Analysis of the CYP21A1P pseudogene: Indication of mutational diversity
and CYP21A2-like and duplicated CYP21A2 genes
Li-Ping Tsai
a,b, Ching-Feng Cheng
c,d, Shu-Hua Chuang
a, Hsien-Hsiung Lee
a,e,⇑ aDepartment of Pediatrics, Buddhist Tzu Chi General Hospital, Taipei Branch, Sindian, Taipei County 231, Taiwan
b
School of Medicine, Tzu Chi University, Hualien 970, Taiwan
c
Department of Pediatrics, Tzu Chi University, Hualien 970, Taiwan
d
Department of Medical Research, Tzu Chi General Hospital, Hualien 970, Taiwan
eSchool of Chinese Medicine, College of Chinese Medicine, China Medical University, Taichung 404, Taiwan
a r t i c l e
i n f o
Article history:
Received 16 November 2010
Received in revised form 3 February 2011 Accepted 4 February 2011 Available online xxxx Keywords: CYP21A1P XA CYP21A2-like gene Duplicated CYP21A2 genes PCR-based amplification Mutational detection
a b s t r a c t
The CYP21A1P gene downstream of the XA gene, carrying 15 deteriorated mutations, is a nonfunctional pseudogene that shares 98% nucleotide sequence homology with CYP21A2 located on chromosome 6p21.3. However, these mutations in the CYP21A1P gene are not totally involved in each individual. From our analysis of 100 healthy ethnic Chinese (i.e., Taiwanese) (n = 200 chromosomes) using the polymerase chain reaction (PCR) products combined with an amplification-created restriction site (ACRS) method and DNA sequencing, we found that approximately 10% of CYP21A1P alleles (n = 195 chromosomes) presented the CYP21A2 sequence; frequencies of P30, V281, Q318, and R356 in that locus were approximately 24%, 21%, 11%, and 34%, respectively, and approximately 90% of the CYP21A1P alleles had 15 mutated loci. In addition, approximately 2.5% (n = 5 chromosomes) showed four haplotypes of the 3.7-kb TaqI-produced fragment of the CYP21A2-like gene and one duplicated CYP21A2 gene. We conclude that the pseudogene of the CYP21A1P mutation presents diverse variants. Moreover, the existence of the CYP21A2-like gene is more abundant than that of the duplicated CYP21A2 gene downstream of the XA gene and could not be distinguished from the CYP21A2–TNXB gene; thus, it may be misdiagnosed by previously established methods for congenital adrenal hyperplasia caused by a 21-hydroxylase deficiency.
Ó 2011 Elsevier Inc. All rights reserved.
Congenital adrenal hyperplasia (CAH)1is an inherited disorder
resulting mainly from a defect in the steroid 21-hydroxylase (CYP21A2) gene that causes approximately 90–95% of all CAH cases. It is one of the most common inborn errors of metabolism in hu-mans. The wide range of CAH phenotypes is associated with multiple mutations known to affect 21-hydroxylase enzymatic activity. CAH is classified into three forms: classical salt wasting, classical simple virilizing, and nonclassical[1,2]. The incidence of the disease caused by these two classical forms is reported to be 1:10,000–1:18,000, depending on race[3,4]. The nonclassical form is milder and com-monly occurs at a rate of 1:1700 in the general population[3,5].
The gene coding for P450c21 is designated CYP21A2. A duplicate copy designated CYP21A1P exists and shares 98% nucleotide quence homology with CYP21A2 in exons and 96% in noncoding se-quences[6,7]. These two genes are located within the HLA class III
human histocompatibility complex locus on chromosome 6p21.3, adjacent to and alternating with the C4A and C4B genes, which en-code the fourth components of the serum complement[8]. The specific constitution of the CYP21A2 locus is probably caused by an ancestral duplication of 30 kb encompassing the CYP21A2 and C4 genes. In this region, C4 (C4A and C4B)[9], CYP21A2 (and CY-P21A1P), RP (RP1 and RP2) [9], and tenascin (XA and TNXB)
[10,11] comprise the most frequent bimodular RCCX (or the
C4-CYP21 repeat) of the RP1–C4–C4-CYP21A1P–XA–RP2–C4–C4-CYP21A2– TNXB gene sequence in 69% of alleles in Caucasians[12]. The se-quence length of the gene cluster is approximately 120 kb [13]. However, CYP21A1P downstream of XA is a pseudogene and is inac-tive due to the existence of 15 deteriorated mutations that include four nucleotides of the promoter region at nt 103 (G), 110 (C), 113 (A), and 126 (T) as well as a 30L, I2 splice (nt 655 or IVS2-12A/C > G), nt 707–714del, 172N, cluster E6, 281L, F306KL307insT, 318X, and 356W. In addition, there are two differ-ent gene sizes of 3.7 kb represdiffer-enting CYP21A2 and 3.2 kb represdiffer-ent- represent-ing CYP21A1P, as determined by TaqI endonuclease digestion from the genome[8].
