Zebrafish animal models

4.1 Zebrafish as a valuable model to study hematopoiesis and leukemogenesis

Zebrafish has proven to be a useful vertebrate model in which to elucidate the molecular mechanisms of hematologic malignancies based on the high degree of genetic and morphological similarity in hematopoiesis between the zebrafish and human.^44,45 Over the last decade, studies using the zebrafish model have contributed to our understanding of vertebrate hematopoiesis, myelopoiesis, and leukemogenesis.^46-48 A high degree of similarity in the gene signatures of specific types of tumor cells in fish and humans have been demonstrated after comparisons of cancer-associated gene expression profiles indicating that the contributing genetic pathways leading to cancer are evolutionarily conserved.⁴⁹ Therefore, zebrafish can provide valuable knowledge about the mechanisms behind pathogenesis of leukemia.

Furthermore, zebrafish animal model offers obvious advantages as a result of its rapid external development, small size and optical transparency of the embryos, which are permeable to small molecules and drugs. As a result, chemical screenings have been successfully conducted by using appropriated zebrafish lines.⁵⁰ The unique advantage of in vivo imaging in zebrafish also helps to dissect the molecular pathways underlying tumor initiation, progression and metastasis.

4.2 Genome editing tools in zebrafish

The zebrafish is an affordable, efficient, and genetically modifiable vertebrate model for studying hematopoiesis and leukemogenesis when compared to the traditional mammalian models. In addition, many molecular methods and models have been established to facilitate both forward and reverse genetic studies in zebrafish. For example, the expression of proteins can be “knocked down” transiently in the embryos by morpholino antisense oligonucleotides (MO) and microRNA or permanently “knockouted” by using the recently developed transcription activator-like effector nucleases (TALEN) technology or clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 system.^51-59 Highly efficient Tol2 transgenic tool is also available for use in the study of hematopoiesis and leukemogenesis in zebrafish.^46,60 The advance in technology has significantly improved the genetic tractability in zebrafish. One of the main limitations in zebrafish model is that antibody markers for hematopoiesis are mostly not available. However, this lack of markers can be compensated in some cases by the use of fluorescent transgenic blood cell reporter lines to identify hematopoietic cell types in zebrafish.⁶¹

5. B cell immune profiles in ET patients

5.1 Increased B cells activation in ET patients

We have reported that activated B cells are increased in ET patients, and can facilitate platelet production mediated by cytokines, such as interleukin (IL)-1beta and IL-6 regardless JAK2V617F mutational status.⁶² We found that increased production of B cell-activating factor (BAFF) by granulocytes and monocytes up-regulates toll-like receptor 4 (TLR4) expression on B cells of ET patients and promotes B cell activation, which play a pathogenic role augmenting thrombocytosis in ET by producing IL-1beta and IL-6. However, whether CALR mutations are also associated with activated B cells in ET patients requires further study.

6. Aims of the study

6.1 To develop a rapid and sensitive screening tool for the detection of CALR mutations

6.2 To evaluate the clinical and prognostic significance of CALR mutations and JAK2/CALR co-mutations in Taiwanese ET patients

Although the clinical and prognostic significance of CALR mutations in Caucasian ET patients have been studied,^63,64 there is still a need to evaluate the clinical and prognostic significance of CALR mutations in Taiwanese ET patients. Besides, JAK2 and CALR co-mutations have been reported in a few MPN patients in several studies. With the use of a highly sensitive HRMA, we have identified higher frequency of JAK2 and CALR co-mutations in ET patients. We therefore want to evaluate the clinical and prognostic significance of JAK2/CALR co-mutations in Taiwanese ET patients.

6.3 To determine the B cell immune profiles in CALR mutated ET patients

We have reported that activated B cells are increased in ET patients, and can facilitate platelet production mediated by cytokines, such as interleukin (IL)-1β and IL-6 regardless JAK2V617F mutational status.⁶² The discovery of CALR mutations in JAK2/MPL-unmutated ET patients in December 2013 have prompted us to ask the question that whether increased B cell activation can also be found in ET with CALR mutations similar to that in JAK2V617F-mutated ET.^18,19,65

6.4 To investigate the molecular pathogenesis of CALR mutations using zebrafish animal models

Although the expression of CALR mutants resulted in pathogenic thrombocytosis in adult mice, whether CALR mutants may disrupt normal hematopoiesis during early development remains unknown. We aim to evaluate the pathophysiologic effects of mutant CALR during embryonic hematopoietic development and to test the therapeutic effects of JAK inhibitors on mutant CALR using the in vivo zebrafish model.

