Chapter 1 Introduction
1.3 Promoters for cancer gene therapy
1.3.2 Tumor related promoters
Tumor related promoters including tumor microenvironment-related promoters and tumor vasculature-related promoters. The former is responding to the tumor microenvironment and physiology such as hypoxia and glucose regulation. Many genes are transcriptionally upregulated in response to hypoxia which are mediated by the inducible transcription complex, hypoxia-inducible factor-1 (HIF-1). HIF-1 binds to hypoxia response elements (HREs) within these genes and activates the downstream gene expression. Therefore, HREs may be used to drive transgene expression specifically within tumor hypoxia areas. It is extremely important to target this population of cells since they are highly resistant
to other forms of treatment, such as radiotherapy and chemotherapy [44]. In addition to oxygen starvation, tumors can also be deprived of glucose that leads to the increased expression of genes involved in glucose metabolism. The promoters of these genes are also used to drive transgene expression specifically within a tumor [45, 46].
Another tumor related promoters are tumor vasculature-related promoters which are more active in the tumor vasculature than normal one. It has been reported that genes are upregulated in proliferating endothelium cells of tumor blood vessels [47]. The endothelial-specific kinase inserts domain receptor (KDR/flk-1) and E-selectin promoter have been indicated to enhance transgene expression in tumor endothelium [48]. Recently, it was demonstrated that the KDR/flk-1 promoter is not only endothelial cell-specific, but also actives in human ovarian cancer cell lines [49].
The use of cancer specific or tumor related promoters is promised to improve the safety of cancer gene therapy. However, the activities of these promoters are much weaker than the current benchmark CMV promoter [32]. The herapeutic efficacy might be limited when employing these kind of weak promoters.
1.4 Activities of NF-κB, HIF-1, and CREB in cancer
progression and therapy
1.4.1 Transcription factor binding sites for expression
Eukaryotic transcriptional regulatory factors are conducted synergistically by multiple transcriptional regulatory factors [50]. These factors can bind to the promoter regions called transcription factor binding sites (TFBSs). TFBSs are usually short (about 5-15 base-pairs) and they are frequently degenerate sequence motifs [51]. The sequence degeneracy of TFBSs has been selected through evolution and is beneficial, because it confers different levels of activity upon different promoters, causing certain genes in specific cells to be transcribed at higher levels than other cells [51]. Although the sequences of TFBSs are degenerated, they still have consensus sequences, such as NF-κB element consensus sequence 5’-GGGPuNNPyPyCC-’3, which can be recognized by specific transcription factors. The orientations and functions of TFBSs are not absolutely correlated. The positions within a promoter can be varied in yeast, and in higher eukaryotes they can be placed upstream, downstream, or in the introns of the genes which they regulate. In addition, they can be placed close to or far away from regulated genes [51]. When one transcription factor interacts with other transcription factors and results in high levels of a transcriptional activation, it is called “synergism or synergistic effect”. This phenomenon usually forms a ternary protein-protein-DNA complex which leads to altered DNA conformation and allowed other factors to bind on [52-54]. Interactions between two factors may be
direct or mediated by co-activators [40, 52]. For example, the coordination of c-Rel and ATF-1/CREB2 is mediated by p300/CREB-BP [53]. In some cases, two factors binding to DNA independently can still activate transcription synergistically [55-57].
A number of factors are known to bend the DNA structure and thus permit binding of other factors [58, 59]. For example, Fos and Jun can induce a corresponding alteration in the conformation of the DNA helix [59]. Furthermore, a variety of elements can contribute to promoter activity, but none is essential for all promoters [60]. Some transcription factors are specific in tissues and contributing to cell development [61]. Transcription factors play a major role in tumor progression. For example, NF-κB promotes cell cycle progression, regulates apoptosis, and facilitates cell adhesion [62]. Recently, many strategies have been used to enhance the potency of promoters needed to retain the tumor specificity in order to maintain potential therapeutic benefits. It is noticed that the transcription factors can recognize DNA sequence specifically and can be utilized in the promoter specificity. In next section, the roles and applications of NF-kB, HIF-1, and CREB in cancer progression and therapy will be discussed.