The RCCX module has three possible forms: monomodular, bimodular, and trimodular. Chromosomes with four RCCX modules
0003-2697/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2011.02.016
⇑ Corresponding author at: School of Chinese Medicine, College of Chinese Medicine, China Medical University, Taichung 404, Taiwan. Fax: +886 3 9389073.
E-mail addresses: [email protected], [email protected] (H.-H. Lee).
1
Abbreviations used: CAH, congenital adrenal hyperplasia; PCR, polymerase chain reaction; ACRS, amplification-created restriction site; dNTP, deoxynucleoside tri-phosphate; mRNA, messenger RNA.
Contents lists available atScienceDirect
Analytical Biochemistry
j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / y a b i o
are very rare[14]. In the monomodule, the CYP21A1P gene does not exist in approximately 17% of Caucasians, as reported by Blan-chong and coworkers[14]. However, haplotypes of the RCCX mod-ule with more than one CYP21A2 gene in the trimodular form were observed[14–19]. Obviously, the gene located downstream of the XA gene can possibly include the CYP21A2 gene as well as the CY-P21A1P gene.
The current study was undertaken to use specifically paired primers to amplify a PCR product containing XA and the adjacent upstream CYP21A1P gene to identify 15 mutational loci commonly appearing in CYP21A1P and to examine whether all of these loci oc-curred in the CYP21A1P gene in our healthy individuals. In addition, we determined whether the duplicated CYP21A2 gene exists down-stream of XA and established a protocol to distinguish the CYP21A2 gene existing in the XA and XB genes, which may produce a misdi-agnosis of CAH caused by a 21-hydroxylase deficiency.
Materials and methods Subjects
For a carrier analysis of CAH caused by the 21-hydroxylase defi-ciency in our population, 1000 blood samples, used mainly for biochemical testing at the time of a health examination, were ob-tained from Veterans General Hospital – Taipei in 2000[20]. Among these samples, we used 100 samples to analyze the CYP21A1P gene. The institute review board of Veterans General Hospital – Taipei ap-proved the protocol, and the study followed its guidelines strictly. Amplification and restriction endonuclease analysis of the primary 6.1-kb PCR product containing the CYP21A1P and XA genes
All of the CYP21A1P gene, except the monomodule in the RCCX module, is located downstream of the XA gene (Fig. 1A). To amplify CYP21A1P, a 6.1-kb polymerase chain reaction (PCR) product amplified with the specifically paired primers, CYP-779f/XA-36F (Table 1), was derived from 100 healthy individuals. The 6.1-kb PCR product contained the entire CYP21A1P and partial XA genes (Fig. 1A). Primer CYP-779f (50-aggtgggctgttttcctttca-30, nt 779 to 759)[6] is located at the 50 end of the CYP21A1P and CYP21A2 genes, and XA-36F (50-ggacccagaaactccaggtgg-30, nt 4252–4272, GenBank accession No. S38953) is located in the XA gene of exon 36/intron 36 (Fig. 1A). The following PCR conditions were used: ini-tial denaturation at 94 °C for 4 min, followed by 12 cycles at 94 °C for 30 s, 62 °C for 40 s, and 68 °C for 5 min, and another 16 cycles at 94 °C for 30 s and 68 °C for 5 min. The 6.1-kb PCR product with 10 U in a 10-
l
l volume of TaqI cleavage enzymes was incubated at 65 °C for 2 h. The completely digested PCR products were ana-lyzed by electrophoresis on a 1.0% agarose gel.ACRS method for identifying 10 mutational loci and DNA sequencing of five loci of the CYP21A1P gene using the secondary PCR product
