6.2 General Experimental Procedures
6.2.18. Statistical methods
The results of the biofilm-forming activity and β-galactosidase activity assays were derived from a single experiment that was representative of three independent experiments. Each sample was assayed in triplicate and the data were presented as the mean ± standard deviation (SD). Differences between groups were evaluated by a
two-tailed Student’s t-test. P-values less than 0.01 were considered statistically significant difference.
Table 6.1. Bacterial strains used in this study
Strain Description Reference or Source
K. pneumoniae
NTUH-K2044 Clinical isolate of K1 serotype (88, 325)
CCW01 NTUH-K2044 ΔlacZ This study
CG43 Clinical isolate of K2 serotype (47)
CG43S3 CG43, Smr (171)
ΔmrkH CG43S3 ΔmrkH , Smr This study
ΔmrkI CG43S3 ΔmrkI, Smr This study
ΔmrkJ CG43S3 ΔmrkJ, Smr This study
CCW40 CG43S3 ΔmrkI [pWY28], Kmr This study
CCW41 CG43S3 ΔmrkI [pWY45], Kmr This study
ΔlacZ CG43S3 ΔlacZ, Smr
ΔlacZ ΔmrkI CG43S3 ΔlacZ ΔmrkI, Smr This study
CCW51 (MrkID56E) CG43S3 mrkID56E, Smr This study
CCW54 (MrkID56A) CG43S3 mrkID56A, Smr This study
Δfur CG43S3 Δfur, Smr (53)
ΔlacZ Δfur CG43S3 ΔlacZ Δfur, Smr (53)
Table 6.1. (continued)
Strain Description Reference or Source
ΔlacZ ΔrcsA CG43S3 ΔlacZ ΔrcsA, Smr (185)
ΔlacZ ΔrcsB CG43S3 ΔlacZ ΔrcsB , Smr (185)
ΔlacZ ΔmrkH CG43S3 ΔlacZ ΔmrkH, Smr This study
ΔrcsA CG43S3 ΔrcsA, Smr (185)
ΔrcsB CG43S3 ΔrcsB, Smr (171)
ΔrmpA CG43S3 ΔrmpA, Smr (53)
ΔrmpA2 CG43S3 ΔrmpA2, Smr (171)
E. coli
JM109 endA1 glnV44 thi-1 relA1 gyrA96 recA1 mcrB+ Δ(lac-proAB) e14- [F' traD36 proAB+ lacIq lacZ ΔM15] hsdR17
(rK-mK+) New England Biolabs
S17-1 λpir hsdR recA pro RP4-2 (Tc::Mu; Km::Tn7)(λpir) (282)
Novablue (DE3) F- ompT hsdSB (rB-mB-) gal dcm (DE3), Tcr Novagen
BL21 (DE3) F- ompT hsdSB (rB-mB-) gal dcm trxB15::kan (DE3) Novagen
HB101 F- thi-1 hsdS20 (rB-mB-) supE44 recA13 ara-14 leuB6 proA2 lacY1 galK2 rpsL20 (strr) xyl-5 mtl-1 Promega
Table 6.2. Plasmids used in this study
Plasmid Description Reference or Source
yT&A Apr, T/A-type PCR cloning vector Yeastern
pET30a-c Kmr, His-tagged protein expression vector Novagen
pKAS46 Apr, Kmr, suicide vector, rpsL (282)
pBAD33 Cmr, expression vector (114)
placZ15 Cmr, promoter selection vector, lacZ+ (183)
pRK415 Tcr, shuttle vector, mob+ This study
pETQ (pETQ33) Kmr, expression vector This study
pKPCA (pETP3) Kmr, 513-bp fragment encoding full length KpcA cloned into pET30a This study pKPC-7 Kmr, ~ 4.9-kb fragment containing the kpcABCD genes cloned into pET30a This study pKPC-36 Kmr, ~ 4.9-kb fragment containing the kpcABCD genes cloned into pETQ This study pAW67 Kmr, ~ 3.8-kb fragment containing the kpcABC genes cloned into pETQ This study pAW69 Kmr, ~ 8.1-kb fragment containing the fimAICDEFGHK genes cloned into pETQ This study pKPCI196 (pSY008) Cmr, 591-bp fragment encoding full length KpcI196 cloned into pBAD33 This study pKPCI210 (pAW142) Cmr, 633-bp fragment encoding full length KpcI210 cloned into pBAD33 This study pKPC-ON (pKPC-22) Apr, 1087-bp fragment containing the kpcSON region cloned into yT&A This study pKPC-OFF (pKPC-20) Apr, 1087-bp fragment containing the kpcSOFF region cloned into yT&A This study pSY003 Cmr, 280-bp fragment of the kpcSON region cloned into placZ15 This study pSY004 Cmr, 280-bp fragment of the kpcSOFF region cloned into placZ15 This study