1.4.2 Nuclear factor-kappaB (NF-κB)
Nuclear factor-kappaB (NF-κB) is a common transcriptional factor that regulates many gene expressions. Many diseases are related to NF-κB, such as
cardiovascular diseases [63], muscular dystrophy [64], inflammatory diseases [65], and cancers [66]. In this section the relationship of NF-κB and cancers are discussed.
1.4.2.1 Biology of NF-κB
NF-κB was first found in B-lymphocytes [67] but NF-κB didn’t only restrict to B-lymphocytes. For example, the stimulation of NF-κB by lipopolysaccharide [68] or phorbol ester was observed in a T cell line [53] and a non-lymphoid cell line [69] [70]. NF-κB belongs to the Rel family transcriptional factors, including Rel-A (also known as p65), Rel-B, c-rel, p50/p105 and p52/p100 [71]. The mature DNA-binding forms of p105 and p100 are shortened forms called p50 and p52, respectively. Unlike most transcriptional factors, proteins of this family reside in the cytoplasm and must translocate into the nucleus to work [72]. All NF-κΒ proteins contain a highly conserved Rel-homology domain (RHD) that is responsible for DNA binding, dimerization, nuclear translocation and interaction with the IκΒ proteins. The IκΒ proteins, including IκΒα, β and ε, bind to NF-κΒ via ankyrin repeats and block its nuclear import and transcriptional activity [71].
Generally, NF-κB dimerization is the classical p50-p65 heterodimer which binds on the 5’-GGGANNYYCCC-3’ consensus sequence [40] to regulate gene expression.
NF-κB can regulate many gene expressions, such as cytokines/chemokines, cell
adhesion molecules, acute phase proteins, and cell-surface receptors, regulators of apoptosis and transcription factors.
1.4.2.2 NF-κB in cancer progression
The NF-κB family might act as tumorigenic transcription factors was first put forward upon the cloning of the p50/p105 subunit [73, 74] and analyzed its sequence. Sequence analysis revealed remarkable homology for over 300 amino acids at the amino-terminal end to the oncogene, v-rel. The v-rel is a potent transforming oncogene from the avian reticuloendotheliosis virus [75]. In many cancers, aberrant activation and nuclear localization of NF-κB is actually quite frequent but most often results from defects in the pathways regulating NF-κB [76, 77]. IκB kinase (IKK) can inhibit IκB resulting in enhancing NF-κB activation [76, 77]. Some oncogenesis are correlated with the levels of IkBα and IkBβ proteins and coincided with the activation of IKK that govern the destruction of IkB factors [78].
Other ways, the loss of negative feedback mechanisms, which inhibit the NF-κB response, can result in its aberrant activity. An example of this is the CYLD tumor suppressor gene, which is associated with a predisposition to familial cylindromatosis (tumors of skin appendages). Losses of CYLD can lead to NF-κB activation [79]. In addition, the microenvironment of a solid tumor frequently contains high levels of inflammatory cytokines and/or hypoxic conditions, which
both stimulate nuclear translocation of NF-κB [76, 77]. The constitutive activation of NF-κB also appears to have a role in cell proliferation. NF-κB prevent Hodgkin's lymphoma cells from undergoing apoptosis under stress conditions [80]. It was further shown that growth factors such as epithelial growth factor [81] and platelet-derived growth factor induce proliferation of tumor cells through activation of NF-κB [82]. NF-κB signaling was also shown to promote pheochromocytoma 12 (PC12) cells survivals by nerve growth factor ligand, TrkA [83]. Recently, research has indicated that NF-κB possesses the prosurvival and antiapoptotic functions [84].
Several gene products that negatively regulate apoptosis in tumor cells, including inhibitor of apoptosis proteins (IAPs) 1 and 2, X-linked IAP, cellular Fas-associated death domain-like interleukin-1β converting enzyme (FLICE)-like inhibitory protein (cFLIP), were shown to be controlled by NF-κB activation [84].
The production of angiogeneic factors, such as vascular endothelial growth factor (VEGF) and Interleukin-8 (IL-8) has been shown to be regulating by NF-κB activation. NF-κB expression was associated with VEGF expression and microvessel density in human colorectal cancer [85]. IL-8 also activate by NF-κB.