Identification of CYP21A1P gene mutations was followed by amplification-created restriction site (ACRS) primer detection (see
Supplemental Table 1 in supplementary material)[21] using the 6.1-kb PCR product as a template. ACRS primer pairs and the restric-tion enzyme reacrestric-tion were used to detect mutarestric-tions (Table 2), including 30L (A), IVS2-12G (or I2 splice) (B), 172N (C), 236N (D), 281L (G), 318X (J1), and 356W (J2) (Fig. 2A), as described previously
[21]. To detect the IVS2-12G (I2 splice) in combination with nt 707– 714del, the 3B/C4 paired primers were used as described previously
[22]. To detect the promoter region (P inTable 2) of nt 209 (C), 198 (T), 188K–189 (T), 126 (T), 113 (A), 110 (C), 103 (G), and 4 (T)[6], 291-bp PCR fragments derived from the paired
primers, CYP-270f/C120 (Table 1), were generated. To detect the F306KL307inseT mutation (H inTable 2), 519-bp PCR fragments de-rived by the paired primers, Ex6/In7R (Table 1), were generated. These two secondary PCR products were subjected to DNA sequenc-ing. The 519-bp PCR fragment contains the CYP21A1P sequence from nt 1306 to 1825, which also includes five SNP site detections of nt 1375 (C), 1420 (G), 1421 (T), 1586 (G), and 1789 (C) (Table 2)[6]. The sequence and location of the sequencing primers are listed in
Table 1. The reaction mixture of the secondary PCR amplification contained 0.5
l
l of the primary PCR product, 5l
l of 10 PCR buffer (100 mmol/L Tris–HCl [pH 8.8], 500 mmol/L KCl, 25 mmol/L MgCl2, and 0.1% Tween 20), 0.08 U of Thermoprime Plus DNA polymerase (Advanced Biotechnologies, UK), 7.5 pmol of each primer, and 80l
mol/L of each deoxynucleoside triphosphate (dNTP) in a final volume of 50l
l. The PCR consisted of 37 cycles at 94 °C for 30 s, 58 °C for 40 s, and 72 °C for 50 s.DNA sequencing
The secondary PCR products (Table 1) for DNA sequencing were used in a Taq Dye Deoxy Terminator Cycle Sequencing Kit (Applied Biosystems, USA).
Results
Use of the 6.1-kb PCR products for CYP21A1P amplification and TaqI restriction endonuclease analysis of 100 normal individuals
A 6.1-kb primary PCR product (Fig. 1B, lane 1) (data from only one person) was generated by the paired primers, CYP779f/XA-36F, from 100 healthy individuals. From the TaqI cleavage analysis of the 6.1-kb PCR product, two TaqI sites (TCGA) in this region (nt 209 and 2995) (Fig. 1A)[6]produced three fragments of 3207, 2315, and 591 bp (the last one of which ran out of the gel) (Fig. 1B, lane 2) (data from only one sample) that appeared in 96 healthy individuals (192 chromosomes). However, three healthy individuals (samples 350, 984, and 988) produced fragments of 3738, 3207, 2315, 591, and 60 bp (the last two of which ran out of the gel) (data from only sample 984) (Fig. 1B, lane 3), and one healthy individual (sample 646) produced 3738, 2315, and 60 bp (the last one of which ran out of the gel) (Fig. 1B, lane 4). This indi-cated that the CYP21A1P gene downstream of the XA gene in most healthy individuals (n = 195 chromosomes) presented a putative size of the 3.2-kb TaqI-produced fragments (Fig. 1B, lane 2) that showed a 97.5% frequency. Otherwise, one allele of the CYP21A2 gene of samples 350, 984, and 988 had the 3.7-kb TaqI-produced fragment, and the other allele had 3.2 kb of the CYP21A1P gene. Sample 646 had the 3.7-kb TaqI-produced fragment of the CYP21A2 gene in two alleles. This implies that 2.5% (five chromosomes) of healthy individuals had CYP21A2 genes (Table 3).