Table 6.2. (continued)
Plasmid Description Reference or Source
pAW126 Cmr, 374-bp fragment of the upstream region of kpcA in the kpcSON phase cloned into placZ15 This study pAW73 Apr , ~ 5.5-kb fragment containing the kpcSOFF-kpcABCD region cloned into yT&A This study pWY28 Kmr Apr, 1953-bp fragment containing the adjacent regions beside mrkI cloned into pKAS46 This study pWY45 Kmr Apr, 2597-bp fragment containing the mrkI and its adjacent regions cloned into pKAS46 This study pmrkA-P1 (PL-mrkA) Cmr, 551-bp fragment of the upstream region of mrkA cloned into placZ15 Ying-Jung Huang pmrkA-P2 (PS-mrkA) Cmr, 402-bp fragment of the upstream region of mrkA cloned into placZ15 Ying-Jung Huang pmrkA-P3 (pAW146) Cmr, 232-bp fragment of the upstream region of mrkA cloned into placZ15 This study pAW197 Kmr Apr, 2597-bp fragment containing the mrkID56E mutant allele cloned into pKAS46 This study pAW198 Kmr Apr, 2597-bp fragment containing the mrkID56A mutant allele cloned into pKAS46 This study pMrkH (pAW45) Kmr, 711-bp fragment encoding full length MrkH cloned into pETQ This study pMrkH* (pAW182) Kmr, 711-bp fragment encoding full length MrkHR111D cloned into pETQ This study pPilZ (pAW190) Kmr, ~ 480-bp fragment encoding the PilZ domain of MrkH cloned into pETQ This study pPilZ* (pAW191) Kmr, ~ 480-bp fragment encoding the PilZ domain of MrkHR111D cloned into pETQ This study pMrkHN (pAW194) Kmr, ~ 330-bp fragment encoding the N-terminal domain of MrkH cloned into pETQ This study pfur Tcr, 0.8-kb fragment containing a fur allele cloned into pRK415 (53) pAW175 Cmr, 407-bp fragment of the upstream region of mrkH cloned into placZ15 This study pYdeH (pAW47) Kmr, 894-bp fragment encoding YdeH, from E. coli W3110, cloned into pETQ This study pYdeH* (pAW71) Kmr, 894-bp fragment encoding YdeHAADEF cloned into pETQ This study
Table 6.3. Oligonucleotide primers used in this study
Primer Sequence (5’--- 3’) a Enzyme cleaved Complementary position (5’ end) prevalence analysis
kpa-1 (pcc047) CACGTATGTATTCGCCCT none +31 relative to the kpaE start codon kpa-2 (pcc004) TCAGTTATAAGTAAAGGTGATCACCCC none -24 relative to the kpaE stop codon kpa-3 (dk001) TTGTCGTTTCATATGGATATGGGAA NdeI -12 relative to the kpaA start codon kpa-4 (dk002) GATTCCCCTTTCTCCATTCAACA none +33 relative to the kpaA stop codon kpb-1 (pcc005) CACCGTGGGGCAAAAGC none -4 relative to the kpbD start codon kpb-2 (pcc006) TTAATCTTCCTGAATAACGACTTCCA none on the kpbD stop codon
kpb-3 (pcc021) ATGAAAAAGACAATCGTAGCTGTA none on the kpbA start codon
kpb-4 (pcc022) CGGGACCCTCGAGGGAAA none +20 relative to the kpbA stop codon kpc-1 (pcc007) CACCATGAAGGTGTTATTAAAATCCG none -4 relative to the kpcD start codon kpc-2 (pcc008) CTATTTATATGTCAACGTAAACGTCGC none on the kpcD stop codon
kpc-3 (pcc023) ATGAAAAAAACGATAACAATCGTG none on the kpcA start codon
kpc-4 (pcc024) CCCCTCGAGGGCACAGTGT XhoI +18 relative to the kpcA stop codon kpd-1 (pcc009) CACCATGAAAAAAATCATCGCA none -4 relative to the kpdD start codon kpd-2 (pcc010) TCAGTTATAAGTCACCACGAAGGTC none on the kpdD stop codon