Bombesin (BBS)-like peptide treated PC-3 cell stimulated an NF-κB-dependent migration of human umbilical vascular endothelial cells in vitro by activating VEGF and IL-8[86]. These findings suggest that increased expression of NF-κB contributes to tumor angiogenesis in cancer.
1.4.3 Hypoxia-inducible-factors (HIFs)
Cancer cells always have a higher growth rate whereas their expansion relies on nutrient supply. Oxygen limitation is central in controlling neovascularization, glucose metabolism, survival and tumour spread. Hypoxia occurs when available oxygen falls below 5%, triggering a complex cellular and systemic adaptation mediated primarily through transcription by hypoxia-inducible factors (HIFs).
HIF-1α was first identified as a crucial regulator of erythropoietin expression inresponse to low oxygen [87]. HIF-2α and HIF-3α have also been described, with HIF-3α, also known as IPAS (inhibitory PAS domain protein), functioning as an inhibitor of transcription [88, 89].
1.4.3.1 Biology of HIFs
HIF was shown in vitro, in a variety of cell culture systems, to be activated at a cut-off point of about 5% oxygen (40 mmHg), and to progressively increase its activity with a decrease in oxygen gradient down to 0.2–0.1% oxygen (1.6–0.8 mmHg), close to anoxia. HIF belongs to the large family of basic-helix–loop–helix (bHLH) proteins and is a heterodimer of a constitutively expressed and stable HIF-1β subunit, and one of three oxygen-regulated HIF-α subunits (HIF-1α, HIF-2α or HIF-3α). HIF-1α and HIF-2α, complexed with the b-subunits ARNT and (more rarely) ARNT2, bind DNA at hypoxia response elements (HREs) [90, 91].
HIF subunits are continuously transcribed and translated, and their stability is regulated by oxygen availability. HIF activation is a multi-step process involving HIF-α stabilization, nuclear translocation, heterodimerization, transcriptional activation and interaction with other proteins [92, 93].
1.4.3.2 HIFs in cancer progression
HIF can induce a vast array of gene products controlling energy metabolism, neovascularization, survival, pHi and cell migration, and has become recognized as a strong promoter of tumor growth [94]. The chemokine receptor CXCR4, a major metastatic mediator, is upregulated by HIF [95]. In addition, metalloproteinases (MMPs) 2 and 9 are regulated by hypoxia [96]. Another key mediator of metastasis is lysyl oxidase which is also a HIF target strongly associated with hypoxia.
Inhibition of the lysyl oxidase blocks in vitro migration and in vivo metastasis from subcutaneous xenografts or after tail vein injection [97].HIF-1α is also associated with VEGF-C expression in invasive ductal carcinomas.
1.4.4 cAMP response-element binding protein (CREB)
cAMP response-element binding protein (CREB) has been found to mediate transcriptional responses to a variety of growth factor and stress signals. CREB regulate many gene expressions. Genome-wide studies put the number of putative
CREB target genes at about 5000, or nearly one-quarter of the human genome.
CREB or related factorswhoseaberrant expression is often associated with certain cancers [98]. In this section, the relationship between CREB and cancer will be discussed.
1.4.4.1 Biology of CREB
CREB is a member of the CREB/ATF-1 (activating transcription factor 1)/CREM (CRE modulator) transcription factor family that mediates cyclic AMP (cAMP), growth factor-dependent, and calcium-dependent gene expression through the cAMP response element [99]. CREB is a 43-kDa basic/leucine zipper (bZIP) transcription factor that is expressed at the RNA level in most tissues. CREB binds to the consensus octanucleotide CRE element (5’-TGANNTCA-3’) as a homodimer and heterodimers in conjunction with other members of the CREB/ATF superfamily of transcription factors [100]. In resting cells, CREB exists in the unphosphorylated state that is transcriptionally inactive but can still bind to DNA. Upon cell activation, CREB becomes phosphorylated, which induces its transcriptional activity by promoting its interaction with the 256-kDa co-activator protein CREB binding protein (CBP). CBP serves as a molecular bridge that allows CREB to recruit and stabilize the RNA polymerase II complex at the TATA box, leading to switch certain genes on or off.