ACRS analysis and DNA sequencing of the secondary PCR product for 15 loci detections in 96 healthy individuals carrying the 3.2-kb TaqI-produced fragments
To detect the 10 loci of A, B, C, D (cluster E6), G, J1, and J2
(Fig. 2A) from 96 healthy individuals who showed the 3.2-kb
TaqI-produced fragments, the 6.1-kb primary PCR product (Fig. 1B, lane 1) generated by the paired primers, CYP-779f/XA-36F, as the template was subjected to secondary ACRS primer amplification (data from only one sample) using the paired prim-ers, CIN/C2 (Table 2), and this generated a 195-bp fragment of locus (A) (Fig. 2B, lane 1); C3B/C4 generated a 124-bp fragment of locus (B) (Fig. 2B, lane 5); C5/C6 generated a 148-bp fragment of locus (C) (Fig. 2B, lane 10); C7D1/C8 generated a 140-bp
ment of locus (D) (Fig. 2B, lane 14); C9/C10-1 generated a 213-bp fragment of locus (G) (Fig. 2B, lane 18); and C11/C12 generated a 197-bp fragment of loci (J1) and (J2) (Fig. 2B, lane 22). In addition, for DNA sequencing, we also prepared (data not shown) paired primers of CYP-270f/C120 to generate a 291-bp fragment of the promoter region (P inTable 2) and EX6/In7R to generate a 519-bp fragment of locus (H) (Table 2). After appropriate endonuclease cleavages (Table 2) of the six different ACRS PCR products (Fig. 2B,
lanes 1, 5, 10, 14, 18, and 22), only two alleles (data from only sam-ple S1) of 24 healthy individuals showed the CYP21A1P sequence in 10 loci (Table 2) that presented a 164-bp fragment of CYP21A1P lo-cus (A) (Fig. 2B, S1), a 93-bp fragment of CYP21A1P locus (B) (Fig. 2B, S1), a 118-bp fragment of CYP21A1P locus (C) (Fig. 2B, S1), a 140-bp fragment of CYP21A1P locus (D) (Fig. 2B, S1), a 213-bp fragment of CYP21A1P locus (G) (Fig. 2B, S1), a 197-bp fragment of CYP21A1P locus (J1) (Fig. 2B, S1), and a 167-bp fragment of
CY-Fig.1. (A) Bimodular form (or the C4-CYP21 repeat module) (RP1–C4A–CYP21A1P–XA–RP2–C4B–CYP21A2–TNXB) of the RCCX region of chromosome 6p21.3 and the strategy for PCR amplification of a 6.1-kb fragment encompassing the XA gene to the CYP21A1P gene. The white box indicates the structures of the RP1, CYP21A2, C4B, and TNXB genes, whereas the black box represents the C4A, CYP21A1P, XA, and RP2 genes. Sizes of the genes from the ATG start codon to the TGA stop codon, including RP1, C4A, CYP21A1P, XA, RP2, C4B, CYP21A2, and TNXB, in the RCCX module of the figure are based on sequences of GenBank accession numbers AL049547 and AF019413. The presence of C4A (the long gene of 20.4 kb) or C4B (the short gene of 14.1 kb) depends on the presence of HERV-K (C4), the endogenous 6.7-kb retroviral sequence, in intron 9 indicated by a solid circle (d). Solid arrows indicate the orientation of transcription. A 121-bp deletion in exon 36 of the XA gene is marked with an asterisk (⁄
). Top: Scale in kilobases (kb), with the TNXB gene starting at 0. Horizontal dashed arrows represent the direction and location of primers XA-36F and CYP779f. Bottom: Restriction digestion analysis of the TaqI restriction fragment on the 6.1-kb PCR product amplified with the paired primers, CYP779F/XA-36F. (B) TaqI cleavage analysis of the 6.1-kb PCR product amplified from XA to the 50end of the CYP21A1P gene. The analysis was carried out on a 1.0% agarose gel. Lane 1: 6.1-kb PCR product amplified with the CYP779/XA-36F primer pair from a
wild-type individual; lane 2: 6.1-kb PCR product digested with TaqI from one of 195 healthy individuals that produced three fragments of 3207, 2315, and 591 bp (the last one of which ran out of the gel); lane 3: one of three healthy individuals (sample 984) that produced five fragments of 3738, 3207, 2315, 591, and 60 bp (the last two of which ran out of the gel); lane 4: sample 646 that produced three fragments of 3740, 2315, and 60 bp (the last one of which ran out of the gel); lane 5: 6.2-kb fragment amplified with the paired primers, CYP779f/Tena36F2[22], that produced three fragments of 3740, 2491, and 60 bp (the last one of which ran out of the gel); lane mk: 1-kb DNA ladder (domestic).