kpd-3 (pcc025) TAAGCGTGGTGATGAGGAGTG none -24 relative to the kpdA start codon kpd-4 (pcc050) GCCAGAAGCTTACGCCGC HindIII +78 relative to the kpdA stop codon kpe-1 (pcc011) CACCATGTCCTTTTTAACTCTCCTG none -4 relative to the kpeD start codon kpe-2 (pcc012) CTAGTCATAATGCAAGGTATAGGTCGC none on the kpeD stop codon
Table 6.3. (continued)
Primer Sequence (5’--- 3’) a Enzyme cleaved Complementary position
Prevalence analysis
kpe-3 (pcc027) TTGAGTATGAAAGAAAAAGGCACC -6 relative to the kpeA start codon kpe-4 (pcc028) GGATCCGGTCTCGAGGAAGAG BamHI, XhoI +70 relative to the kpeA stop codon
kpf-1 (pcc013) CACCATGCGCCGACTTAGC -4 relative to the kpfD start codon
kpf-2 (pcc014) TTATTCAAAGGTCACGGTGATTTTG on the kpfD stop codon
kpf-3 (pcc029) TTGGCTATGAAAATGAAATCACTT -6 relative to the kpfA start codon
kpf-4 (pcc030) TTATCCGCCTCGAGCCGTC +31 relative to the kpfA stop codon
kpg-1 (pcc015) CACCATGAAATCTGTTTTTCGTCTAC -4 relative to the kpgD start codon
kpg-2 (pcc016) CTAGTTATACTCCAGGGCGAAAGTCA on the kpgD stop codon
kpg-3 (pcc031) ATGAAAAAACAACCTCGCTTTA on the kpgA start codon
kpg-4 (pcc032) TGACAATTAACACATAAGCTTTCTG HindIII +73 relative to the kpgA stop codon
mrk-1 (mrkD-N) GGGACAGCAAACAACAAA -27 relative to the mrkD start codon
mrk-2 (SL0080) CGCATTAATCGTACGTCA +4 relative to the mrkD stop codon
mrk-3 (mrkA-RTF) GGTAAGTAATTTCGTAAGTCGCGT -26 relative to the mrkA stop codon mrk-4 (mrkA-RTR) CTCTGACAAGGAAATGGCAATG -19 relative to the mrkA start codon
fim-1 (pcc074) TCGCTTCCCGCTGCAGGCC -111 relative to the fimH start codon
fim-2 (SL0078) GAACGCCTATCCCCTGCGCC -168 relative to the fimH stop codon
fim-3 (pcc051) GAAGGCACAACGGATCCCAA BamHI -59 relative to the fimA start codon
fim-4 (pcc052) CTTCCTTGCCTGACTCGGGT +21 relative to the fimA stop codon
Table 6.3. (continued)
Primer Sequence (5’--- 3’) a Enzyme cleaved Complementary position
pcc053 CAAGGAGAAACATATGAAAAAAACGA NdeI -13 relative to the kpcA start codon
pcc056 CGATCAAACAGATCTTTCCACCA BglII +93 relative to the kpcD stop codon
pcc081 GGCGGGAGGCAGACAGCGAC +281 relative to the kpcI start codon
pcc082 TGCGGCGAGGGTGTAGTCAGGAG -103 relative to the kpcA stop codon
pcc149 ATGCCAGTAAAACGAAAACACC on the kpcA start codon
pcc150 CTTTACATTCTGGCACTAATTGTGTG +2 relative to the kpcI196 stop codon
YCY001 GGATCCGTGGTGAGTTCAGGAGAAAATTTGG BamHI -83 relative to the kpcA start codon YCY002 AGATCTATGTAAAGTAGTATCAGAAAAATTTAGCAAAG BglII -374 relative to the kpcA start codon pcc167 CAATCCGGTTCGTTATTTCGACATCGTTCAAAGG -42 relative to the fimA start codon pcc169 GCCAAACATGAATTCGATAACACCCGCGAATAC +93 relative to the fimK stop codon pcc202 GAATTCAAGGAGAAAGGTATGAAAAAAACGA EcoRI -12 relative to the kpcA start codon pcc223 AGATCTCCAGCCAGCCGGATTTTAATAAC BglII +31 relative to the kpcC stop codon pcc183 TTAAGGAGCAAGGCTTATGCCAGTAAAACGAAAAC -16 relative to the kpcI start codon
wc07 AGATCCTACAAATGGGGCGTGA -306 relative to the mrkH start codon
wc08 GGCCTGTTCACCTATTACGTTG +136 relative to the mrkJ stop codon
wc09 CTCTTTTTGCGCTTGGCTTCTA -5 relative to the mrkH stop codon
wc10 TTCTCCCGGTAAATCAGTAGCG +4 relative to the mrkI stop codon
Table 6.3. (continued)
Primer Sequence (5’--- 3’) a Enzyme cleaved Complementary position