Chapter 2

High-resolution melting analysis as a rapid and sensitive screening tool for the detection of CALR mutations

1. Summary

Somatic CALR exon 9 mutations have recently been identified in patients with JAK2/MPL-unmutated myeloproliferative neoplasm, and have become an important clonal marker for the diagnosis of essential thrombocythemia (ET) and primary myelofibrosis. In the present study, we sought to use high-resolution melting analysis (HRMA) as a screening method for the detection of CALR mutations. 32 JAK2/MPL-unmutated ET patients were retrospectively enrolled and 8 healthy adults were used as wild-type control.

CALR exon 9 mutation was independently screened by HRMA with the CFX Connect real-time system and Sanger sequencing. TA-cloning was used to detect CALR exon 9 mutations in patients suspected to have low mutant allele burden. The maximal sensitivity of HRMA in identifying both CALR type 1 and type 2 mutants from patients’ genomic DNA was 2.5%. Twenty-two samples were found to have distinct melting curves from wild-type. The presence of CALR mutations in 16 of these 22 samples were confirmed by Sanger sequencing, while the other 6 samples were wild-type by sequencing. After TA-cloning, CALR mutations were detected in 5 of 6 patients from 1 (6%) of 16 clones to 1 (2%) of 50 clones. Therefore, HRMA identified CALR mutations in 21 (65.6%) of 32 ET patients compared to 16 (50%) patients by Sanger sequencing, with a false positive rate of 3% and no false negative. In conclusion, the HRMA developed in our system is a rapid and sensitive technique for the detection of CALR exon 9 mutations.

2. Introduction

hematopoietic stem cell disorder and includes polycythemia vera (PV), essential thrombocythemia (ET) and primary myelofibrosis (PMF).² ET is characterized by increased number of mature megakaryocytes in the bone marrow and sustained thrombocytosis in the peripheral blood. Although most ET patients have a normal life expectancy, some may encounter serious events such as thrombotic and hemorrhagic complications and leukemic transformation during their clinical course.³ The JAK2 V617F mutation was discovered in 2005, and has provided important diagnostic, therapeutic, and prognostic implications in MPNs. The frequency of JAK2 V617F mutation is over 90% in polycythemia vera (PV), and about 60% in ET and PMF.^5-7 Besides, MPL mutations are identified in about 4-5% of JAK2-unmutated ET and PMF patients.⁸ Following these seminal reports, other somatic mutations such as LNK, TET2 and DNMT3A have also been detected in patients with MPN.⁹ However, they are not mutually exclusive with JAK2 and MPL mutations and also not specific to patients with MPN.^9,10 Despite many somatic mutations have been identified in patients with ET, clonal molecular marker is still not identified in ~40% of ET patients.

Recently, a high frequency (around 49-88%) of somatic calreticulin (CALR) mutations was identified in patients with JAK2/MPL-unmutated patients with ET and PMF.18,19,32,66,67

Most CALR mutations in MPNs are heterozygous indels in exon 9 causing one base pair reading frameshift and resulted in the generation of a novel CALR protein C-terminus. The majority of the CALR exon 9 mutants were a 52 bp deletion of nt1172 to nt1223 (L367fs*46, type 1 mutation) and a 5 bp insertion of TTGTC (K385fs*47, type 2 mutation).

Rarely, CALR exon 9 point mutations have been reported in follicular lymphoma (E403X and E405Q),²¹ PMF (E379D)¹⁸ and chronic neutrophilic leukemia (E398D).²² Importantly, CALR mutations are not only mutually exclusive with JAK2 and MPL mutations, but they

are also infrequently detected in other myeloid neoplasms such as myelodysplastic syndrome, chronic myelomonocytic leukemia and atypical chronic myeloid leukemia.^18,19 These findings indicate that CALR mutations are quite specific for ET and PMF. Based on these discoveries, CALR mutations have been proposed to be included in the World Health Organization classification system for the molecular diagnosis of ET and PMF.²³ Therefore, the detection of CALR mutations with reliable and cost-effective methods in patients suspected to have ET or PMF is very important.