1.4.4.2 CREB in cancer progression
A potential role for the CREB family in cellular transformation was first appreciated in clear-cell sarcomas of soft tissues (CCSST) [101]. CCSST is an unusual malignancy of adolescents and young adults that typically arises in the deep soft tissues of the lower extremities close to tendon, fascia, and aponeuroses [102]. CCSST is typified by a chromosomal t(12;22)(q13;q12) translocation resulting in a fusion between the Ewing sarcoma gene (EWSR1) and activating transcription factor 1 (ATF1) [63]. The EWS–ATF1 can enhance expression of numerous CREB target genes by functioning as a strong activator. Indeed, disrupting EWS–ATF1 activity appears sufficient to block cell proliferation and promote cell apoptosis [63, 103]. Virally encoded oncoproteins such as hepatitis B virus and human T-cell leukemia virus (HTLV-1) tax also influence CREB activity in their efforts to promote cellular transformation [104, 105]. Based on this evidence, CREB will appear to cooperate with other factors, either in the context of a fusion protein or as part of a complex with an oncoprotein, to induce transformation. But whether CREB alone is capable of promoting tumorigenesis remained unclear [98].
1.4.5 Transcription factors interaction in cancer progression
The activity of many inducible transcription factors, such as NF-κB, is regulated through their association with cellular co-activators [106] . Interaction with the co-activator CREB binding protein (CBP) appears to be necessary to optimize the transcriptional activity of NF-κB. The interaction of the p65 (Rel A) subunit of NF-κB with CBP involves the KIX region of CBP, which is the same region responsible for binding the transcriptionally active serine-133-phosphorylated form of CREB [107, 108]. In human germline (GL) Iγ1promoter, NF-κB interacts with CREB to enhance gene expression. The Human Iγ1 promoter has NF-κB binding sites and CREB sites; they are communicating with each other via direct or indirect interactions. When using EMSA to observe NF-κB and CREB, it was found that the co-activator p300 interacts with CREB and NF-κB [109].
1.5 Strategy
Specific expression of the therapeutic gene in target cells depends on the specific delivery or the specific promoter activity. Either one of the two systems can be improved to become completely specific therapy without side effects.
However, the both systems do not achieve the specific efficacy so far and the perfection of either system is extremely difficult. In this study we introduced a simple concept that the combination of partial specific delivery and partial specific promoter activity may achieve more specificity for target cells (Figure 1). Besides,
this strategy can be done in a rapid and convenient fashion. The first part in our study is to rapidly create a novel promoter based on the activities of transcription factors. The transcription factors which are important in cancer progression will be roughly assayed in several tumor or rapid-proliferating cells. The response elements with higher activities in tumor cells will be processed to create a novel mini-promoter. This transcription factor-based synthetic promoter (TSP) which consists of several kinds of response elements might be flexible and partial specific in tumor cells. The second part is to enhance the delivery efficiency of PEI by a convenient method of peptide absorption. The multi-functional peptide RGD-4C-HA possesses the ability of specific targeting and can absorb to PEI.
RGD-4C-HA contains RGD-4C sequence which was proved to specifically bind to integrin αvβ3 [110-112]. In addition RGD-4C-HA contains a negatively charged tail which can absorb to the positively charged PEI by electrostatic forces. This modification of PEI is rapid and convenient in laboratory compared to the complicated chemical coupling or modification of the functional groups.
RGD-4C-HA should improve the delivery efficiency and specificity of PEI for integrin αvβ3 expessing cells such as B16-F10 cells. The partial specific promoter and the partial specific delivery system can be developed in a rapid and convenient method as described above. Finally, the combination of the two systems should achieve more specificity than either system alone.