pcc212 GGATCCAAGGGATGCATATGACAGAGGG BamHI -5 relative to the mrkH start codon pcc213 AAGCTTACTGTCCAAGGTTGTCAGATTCTC HindIII +14 relative to the mrkH stop codon pcc335 GGATCCATGCATGACAATAGCGGTGTCGATAAAGG BamHI +244 relative to the mrkH start codon pcc336 AAGCTTGCTGCACTACCTGCAGGCATTC HindIII +316 relative to the mrkH start codon pcc216 GGATCCATGATCAAGAAGACAACGGAAATTG BamHI on the ydeH start codon
pcc217 AAGCTTAAACTCGGTTAATCACATTTTGTTC HindIII +4 relative to the ydeH stop codon pcc224 GAAACGGTTTATCGCTACGCGGCCGAAGAATTTATCATTATTG +598 relative to the ydeH start codon pcc225 CAATAATGATAAATTCTTCGGCCGCGTAGCGATAAACCGTTTC +640 relative to the ydeH start codon pcc337 CTTATTAATTAAATTGAAAATAATCGTCTGGGCC +165 relative to the mrkI start codon pcc338 GAGATTTCTGCCATCAGAATCGTCGATCTG +165 relative to the mrkI start codon pcc339 GCGATTTCTGCCATCAGAATCGTCGATCTG +165 relative to the mrkI start codon
pcc281 CCGGAGACAGGTAAACGTTCGCATCGCT +181 relative to the mrkA strat codon
pcc282 AGCAGCCTGGCAGTTAGAGACGTCAATGGTG +270 relative to the mrkA strat codon pcc273 AGATCTTTGACGCCGATAGCACCAG HindIII -188 relative to the mrkA start codon pcc324 GGATCCGCGGTTGCCATTGCTGCAGAG BamHI +38 relative to the mrkA start codon pcc319 GGATCCAGACAAAATGGAGGGAACCCTATC BamHI -376 relative to the mrkH start codon pcc320 GGATCCTTACTGGTCTTTATCGTTCCCTCTG BamHI +29 relative to the mrkH start codon
Primer Sequence (5’--- 3’) a Enzyme cleaved Complementary position
RT-PCR
a1 (wc05) GGATCCGCCTGGGTGCCCTTTTTCC BamHI -640 relative to the mrkH start codon
a2 (wc03) CCCTCTGTCATATGCATCCCTTG +11 relative to the mrkH start codon
b1 (pcc275) CACCCTGGATAACGCTAATGAAGAGAG -150 relative to the mrkI start codon b2 (pcc276) CATAACTCAGACGGGTGGCATTTTC +100 relative to the mrkI start codon c1 (pcc277) GAATCAGCGTATTGCCGCTCTCC -177 relative to the mrkJ start codon
c2 (pcc256) CATTCCACCGCGACCAGAGTAC +110 relative to the mrkJ start codo
d1 (wc13) ATGACCAAAACGCCGAATCTTA +439 relative to the mrkH start codon
d2 (wc09) CTCTTTTTGCGCTTGGCTTCTA -5 relative to the mrkH stop codon
e1 (wc17) GGATCCGGGCTGTGCAGAGAGTTGATAAA BamHI +265 relative to the mrkI start codon e2 (pcc280) AACCGTTTTATGAGCAATGCCGAG +495 relative to the mrkI start codon
f1 (pcc278) CCATATCCTGAACCTGTTGCGCC +273 relative to the mrkJ start codon
f2 (pcc279) CGGACTCTTTGCGCATCAGGTG +532 relative to the mrkJ start codon
a The nucleotide sequence recognized by each restriction enzyme listed are underlined.
Table 6.3. (continued)
References
1. Aberg, A., V. Shingler, and C. Balsalobre. 2006. (p)ppGpp regulates type 1 fimbriation of Escherichia coli by modulating the expression of the
site-specific recombinase FimB. Mol Microbiol 60:1520-33.
2. Aberg, V., and F. Almqvist. 2007. Pilicides-small molecules targeting bacterial virulence. Org Biomol Chem 5:1827-34.
3. Aberg, V., E. Fallman, O. Axner, B. E. Uhlin, S. J. Hultgren, and F.
Almqvist. 2007. Pilicides regulate pili expression in E. coli without affecting the functional properties of the pilus rod. Mol Biosyst 3:214-8.
4. Abraham, J. M., C. S. Freitag, J. R. Clements, and B. I. Eisenstein. 1985.
An invertible element of DNA controls phase variation of type 1 fimbriae of Escherichia coli. Proc Natl Acad Sci U S A 82:5724-7.
5. Abremski, K. E., and R. H. Hoess. 1992. Evidence for a second conserved arginine residue in the integrase family of recombination proteins. Protein Eng 5:87-91.