P21A1P locus (J2) (Fig. 2B, S1). In addition, two secondary PCR products of the 291- and 519-bp fragments for DNA sequencing (data not shown) also contained the CYP21A1P sequence in two al-leles in the promoter region of four SNP sites of nt 126 (T), 113 (A), 110 (C), and 103 (G) (Table 2) and the F306KL307inseT lo-cus (data not shown). This indicates that 24% (24/100) of CYP21A1P downstream of the XA gene of healthy individuals showed 15 mu-tated loci in two alleles. The allelic frequencies of healthy individ-uals (n = 195 chromosomes) with normal and mutated loci in the CYP21A1P gene are summarized inTable 4.
ACRS analysis and DNA sequencing of the secondary PCR product for 15 loci detections of five chromosomes carrying 3.7-kb TaqI-produced fragments
Three healthy individuals (samples 350, 984, and 988) had the 6.1-kb primary PCR product (Fig. 1B, lane 3) (data from only sam-ple 984) that produced fragments of 3.7, 3.2, 2.3, 0.5, and 0.06 kb on the TaqI digestion analysis. With the ACRS analysis of the A, B, C, D (cluster E6), G, J1, and J2 loci (Fig. 2B), sample 984 (S2) pre-sented fragments of the 195-bp CYP21A2 and 164-bp CYP21A1P loci (A) (Fig. 2B, S2), the 132-bp CYP21A2 and 93-bp CYP21A1P loci (B)
Table 1
Primers for amplification of the CYP21A1P gene and secondary PCR product for DNA sequencing.
Designation Primer (50?30) Location (nt) Specificity
Primers for amplification of the 6.1-kb PCR product CYP-779f CCAGAAAGCTGACTCTGGATG 779 to 759a CYP21A1P/ CYP21A2 XA-36F GGACCCAGAAACTCCAGGTGG 4252–4272b XA Primers for amplification of the 291-bp PCR product for DNA sequencing CYP-270f CCAGAAAGCTGACTCTGGATG 271 to
251a
CYP21P/CYP21 C120 AGCAGGCCCAGGAGCAGCAT 20–1a
CYP21P/CYP21 Primers for amplification of the 519-bp PCR product for DNA sequencing EX6 TCATGCTTCCTGCCGCAGTTC 1306–1326a CYP21P/CYP21
In7R GCCAGGTTGCTGGGAAGGAGC 1825–1805a CYP21P/CYP21
Primers for amplification of the 469-bp PCR product for DNA sequencing 1A2 CTGCTGGCTGGCGCCCGCCT 31–50a
CYP21P/CYP21 In2 AGGTGGGAGGATCATTTGAG 500–481a CYP21P/CYP21 aBased on Higashi and coworkers[6].
b
Based on GenBank accession number S38953.
Table 2
Primer pairs for the ACRS analysis of 10 mutation loci and DNA sequencing of the promoter region and F306KL307insT locus in the CYP21A1P gene. ACRS analysis
Designation Mutation locusa
Paired primer PCR (bp) Restriction site Fragment (bp)
Natural Created CYP21A2 CYP21A1P
A 30L CIN/C2 195 – PstI 195 164 + 31
B I2splice and 707–714delb
C3B/C4 124 – SacI 132 93 + 31 C 172N C5/C6 148 – MseI 148 118 + 30 D 236Nc C7D1/C8 140 – MboI 114 + 26 140 G 281L C9/C10-1 213 ApaLI – 116 + 101 213 J1 318X C11/C12 197 PstI – 146 + 51 197 J2 356W C11/C12 197 – MscI 197 167 + 30
DNA sequencing analysis
Designation Locus (nt/aa)a Paired primers PCR (bp) Sequencea
CYP21A2 CYP21A1P H F306KL307 EX6/In7R 519 – T nt 1375 T C 1420 A G 1421 C T 1586 C G 1789 G C P nt 209 CYP-270f/C120 291 T C 198 C T 188K189 – T 126 C T 113 G A 110 T C 103 A G 4 C T
H62 1A2/In2 469 CAC CAC/CTC
a
Based on Higashi and coworkers[6].
b I2 splice denotes IVS2-12A/C > G or nt 655. c E6 cluster indicates I236, V237, and M239.