Chapter 2 Materials & Methods
2.1 Materials
2.1.1 Primers
Table 1: Primers used in this study Name Primer Sequence (5’to 3’)
5' TSP1
CGCGTGGGACTTTCCGCTGGGGACTTTCCGCTGGGGACTTTCC GCTGTGACGTCAGAGAG
3' TSP2
TCAGCTCTCTGACGTCACAGCGGAAAGTCCCCAGCGGAAAG TCCCCAGCGGAAAGTCCCA
5' TSP2
CTGACGTCAGAGAGCTGACGTCAGAGAGCTACGTGTGTGTA CGTGTGTGTACGTGAT
3' TSP1
CGATCACGTACACACACGTACACACACGTAGCTCTCTGACGT CAGCTCTCTGACG
The primers were purchased from commercial (MDBio, Taiwan, ROC, ROC). The binding sites of NF-kB (underlined), CREB (bold), and HIF-1 (dotted) were labeled.
2.1.2 Cell lines
Table 2: Cell lines used in this study
Cell line Description ATCC #
B16-F10 mouse melanoma cells CRL-6475 Balb/3T3 mouse embryo fibroblast cells CCL-163 HeLa human cervical carcinoma cells CCL-2
2.1.3 Plasmids
Table 3: Plasmids used in this study
Plasmid Description Source
pAAV-MCS With multiple cloning site
Stratagene, Cedar Creek, TX
pAAV-MCS-hrGFP
With humanized renilla green fluorescent protein
From Dr. Liao’s Lab
pAP-1-hrGFP
Containing 7 copies of AP-1 binding site
Stratagene, Cedar Creek, TX
pARE-hrGFP AmpR assay plasmid From Dr. Liao’s Lab
pAsRed2-N1 With red fluorescent protein
Becton Dickinson, Moutain View, CA
pCRII-hrGFP
Containing 7 copies of HIF-1 binding site
From Dr. Liao’s Lab
pCRE-hrGFP
Containing 4 copies of CREB binding site
Stratagene, Cedar Creek, TX
pD5-hrGFP With synthetic promoter From Dr. Liao’s Lab
pNF-κB-hrGFP Containing 5 copies of NF-κB binding site
Stratagene, Cedar Creek, TX
pNFAT-hrGFP
Containing 4 copies of NFAT binding site
Stratagene, Cedar Creek, TX
MZF-1-hrGFP
Containing 3 copies of MZF-1 binding site
From Dr. Liao’s Lab
2.1.4 Chemicals, enzymes, and reagents
Table 4: Chemicals, enzymes, and reagents used in this study
Chemical Company
100 bp DNA ladder
Protech, Taiwan, ROC
1kb DNA ladder Protech, Taiwan,
ROC
Albumin bovine Fraction V (BSA)
MP Biomedicals, Irvine, CA
Ampicillin
Amresco, Solon, Ohio
ApaI (restriction enzyme) Promega, USA
BamHI (restriction enzyme) Calcium chloride, dyhidrate J.T.Baker,
Phillipsburg, NJ
Coomssie Brilliant blue
Amresco, Solon, Ohio
Deoxy-nucleotide triphosphates (dNTP) Promega, USA
Dimethyl sulfoxide (DMSO)
MP Biomedicals, Irvine, CA
Disodium hydrogen phosphate anhydrous (Na2HPO4)
Scharlau, Barcelona, Spain
Dulbecco’s modified Eagle’s medium (DMEM)
Sigma, St. Louis,
Ethylenediaminetetraacetic acid (EDTA) Tedia, Fairfield, OH
Fetal bovine serum
Biological
Industries, Kibbutz Beit Haemek, Israel
Glycerol Showa, Tokyo,
Japan
Hydroboric acid (H3PO4)
Riedel-de Haën,
Luria Bertani (LB) agar
Amresco, Solon, Ohio
Luria Bertani (LB) broth
Scharlau, Barcelona, Spain
Methanol
Penicillin-streptomycin amphotericin B (PSA)
Biological
Sephacryl S-200
Sodium dihydrogenphosphate dihydrate (NaH2PO4． 2H2O)
Sodium hydrogen carbonate (NaHCO3)
MP Biomedicals,
T4 ligation buffer Epicentre, Madison,
WI
T4 polynucleotide kinase NEB, Hitchin, UK
Taq polymerase
BioKit, Taiwan, ROC
Taq DNA polymerase XL
Protech, Taiwan,