6. Achenbach, L. A., and W. Yang. 1997. The fur gene from Klebsiella
pneumoniae: characterization, genomic organization and phylogenetic analysis.
Gene 185:201-7.
7. Alberti, S., D. Alvarez, S. Merino, M. T. Casado, F. Vivanco, J. M. Tomas, and V. J. Benedi. 1996. Analysis of complement C3 deposition and
degradation on Klebsiella pneumoniae. Infect Immun 64:4726-32.
8. Allen, B. L., G. F. Gerlach, and S. Clegg. 1991. Nucleotide sequence and functions of mrk determinants necessary for expression of type 3 fimbriae in Klebsiella pneumoniae. J Bacteriol 173:916-20.
9. Alm, R. A., A. J. Bodero, P. D. Free, and J. S. Mattick. 1996. Identification of a novel gene, pilZ, essential for type 4 fimbrial biogenesis in Pseudomonas aeruginosa. J Bacteriol 178:46-53.
10. Alsteens, D., E. Dague, C. Verbelen, G. Andre, V. Dupres, and Y. F.
Dufrene. 2009. Nanoscale imaging of microbial pathogens using atomic force microscopy. Wiley Interdiscip Rev Nanomed Nanobiotechnol 1:168-80.
11. Alvarez, D., S. Merino, J. M. Tomas, V. J. Benedi, and S. Alberti. 2000.
Capsular polysaccharide is a major complement resistance factor in lipopolysaccharide O side chain-deficient Klebsiella pneumoniae clinical isolates. Infect Immun 68:953-5.
12. Amikam, D., and M. Y. Galperin. 2006. PilZ domain is part of the bacterial c-di-GMP binding protein. Bioinformatics 22:3-6.
13. Andersson, M., O. Axner, F. Almqvist, B. E. Uhlin, and E. Fallman. 2008.
Physical properties of biopolymers assessed by optical tweezers: analysis of folding and refolding of bacterial pili. Chemphyschem 9:221-35.
14. Andrews, S. C., A. K. Robinson, and F. Rodriguez-Quinones. 2003.
Bacterial iron homeostasis. FEMS Microbiol Rev 27:215-37.
15. Arakawa, Y., R. Wacharotayankun, T. Nagatsuka, H. Ito, N. Kato, and M.
Ohta. 1995. Genomic organization of the Klebsiella pneumoniae cps region responsible for serotype K2 capsular polysaccharide synthesis in the virulent strain Chedid. J Bacteriol 177:1788-96.
16. Archibald, F. S., and I. Fridovich. 1983. Oxygen radicals, oxygen toxicity and the life of microorganisms. Acta Med Port 4:101-12.
17. Baga, M., M. Goransson, S. Normark, and B. E. Uhlin. 1985.
Transcriptional activation of a Pap pilus virulence operon from uropathogenic Escherichia coli. Embo J 4:3887-93.
18. Baga, M., M. Norgren, and S. Normark. 1987. Biogenesis of E. coli Pap pili:
PapH, a minor pilin subunit involved in cell anchoring and length modulation.
Cell 49:241-51.
19. Baichoo, N., and J. D. Helmann. 2002. Recognition of DNA by Fur: a reinterpretation of the Fur box consensus sequence. J Bacteriol 184:5826-32.
20. Balows, A., and B. Duerden. 1998. Topley & Wilson’s microbiology and microbial infections, 9th ed., vol. 2. Oxford University Press, Oxford, United Kingdom.
21. Bann, J. G., J. S. Pinkner, C. Frieden, and S. J. Hultgren. 2004. Catalysis of protein folding by chaperones in pathogenic bacteria. Proc Natl Acad Sci U S A 101:17389-93.
22. Barends, T. R., E. Hartmann, J. J. Griese, T. Beitlich, N. V. Kirienko, D. A.
Ryjenkov, J. Reinstein, R. L. Shoeman, M. Gomelsky, and I. Schlichting.
2009. Structure and mechanism of a bacterial light-regulated cyclic nucleotide phosphodiesterase. Nature 459:1015-8.
23. Bartlett, J. G., P. O'Keefe, F. P. Tally, T. J. Louie, and S. L. Gorbach. 1986.
Bacteriology of hospital-acquired pneumonia. Arch Intern Med 146:868-71.
24. Bateman, A., L. Coin, R. Durbin, R. D. Finn, V. Hollich, S. Griffiths-Jones, A. Khanna, M. Marshall, S. Moxon, E. L. Sonnhammer, D. J. Studholme, C. Yeats, and S. R. Eddy. 2004. The Pfam protein families database. Nucleic Acids Res 32:D138-41.
