 2002). Membranes at 30°C are normally in a less-liquid crystalline form and will undergo a transition to a more-fluid phase state when the temperature increases (Cronan and Rock 1996; Vigh et al., 1998). This change from a non-fluid (ordered) to a liquid state (less ordered) might cause activation of the kinase activity, resulting in autophosphorylation of a conserved histidine (His 188) contained in the transmitter domain of RssA. The phosphoryl group of His188 could be directly transferred to RssB, which down-regulates transcription of fabGSm or shlA. Activation of fabGSm results in a synthesis of
“non-swarming fatty acid profile”. This metabolic pathway, therefore, generates a regulatory loop where SFAs or temperature upshift stimulates fabGSm transcription by favouring RssB phosphorylation and promotes phosphorylated RssB binding to its binding site. In B. subtilis, cells respond to a decrease in ambient growth temperature by desaturating the fatty acids of their membrane lipids and by increasing the proportion of anteiso-branched fatty acids (Aguilar et al., 2001). This pathway, termed the Des pathway, responds to a decrease in growth temperature by enhancing the expression of the des gene coding for an acyl-lipid desaturase (Aguilar et al., 2001). The Des pathway is also uniquely and stringently regulated by a two-component system composed of a membrane-associated kinase, DesK, and a soluble transcriptional activator, DesR. It is suggested that activation of this transduction pathway might be mediated by a decrease in membrane fluidity provoked by a temperature downshift (Aguilar et al., 2001). It is also found in B.