Tryptone CONDA, Spain
Tween 20
Yeast extract
Conda, Madrid, Spain
2.1.5 Antibodies
Table 5: Antibodies used in this study
Antibody Description Company
Anti-HA-fluorescein, high affinity (3F10)
Recognizing the HA peptide sequence [YPYDVPDYA] recognizing the mouse IgG
DakoCytomatio n, Glostrop, Denmark
2.1.6 Kits
Table 6: Kits used in this study
Kit Company Used in
NucleoBond PC100 Macherey-Nagel, DNA extraction
Duran, Germany SuperSignal West Pico
Chemiluminescent Substrate
Pierce, Rockford, IL
The substrate of HRP in dot blot
2.1.7 Buffers
Table 7: Buffers used in this study
Buffer Description Used in
1X PBS 137 mM NaCl, 10 mM Na2HPO4, 2.7 mM KCl, 1.8 mM KH2PO4, pH7.4
Cell culture
5% Blocking buffer
5%(w/v) non-fat powdered milk in 1X PBS buffer
Buffer S1 50 mM Tris-HCl, 10mM EDTA, 100μg/ml RNase A, pH8.0
Midi
preparation
Buffer S2 200 mM NaOH, 1% SDS Midi
preparation
Buffer S3 2.8 KAc, pH 5.1 Midi
preparation Buffer N2 100 mM Tris,15% ethanol, 900 mM KCl,
0.15% Triton X100, adjusted to pH 6.3 with H3PO4 EDTA-trypsin 2.5 g trypsin, 0.1 M EDTA (pH8.0) in 1L
1X PBS, pH7.4, 0.2 μm filtered
Cell culture
PBST 0.05% Tween 20 in 1X PBS Dot blot Solution I 50mM Tris-HCl, 10mM EDTA , 10mg/ml
RNase A, pH=8.0
Mini
preparation Solution II 0.2M NaOH, 1%（w/v）SDS Mini
preparation Solution III 2.8M potassium acetate, pH=5.1 Mini
preparation Staining buffer 1% BSA , 0.05% NaN3 in 1X PBS
Versene 0.2g EDTA in 1L 1X PBS Cell culture
2.1.8 Media
Table 8: Media used in this study
Media Description Used in
DMEM growth
1% tryptone, 0.5% yeast extract, 1%
NaCl
1% tryptone, 0.5% yeast extract, 1%
NaCl, 1.5% agar, 50μg/ml ampicillin
Bacteria culture
LB
(Luria-Bertani)/Ampi cillin broth
1% tryptone, 0.5% yeast extract, 1%
NaCl, 50μg/ml ampicillin
1% tryptone, 0.5% yeast extract, 1%
NaCl, 1.5% agar, 30μg/ml kanamycin
Bacteria culture
LB 1% tryptone, 0.5% yeast extract, 1% Bacteria
(Luria-Bertani)/Kana mycin broth
NaCl, 30μg/ml kanamycin culture
Opti-MEM I Medium without serum Cell culture
SOB broth
2% tryptone, 0.5% yeast extract, 0.05%
NaCl, %0.0186 KCl, 10mM MgCl2
Bacteria culture
2.1.9 Equipment
Table 9: Equipment used in this study
Equipment Company
–20°C low temperature refrigerator
Frigidaire, Pittsburgh, PA
–80°C low temperature refrigerator
Nuaire, Caerphilly
Centrifuge 5804 R
Eppendorf, Hamburg, Germany
DNA electrophoresis unit Gel Mate 2000 Toyobo, Japan
Dot-blot machine
Heating plate Firstek, Taiwan, ROC
Inverted research microscope, IX71
Olympus, Tokyo, Japan
Biological safety cabinet, Forma Class II, A2 Thermo, USA
Lead blocker
Orbital Shaking incubator OS1500R TKS
pH meter SP701 Suntex, Taiwan, ROC
Thermal cycler
Eppendorf, Hamburg, Germany
Uni-photo gel image system EZ lab, Taiwan, ROC
Water bath Firstek, Taiwan, ROC
2.2 Methods
2.2.1 Construction of transcription factor-based synthetic promoter (TSP)
The pD5-hrGFP was obtained by replacing the CMV promoter of
The pD5-hrGFP was obtained by replacing the CMV promoter of