25. Baumler, A. J., R. M. Tsolis, F. A. Bowe, J. G. Kusters, S. Hoffmann, and F.
Heffron. 1996. The pef fimbrial operon of Salmonella typhimurium mediates adhesion to murine small intestine and is necessary for fluid accumulation in
the infant mouse. Infect Immun 64:61-8.
26. Baumler, A. J., R. M. Tsolis, and F. Heffron. 1996. The lpf fimbrial operon mediates adhesion of Salmonella typhimurium to murine Peyer's patches. Proc Natl Acad Sci U S A 93:279-83.
27. Benach, J., S. S. Swaminathan, R. Tamayo, S. K. Handelman, E.
Folta-Stogniew, J. E. Ramos, F. Forouhar, H. Neely, J. Seetharaman, A.
Camilli, and J. F. Hunt. 2007. The structural basis of cyclic diguanylate signal transduction by PilZ domains. Embo J 26:5153-66.
28. Birck, C., M. Malfois, D. Svergun, and J. Samama. 2002. Insights into signal transduction revealed by the low resolution structure of the FixJ response regulator. J Mol Biol 321:447-57.
29. Blomfield, I. C. 2001. The regulation of pap and type 1 fimbriation in Escherichia coli. Adv Microb Physiol 45:1-49.
30. Blomfield, I. C., P. J. Calie, K. J. Eberhardt, M. S. McClain, and B. I.
Eisenstein. 1993. Lrp stimulates phase variation of type 1 fimbriation in Escherichia coli K-12. J Bacteriol 175:27-36.
31. Blomfield, I. C., M. S. McClain, J. A. Princ, P. J. Calie, and B. I.
Eisenstein. 1991. Type 1 fimbriation and fimE mutants of Escherichia coli K-12. J Bacteriol 173:5298-307.
32. Blumer, C., A. Kleefeld, D. Lehnen, M. Heintz, U. Dobrindt, G. Nagy, K.
Michaelis, L. Emody, T. Polen, R. Rachel, V. F. Wendisch, and G. Unden.
2005. Regulation of type 1 fimbriae synthesis and biofilm formation by the transcriptional regulator LrhA of Escherichia coli. Microbiology 151:3287-98.
33. Boddicker, J. D., R. A. Anderson, J. Jagnow, and S. Clegg. 2006.
Signature-tagged mutagenesis of Klebsiella pneumoniae to identify genes that influence biofilm formation on extracellular matrix material. Infect Immun 74:4590-7.
34. Boehm, A., M. Kaiser, H. Li, C. Spangler, C. A. Kasper, M. Ackermann, V.
Kaever, V. Sourjik, V. Roth, and U. Jenal. 2010. Second
messenger-mediated adjustment of bacterial swimming velocity. Cell 141:107-16.
35. Boulette, M. L., and S. M. Payne. 2007. Anaerobic regulation of Shigella flexneri virulence: ArcA regulates Fur and iron acquisition genes. J Bacteriol 189:6957-67.
36. Braaten, B. A., X. Nou, L. S. Kaltenbach, and D. A. Low. 1994.
Methylation patterns in pap regulatory DNA control pyelonephritis-associated pili phase variation in E. coli. Cell 76:577-88.
37. Brisse, S., C. Fevre, V. Passet, S. Issenhuth-Jeanjean, R. Tournebize, L.
Diancourt, and P. Grimont. 2009. Virulent clones of Klebsiella pneumoniae:
identification and evolutionary scenario based on genomic and phenotypic characterization. PLoS One 4:e4982.
38. Bryan, A., P. Roesch, L. Davis, R. Moritz, S. Pellett, and R. A. Welch. 2006.
Regulation of type 1 fimbriae by unlinked FimB- and FimE-like recombinases in uropathogenic Escherichia coli strain CFT073. Infect Immun 74:1072-83.
39. Burmolle, M., M. I. Bahl, L. B. Jensen, S. J. Sorensen, and L. H. Hansen.
2008. Type 3 fimbriae, encoded by the conjugative plasmid pOLA52, enhance biofilm formation and transfer frequencies in Enterobacteriaceae strains.
Microbiology 154:187-95.
40. Cao, J., M. R. Woodhall, J. Alvarez, M. L. Cartron, and S. C. Andrews.
2007. EfeUOB (YcdNOB) is a tripartite, acid-induced and CpxAR-regulated, low-pH Fe2+ transporter that is cryptic in Escherichia coli K-12 but functional in E. coli O157:H7. Mol Microbiol 65:857-75.