Several methods have been used to detect CALR exon 9 mutations including direct DNA sequencing, PCR followed by fragment analysis and immunostaining.18,19,26,27

Although fragment analysis has a relatively high sensitivity for CALR mutations detection, it cannot discriminate point mutation from wild-type sequence. High-resolution melting analysis (HRMA) is a closed-tube and PCR-based technique for the detection of gene polymorphism and mutations by measuring changes in the melting of a DNA duplex.⁶⁸ HRMA is a well-established method for the detection of or prescreening for mutations both in a routine molecular laboratory and in a research setting. For example, HRMA has shown high sensitivity and specificity for the detection of JAK2 V617F and JAK2 exon 12 mutations in patients with MPN.^69-71 Recently, the feasibility of using HRMA for the detection of CALR mutations in ET and persistent thrombocytosis has been reported using the LightCycler 480 platform (Roche Diagnostics).²⁸ In this study, we sought to assess HRMA for rapid and sensitive detection of CALR exon 9 mutations in ET using the CFX Connect real-time system (Bio-Rad Laboratories, Hercules, CA, USA).

3. Patients and Methods

3.1 Patient samples and DNA extraction

The screening for mutations in patients with hematologic neoplasms was approved by the Institutional Review Board of Mackay Memorial Hospital. 32 adult patients with JAK2/MPL-unmutated ET were retrospectively enrolled based on the 2008 World Health Organization classification and 8 healthy adults were used as wild-type control. Written informed consent was obtained from all patients. Patient genomic DNA was derived from bone marrow or peripheral blood by using EasyPure Genomic DNA Spin Kit (Bioman, Taipei, Taiwan).

3.2 Assay design and the HRMA technique

Oligonucleotide primers were designed by Primer3 software to flank all CALR exon 9 variants reported in MPN. The primers were used to amplify a 134 bp amplicon [GenBank:

NM_004343]: forward 5’ - GAAACAAATGAAGGACAAACAGG -3’, and reverse 5’ - CCTCATCCTCCTCATCCTCA -3’. PCR was performed in a 20 μl reaction volume containing precision melt supermix (Bio-Rad Laboratories, Hercules, CA, USA), 100 nM of each primer, and 25 ng genomic DNA. The 134 bp amplicon was run according to the following conditions: an initial denaturation step of 95˚C for 2 min, followed by 35 cycles of 95˚C for 10 sec, 58˚C for 30 sec, and 72˚C for 30 sec. After completion of amplification, DNA was heated at 95˚C for 30 sec, kept at 60˚C for 1 min, and then melted from 70 to 95˚C (increment 0.2˚C, dwell time 10 sec). The results were analyzed using the Bio-Rad Precision Melt Analysis software. Melting profiles were normalized, grouped and displayed as fluorescence-versus-temperature plots or subtractive difference plots (-df/dt vs T). All samples with distinguished melting curves from wild-type were confirmed by duplicate study. Both type 1 and type 2 CALR exon 9 mutant cDNA were obtained by direct DNA synthesis, and CALR wild-type cDNA was cloned from patient sample.

3.3 Sanger sequencing

All patients were also independently screened for CALR exon 9 mutations spanning codons 352–417 by Sanger sequencing on an ABI 3730 sequencer based on previously described method.¹⁹ All identified sequence variants were subjected to repeated bi-directional sequencing for confirmation. Mutations were identified using DNA Dynamo sequence analysis software (Blue Tractor Software Ltd, Conwy, UK). All patients had been screened for JAK2V617F and MPL exon 10 mutations as previously described.^7,9

3.4 Sensitivity of HRMA in detecting CALR type 1 and type 2 mutations

To study the sensitivity of the methodology, we serially diluted two plasmids carrying CALR type 1 and type 2 mutations with wild-type plasmid DNA in different concentrations (100% mutant, 50% mutant, 25% mutant, 10% mutant, 7.5% mutant, 5% mutant, 2.5%

mutant, 1.25% mutant, and 0% mutant). The sensitivity tests were carried out in triplicate samples. The sensitivity of HRMA was validated by serially diluting two patient samples carrying CALR type 1 and type 2 mutations with control DNA. Based on the relative peak areas of the mutant and wild-type PCR products, the mutant allele burden of these 2 patient samples was estimated to be ~50%. CALR type 1 and type 2 patients’ DNA were also serially diluted by wild-type DNA in different concentrations (50% mutant, 25% mutant, 12.5% mutant, 5% mutant, 3.75% mutant, 2.5% mutant, 1.25% mutant, 0.625% mutant, and 0% mutant). We did not evaluate the sensitivity of HRMA for other types of CALR mutations because they are less frequently detected.