(Fig. 2B, S2), the 148-bp CYP21A2 and 118-bp CYP21A1P loci (C) (Fig. 2B, S2), the 114-bp CYP21A2 and 140-bp CYP21A1P loci (D) (Fig. 2B, S2), the 213-bp CYP21A1P and 116- plus 101-bp CYP21A2 loci (G) (Fig. 2B, S2), the 197-bp CYP21A2 and 146-bp CYP21A1P loci
(J1) (Fig. 2B, S2), and the 197-bp CYP21A2 locus (J2) (Fig. 2B, S2). From DNA sequencing of the 291-bp fragment to identify the pro-moter region of four SNP sites, sample 984 (S2) presented the sta-tus of nt 126 (C/T), 113 (G/A), 110 (T/C), and 103 (A/G) in
Fig.2. Restriction analysis of the amplification product of the ACRS method and map for detecting mutational loci of the CYP21A1P gene. (A) Detection of an ACRS amplification product of the CYP21A1P gene for 30L (A), for IVS2-12G (or the I2 splice) and 707–714del (B), for 172N (C), for 236N (D), for 281L (G), for 318X (J1), and for 356W (J2). The ACRS primers were described previously (Supplemental Table 1)[21,22]. Mutational loci of the CYP21A1P gene are indicated by a black box, and normal loci are indicated by a white box. (B) Restriction analysis of the ACRS amplification products of three healthy individuals on a 2.7% agarose gel. The loci are designated (A), (B), (C), (D), (G), (J1), and (J2) corresponding to map A. Lanes 1, 5, 10, 14, 18, and 22 are PCR products for (A), (B), (C), (D), (G), and (J1) and (J2), respectively. Lane S1: one healthy individual with the 3.2-kb TaqI fragment of the CYP21A1P gene in two alleles; lanes S2 and S3: samples 984 and 646, respectively; lane S: one CAH patient with the I2 splice mutation (without the 707–714del mutation) in two alleles that produced a 103-bp fragment by the ACRS analysis[22]. Each amplification product was either untreated (‘‘’’ lanes) or treated (‘‘+’’ lanes) with an appropriate restriction enzyme (RE) (Table 2). Lane mk: 100-bp DNA ladder (domestic). (C) Four proposed haplotypes of the CYP21A2-like gene present in four healthy individuals with the 3.7-kb TaqI-produced fragment from the ACRS and DNA sequencing analyses.
two alleles (seeSupplemental Table 2 in supplementary material) and 519-bp fragments showed the presence of F306KL307inseT in two alleles (seeSupplemental Table 2). This indicated that sample 984 (S2) might carry one CYP21A2-like gene with a 3.7-kb TaqI-produced fragment (Fig. 1B, lane 3) that had the F306KL307inseT mutation (H) (Fig. 2C, haplotype 1), and the other allele with a 3.2-kb TaqI-produced fragment of the CYP21A1P gene (Fig. 1B, lane 3) had the 197-bp CYP21A2 locus (J2) (Fig. 2B, S2). In addition, the ACRS analysis of sample 646 (S3) with two alleles presenting the 3.7-kb TaqI-produced fragment (Fig. 1B, lane 4) showed fragments of the 195-bp CYP21A2 locus (A) (Fig. 2B, S3), the 132-bp CYP21A2 locus (B) (Fig. 2B, S3), the 148-bp CYP21A2 locus (C) (Fig. 2B, S3), the 114-bp CYP21A2 locus (D) (Fig. 2B, S3), the 213-, 116-, and 101-bp CYP21A1P and CYP21A2 loci (G) (Fig. 2B, S3), the 197-bp CY-P21A1P and 146-bp CYP21A2 loci (J1) (Fig. 2B, S3), and the 197-bp CYP21A2 and 164-bp CYP21A1P of loci (J2) (Fig. 2B, S3). From DNA sequencing of the 291-bp fragment (seeSupplemental Table 2) of the promoter region (P in Table 2), sample 646 (S3) presented the CYP21A2 sequence of nt –126 (C), –113 (G), –110 (T), and – 103 (A) in two alleles (see Supplemental Table 2), and the se-quenced 519-bp fragments did not carry the F306KL307inseT mutation (seeSupplemental Table 2) in two alleles. This indicated that sample 646 (S3) might carry one CYP21A2-like gene with 3.7-kb TaqI-produced fragments (Fig. 1B, lane 4) that had mutations of 281L, 318X, and 356R (Fig. 2C, haplotype 2) and another allele with a normal CYP21A2 gene (seeSupplemental Table 2). Two samples, 988 and 350, were also identified by ACRS and DNA sequencing, and the data are listed in Supplemental Table 2. Haplotypes of the CYP21A2-like genes with the 3.7-kb TaqI-produced fragment are shown inFig. 2C.