41. Carpenter, B. M., J. M. Whitmire, and D. S. Merrell. 2009. This is not your mother's repressor: the complex role of fur in pathogenesis. Infect Immun 77:2590-601.
42. Carpenter, J. L. 1990. Klebsiella pulmonary infections: occurrence at one medical center and review. Rev Infect Dis 12:672-82.
43. Cegelski, L., G. R. Marshall, G. R. Eldridge, and S. J. Hultgren. 2008. The biology and future prospects of antivirulence therapies. Nat Rev Microbiol 6:17-27.
44. Chang, A. C., and S. N. Cohen. 1978. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol 134:1141-56.
45. Chang, A. L., J. R. Tuckerman, G. Gonzalez, R. Mayer, H. Weinhouse, G.
Volman, D. Amikam, M. Benziman, and M. A. Gilles-Gonzalez. 2001.
Phosphodiesterase A1, a regulator of cellulose synthesis in Acetobacter xylinum, is a heme-based sensor. Biochemistry 40:3420-6.
46. Chang, B. J., Y. J. Huang, C. H. Chan, L. Hsu, H. L. Peng, H. Y. Chang, T.
R. Yew, C. H. Liu, and S. Chi. 2006. Measurement of the adhesive force between a single Klebsiella pneumoniae type 3 fimbria and collagen IV using optical tweezers. Biochem Biophys Res Commun 350:33-8.
47. Chang, H. Y., J. H. Lee, W. L. Deng, T. F. Fu, and H. L. Peng. 1996.
Virulence and outer membrane properties of a galU mutant of Klebsiella pneumoniae CG43. Microb Pathog 20:255-61.
48. Chen, Y. T., H. Y. Chang, Y. C. Lai, C. C. Pan, S. F. Tsai, and H. L. Peng.
2004. Sequencing and analysis of the large virulence plasmid pLVPK of
Klebsiella pneumoniae CG43. Gene 337:189-98.
49. Chen, Y. Y., C. C. Wu, J. L. Hsu, H. L. Peng, H. Y. Chang, and T. R. Yew.
2009. Surface rigidity change of Escherichia coli after filamentous bacteriophage infection. Langmuir 25:4607-14.
50. Cheng, D. L., Y. C. Liu, M. Y. Yen, C. Y. Liu, and R. S. Wang. 1991. Septic metastatic lesions of pyogenic liver abscess. Their association with Klebsiella pneumoniae bacteremia in diabetic patients. Arch Intern Med 151:1557-9.
51. Cheng, H. P., and G. C. Walker. 1998. Succinoglycan production by Rhizobium meliloti is regulated through the ExoS-ChvI two-component regulatory system. J Bacteriol 180:20-6.
52. Cheng, H. Y., Y. F. Chen, and H. L. Peng. 2010. Molecular characterization of the PhoPQ-PmrD-PmrAB mediated pathway regulating polymyxin B resistance in Klebsiella pneumoniae CG43. J Biomed Sci 17:60.
53. Cheng, H. Y., Y. S. Chen, C. Y. Wu, H. Y. Chang, Y. C. Lai, and H. L. Peng.
2010. RmpA regulation of capsular polysaccharide biosynthesis in Klebsiella pneumoniae CG43. J Bacteriol 192:3144-58.
54. Chessa, D., M. G. Winter, M. Jakomin, and A. J. Baumler. 2009.
Salmonella enterica serotype Typhimurium Std fimbriae bind terminal alpha(1,2)fucose residues in the cecal mucosa. Mol Microbiol 71:864-75.
55. Chorell, E., J. S. Pinkner, G. Phan, S. Edvinsson, F. Buelens, H. Remaut, G.
Waksman, S. J. Hultgren, and F. Almqvist. 2010. Design and synthesis of C-2 substituted thiazolo and dihydrothiazolo ring-fused 2-pyridones: pilicides with increased antivirulence activity. J Med Chem 53:5690-5.
56. Christen, M., B. Christen, M. G. Allan, M. Folcher, P. Jeno, S. Grzesiek, and U. Jenal. 2007. DgrA is a member of a new family of cyclic diguanosine monophosphate receptors and controls flagellar motor function in Caulobacter crescentus. Proc Natl Acad Sci U S A 104:4112-7.
57. Christen, M., B. Christen, M. Folcher, A. Schauerte, and U. Jenal. 2005.
Identification and characterization of a cyclic di-GMP-specific phosphodiesterase and its allosteric control by GTP. J Biol Chem 280:30829-37.
58. Chuang, Y. P., C. T. Fang, S. Y. Lai, S. C. Chang, and J. T. Wang. 2006.
Genetic determinants of capsular serotype K1 of Klebsiella pneumoniae causing primary pyogenic liver abscess. J Infect Dis 193:645-54.