3.5 TA-cloning

The PCR products of CALR exon 9 of 6 ET patients suspected to have a low allele burden mutant were purified using a EasyPure High Pure PCR clean-up Kit (Bioman, Taipei,

Taiwan) and cloned into a pGEMT-easy vector (Promega, Madison, CA, USA). We obtained at least 16 clones in each individual. The PCR product of each clone was checked on a 2% agarose gel by electrophoresis for the presence of mutant band. All selected clones were then sent for Sanger sequencing regardless the presence or absence of mutant band.

4. Results

4.1 Sensitivity of HRMA in identifying the CALR type 1 and type 2 mutants

We first evaluated the sensitivity of HRMA in detecting the CALR type 1 and type 2 mutant plasmid DNA with different concentrations of mutant DNA serially diluted by wild-type plasmid DNA. HRMA could distinguish CALR type 1 and type 2 mutants with the maximal sensitivity of 2.5% and 1.25%, respectively (Figure 2A and C). Whereas, the maximal sensitivity of Sanger sequencing for the detection of both CALR type 1 and type 2 mutants was at least 10% or higher (Figure 2B and D). Besides, the maximal sensitivity of HRMA was validated with 2 patient samples and was found to be 2.5% for both CALR type 1 and type 2 mutants (Figure 3A and B).

4.2 Detection of CALR exon 9 mutations in JAK2/MPL-unmutated ET patients

In this cohort of 32 ET patients, the normalized melting curves of 22 (68.8%) patient samples clearly showed a distinctive difference from that of wild-type group, and the representative normalized melting curves from 6 of the 22 patient samples were shown in Figure 4A. When the data were represented in difference plots, the individual nature of the mutant melting curves became more apparent as illustrated in Figure 4B. To determine the concordance between HRMA and Sanger sequencing, all 32 ET patients were also screening for CALR exon 9 mutations by Sanger sequencing. In the 22 ET patients with distinctive melting curves, Sanger sequencing could only detect CALR exon 9 mutations in

16 patients. All the remaining 6 patients with distinctive melting curves as shown on Figure 5A had wild-type CALR exon 9 sequences by Sanger sequencing. The other 10 patients were determined to have wild-type CALR by both HRMA and Sanger sequencing.

In the 6 patients with discordant results between HRMA and Sanger sequencing, we then performed TA-cloning to determine whether these 6 patients had low allele burden CALR mutations not detected by Sanger sequencing (Figure 5B and C).

After TA-cloning, CALR type 2 mutations were detected in 5 of 6 patients from 1 (6%) of 16 clones to 1 (2%) of 50 clones, and only 1 clone from each patient was tested positive for the CALR mutation (Figure 5). We did not identify CALR mutation in the last patient after screening for 100 clones. Therefore, HRMA identified CALR mutations in 21 (65.6%) of 32 ET patients compared to 16 (50%) by Sanger sequencing. The possible 3% false positive rate is low and no false negative was detected in our HRMA system.

In this study, 21 JAK2/MPL-unmutated ET patients were found to harbor 6 types of CALR exon 9 mutations: 5 type 1 (p.L367fs*46), 11 type 2 (p.K385fs*47), 1 type 3 (p.L367fs*48), 2 type 34 (p.K385fs*47), and 2 other types (p.L367fs*43 and p.E369fs*50).

All CALR exon 9 mutations are indels causing +1 base-pair reading frameshift, with type 2 (11/21, 52.4%) being the most prevalent mutational type. In these 21 patients with CALR mutations, the number of female patients was slightly higher than male patients (57% vs 43%) (Table 1).