Four healthy individuals showed normal allele in the CYP21A2 gene downstream of the TNXB gene
With an examination of four healthy individuals (samples 984, 646, 988, and 250) for a carrier analysis in 2000[20]using differ-ential PCR amplification with the paired primers, BF1/21BR[21],
their haplotypes of CYP21A2 showed two normal alleles. Primers BF1 and 21BR are specific for the 50and 30ends of the CYP21A2 se-quence, respectively. Therefore, this implies that the CYP21A2-like gene that existed downstream of the XA gene in these four healthy individuals cannot be generated by PCR amplification using the paired primers, BF1/21BR, as in a previously established method.
The presence of normal locus P30 (CCG) in the CYP21A1P gene is attributed to the production of L62 (CTC), and the L30 (CTG) mutation goes with H62 (CAC) in the gene sequence
Our analysis revealed a 24.1% frequency (Table 4) of the normal P30 (CCG) locus (A) (Fig. 3A) in the CYP21A1P gene with a 3.2-kb TaqI-produced fragment in 40 healthy individuals (Table 4) in whom locus H62 (CAC) was altered to L62 (CTC) (Fig. 3B) and mu-tated L30 (CTG) (Fig. 3D) retained locus H62 (CAC) in the gene se-quence (Fig. 3E). However, a normal P30 was present in four haplotypes of the CYP21A2-like genes (samples 984, 646, 988, and 350; seeSupplemental Table 2), and H62 was not changed to L62 (see Supplemental Table 2). Because L62 does not exist in the CYP21A1P or CYP21A2 gene, normal P30 presenting in CYP21A1P with a 3.2-kb TaqI-produced fragment may play a role in creating the L62 sequence through a spontaneous recombination.
Discussion
Pseudogenes are divided into two types: processed and nonpro-cessed. Processed pseudogenes lack introns and are presumably generated from mature messenger RNA (mRNA) that carries out retrotransposition and is then integrated into the genome. The integration mechanism is by random chance, and the location is frequently not near the parental gene[23]. In this class, some pseu-dogenes were identified as having ‘‘live’’ transcriptional activity in humans[24–26]. Nonprocessed pseudogenes arise from duplica-tion of the parental gene. The duplicaduplica-tion region is close to the parental gene, within 500 kb (22.6% of frequencies)[23]. Nonpro-cessed pseudogenes contain intron sequences and genetic lesions such as in-frame termination codons produced by a single base change and base insertions and deletions that cause a change in the reading frame and, thus, premature termination. Therefore, the sequence of the functional gene being converted to that of the pseudogene may cause genetic mutations.
CAH is a term that describes several inheritable disturbances in steroid hormone metabolism. There are six enzymes, CYP11A, CYP17 (17,20-lyase), CYP21A2, CYP11B1, CYP11B2, and 17b-hydrox-ylsteroid dehydrogenase, that are required for the synthesis of ste-roid hormones. Among them, only CYP21A2 contains the CYP21A1P pseudogene; they are separated by 30 kb in chromosome 6p21.3 and show great similarity. Therefore, this seems to be the most likely reason for misalignment and gene conversions to occur at meiosis between these two genes. As a result, the most frequent steroid hormone abnormality occurs as a CYP21A2 deficiency that causes approximately 90–95% of all CAH cases. Genetic defects of the CYP21A2 gene in CAH may commonly lead to one of two cate-gories of (i) small-scale conversions of the CYP21A1P sequence (commonly one of 15 mutations) and (ii) chimeras of the RCCX module, including the chimeric CYP21A1P/CYP21A2 and TNXA/TNXB genes[27–29]. The CYP21A1P pseudogene belongs to the nonpro-cessed type[23], for which CYP21A1P transcription itself was not detected under any culture conditions or with various regulatory factors[30]solely because of two deteriorated mutations of the 707–714del and I2 splice. However, the promoter can drive tran-scription to an unrelated gene termed YA[31], although the func-tion of YA is not yet clear.
Table 3
Frequency of the 3.2- and 3.7-kb TaqI-produced fragments of the CYP21A1P gene downstream of the XA gene in healthy ethnic Chinese (i.e., Taiwanese).