59. Clatworthy, A. E., E. Pierson, and D. T. Hung. 2007. Targeting virulence: a new paradigm for antimicrobial therapy. Nat Chem Biol 3:541-8.
60. Clegg, S., B. K. Purcell, and J. Pruckler. 1987. Characterization of genes encoding type 1 fimbriae of Klebsiella pneumoniae, Salmonella Typhimurium,
and Serratia marcescens. Infect Immun 55:281-7.
61. Colodner, R., R. Raz, B. Chazan, and W. Sakran. 2004. Susceptibility pattern of extended-spectrum beta-lactamase producing bacteria isolated from inpatients to five antimicrobial drugs in a community hospital in Northern Israel. Int J Antimicrob Agents 24:409-10.
62. Connell, I., W. Agace, P. Klemm, M. Schembri, S. Marild, and C.
Svanborg. 1996. Type 1 fimbrial expression enhances Escherichia coli virulence for the urinary tract. Proc Natl Acad Sci U S A 93:9827-32.
63. Cortes, G., N. Borrell, B. de Astorza, C. Gomez, J. Sauleda, and S. Alberti.
2002. Molecular analysis of the contribution of the capsular polysaccharide and the lipopolysaccharide O side chain to the virulence of Klebsiella pneumoniae in a murine model of pneumonia. Infect Immun 70:2583-90.
64. Cotter, P. A., and S. Stibitz. 2007. c-di-GMP-mediated regulation of virulence and biofilm formation. Curr Opin Microbiol 10:17-23.
65. Cusumano, C. K., and S. J. Hultgren. 2009. Bacterial adhesion--a source of alternate antibiotic targets. IDrugs 12:699-705.
66. Dahl, M. K., T. Msadek, F. Kunst, and G. Rapoport. 1991. Mutational analysis of the Bacillus subtilis DegU regulator and its phosphorylation by the DegS protein kinase. J Bacteriol 173:2539-47.
67. Darfeuille-Michaud, A., C. Jallat, D. Aubel, D. Sirot, C. Rich, J. Sirot, and B. Joly. 1992. R-plasmid-encoded adhesive factor in Klebsiella pneumoniae strains responsible for human nosocomial infections. Infect Immun 60:44-55.
68. De Lorenzo, V., M. Herrero, F. Giovannini, and J. B. Neilands. 1988. Fur (ferric uptake regulation) protein and CAP (catabolite-activator protein) modulate transcription of fur gene in Escherichia coli. Eur J Biochem 173:537-46.
69. Delany, I., G. Spohn, A. B. Pacheco, R. Ieva, C. Alaimo, R. Rappuoli, and V. Scarlato. 2002. Autoregulation of Helicobacter pylori Fur revealed by functional analysis of the iron-binding site. Mol Microbiol 46:1107-22.
70. Di Martino, P., Y. Bertin, J. P. Girardeau, V. Livrelli, B. Joly, and A.
Darfeuille-Michaud. 1995. Molecular characterization and adhesive
properties of CF29K, an adhesin of Klebsiella pneumoniae strains involved in nosocomial infections. Infect Immun 63:4336-44.
71. Di Martino, P., N. Cafferini, B. Joly, and A. Darfeuille-Michaud. 2003.
Klebsiella pneumoniae type 3 pili facilitate adherence and biofilm formation on abiotic surfaces. Res Microbiol 154:9-16.
72. Di Martino, P., V. Livrelli, D. Sirot, B. Joly, and A. Darfeuille-Michaud.
1996. A new fimbrial antigen harbored by CAZ-5/SHV-4-producing Klebsiella
pneumoniae strains involved in nosocomial infections. Infect Immun 64:2266-73.
73. Dodson, K. W., F. Jacob-Dubuisson, R. T. Striker, and S. J. Hultgren. 1993.
Outer-membrane PapC molecular usher discriminately recognizes periplasmic chaperone-pilus subunit complexes. Proc Natl Acad Sci U S A 90:3670-4.
74. Doud, M. S., R. Grimes-Zeppegno, E. Molina, N. Miller, D. Balachandar, L. Schneper, R. Poppiti, and K. Mathee. 2009. A k2A-positive Klebsiella pneumoniae causes liver and brain abscess in a Saint Kitt's man. Int J Med Sci
74. Doud, M. S., R. Grimes-Zeppegno, E. Molina, N. Miller, D. Balachandar, L. Schneper, R. Poppiti, and K. Mathee. 2009. A k2A-positive Klebsiella pneumoniae causes liver and brain abscess in a Saint Kitt's man. Int J Med Sci