5. Discussion

The identification of CALR mutations is important in the molecular diagnosis of MPN especially in JAK2/MPL-unmutated patients. In addition, CALR mutational status was

found to be one of the most significant risk factor for survival in PMF.³³ Sanger sequencing has been used to detect CALR exon 9 mutations in many studies, but it is rarely sensitive below a 10% mutant allele burden as illustrated in Figure 2B and D. Fragment analysis assay was also used and the sensitivity was estimated to be 5% or less for CALR exon 9 mutations.²⁷ Although fragment analysis assay is able to detect most indel mutations in CALR, it cannot discriminate point mutation from wild-type sequence.

Recently, Bilbao-Sieyro et al. showed that HRMA is a feasible method for the detection of CALR mutations using the LightCycler 480 platform.²⁸ The amplicon size of their primer sequences was 265 bp, and the limit of detection for CALR type 2 (K385fs*47) mutant was of 3%. However, the ideal amplicon length for HRMA is usually less than 250 bp. In this study, the HRMA primers with an amplicon size of 134 bp were designed and are capable of detecting common CALR exon 9 mutations in myeloid neoplasms with satisfactory sensitivity.

Based on the dilution studies using patients’ genomic DNA, the maximal sensitivity of our HRMA using CFX Connect real-time system for both CALR type 1 (L367fs*46) and type 2 (K385fs*47) mutants was of 2.5%. In addition to 16 CALR mutated samples that could be detected by both HRMA and Sanger sequencing, we were able to identify another 5 patients with low CALR mutant allele burden only by HRMA. In this situation, we used TA-cloning followed by Sanger sequencing to confirm the mutation suspected.

Alternatively, fragmented analysis may be used for mutation detection because it also has a better sensitivity than Sanger sequencing. We were not able to detect CALR mutation in 1 of the 6 patients after screening for 100 clones. It is likely that this patient might still have low allele burden CALR mutation which, by chance was missed by random selection of clones (Figure 5A). However, we counted the result as a possible 3% false positive rate to

avoid overestimation of our data. Importantly, no false negative was found in our HRMA system and this is critical in regard to its role as a screening tool.

HRMA developed in this study can be utilized for rapid, sensitive and reliable detection of CALR mutations. Although a total of 5 SNPs (rs201971744, rs143880510, rs370029737, rs374121178 and rs150264068) are reported in the region covered by our amplicon, the minor allele frequency of 3 of them is reported to be less than 0.01%. Therefore, the influence of these 5 SNPs to our HRMA system will likely be very small. Nevertheless, one limitation to this HRMA methodology is that it will not be able to identify the 2 CALR exon 9 point mutations reported in follicular lymphoma (E403X and E405Q) because they are not covered by our 134 bp amplicon. The frequency and significance of these 2 CALR point mutations in follicular lymphoma are currently not yet clear. Therefore, our HRMA methodology is suitable for use in patients suspected to have myeloid neoplasms especially ET and PMF. By using HRMA, we detected a total of 6 different types of CALR mutations in ET patients. All the CALR mutations detected in this study resulted in a +1 base-pair shifting in the reading frame and generated the characteristic novel peptide sequence in the C-terminus. All the CALR exon 9 indel mutations likely contribute to a similar, yet not clearly understood molecular pathogenesis in ET and PMF. In addition, the number of female patients was slightly higher than male patients (57% vs 43%) in our 21 ET patients with CALR mutations, and this has also been observed in other study.⁷²

HRMA, a close-tube method, is not only rapid as it is conducted immediately after PCR amplification, but is also cost effective because it can reduce the use of Sanger sequencing.

By using HRMA, a medium-throughput screening for CALR mutations is also possible.

Based on these advantages, our results clearly illustrated that HRMA is a more suitable and

sensitive method over Sanger sequencing for the screening of CALR mutations in both clinical and research settings. Nevertheless, in samples with distinct melting curves, complimentary Sanger sequencing is still required to determine their exact genotypes because the pattern of melting curves does not correlate with specific CALR mutational types.

In conclusion, we have shown that HRMA is a rapid, sensitive, reliable and cost effective method for the detection of CALR mutations. Because CALR mutations have important

In conclusion, we have shown that HRMA is a rapid, sensitive, reliable and cost effective method for the detection of CALR mutations. Because CALR mutations have important