Chromosomes
n %
CYP21A1P with the 3.2-kb TaqI-produced fragment 195 97.5 CYP21A1P with the 3.7-kb TaqI-produced fragment 5a 2.5
Total 200 100
a
Four haplotypes of the CYP21A2-like gene and one haplotype of the CYP21A2 gene were included.
Table 4
Allelic frequencies of the CYP21A1P gene with the CYP21A2 sequence in healthy ethnic Chinese (i.e., Taiwanese) (n = 195 chromosomes).
Locusa P A B C D G H J1 J2 Two alleles 0 7 0 0 0 7 0 2 14 One allele 0 33 0 0 0 27 0 17 38 Total individuals 0 40 0 0 0 34 0 19 52 Total chromosomes 0 47 0 0 0 41 0 21 66 Locus frequency (%) 0 24.1 0 0 0 21 0 10.8 33.8 Allelic frequency 10% (175/9 195)
Note: The population frequency of the normal locus in the CYP21A1P gene was approximately 10%. The population frequency of the mutated locus in the CYP21A1P gene was approximately 90%.
aP: nt 126 (C), 113 (G), 110 (T), and 103 (A); A: P30; B: I2 splice (IVS2-12A/
T, nt 655); C: I172; D: E6 cluster (I236, V237, and M239); G: V281; H: F306/L307; J1: Q318; J2: R356 (based on Higashi et al.[6]).
In this study, we used the specific paired primers, CYP779/XA-36F, to amplify the CYP21A1P gene located downstream of the XA gene and examined the status of the gene size and mutational lo-cus distributions. In an analysis of the alleles (n = 47 chromo-somes) (Table 4) of the 3.2-kb TaqI-produced fragment of the CYP21A1P gene with the P30 (CCG) locus (A) of the CYP21A2 se-quence, the promoter sequence of nt 4 contained C of the CYP21A2 sequence (Fig. 3C), and the allele with L30 (CTG)
(Fig. 3F) contained sequence T. However, promoter regions
showed the CYP21A1P sequence in these two different alleles at nt 126 (T), 113 (A), 110 (C), and 103 (G) (Table 2) (data not shown). This implies that the 50 end region of the CYP21A1P gene with P30 of the CYP21A2 sequence includes only nt 4 to 103, indicating that the 50 end region extending beyond nt 103 is the CYP21A1P sequence. Furthermore, analysis of the 30 end region in either the CYP21A1P gene (195 chromosomes) (
Ta-ble 3) or four haplotypes of the CYP21A2-like genes and one
duplicated CYP21A2 (five chromosomes) (Table 3) showed the XA sequence at nt 3074 (C), 3096 (G), 3146 (T), 3149 (C), 3170 (C), and 3180 (T) (data not shown). This indicates that
CYP21A2-like genes and duplicated CYP21A2 genes downstream of the XA gene show a chimeric structure with the 50 end of the CYP21A2 structure and the CYP21A1P sequence in the 30 end. Therefore, identification of CYP21A2-like genes and duplicated CYP21A2 genes using either a two-step CYP21A2 amplification [32–34]or a one-step differential PCR amplification of the CYP21A2 gene
[21,35] may produce PCR dropoff. In addition, the use of an al-lele-specific PCR to detect 10 different mutations [16–18,36]
might not be able to distinguish whether CYP21A2 exists down-stream of the XB or XA gene. Predictably, the MLPA assay [37]
might ‘‘catch’’ both the CYP21A2-like (Fig. 2C, haplotypes 1, 2, and 3) and CYP21A2 genes downstream of the TNXB gene. A Southern blot analysis by TaqI digestion might also show frag-ments of the 3.7 kb that present the CYP21A2 gene downstream of the TNXB gene, and 2.3 kb may be present as from the CY-P21A1P fraction in the RCCX region. Therefore, these two methods might lead to a misinterpretation of CYP21A2 genotyping. Because the orientation of transcription of the CYP21A2 gene begins from a telomere to a centromere in chromosome 6p21.3, these four hap-lotypes of CYP21A2-like genes (samples 984, 646, 988, and 350;
Fig.3. DNA sequencing analysis of codons 30 and 62, and the promoter region of the nt -4 sequence of the CYP21A1P gene with the 3.2-kb TaqI-produced fragment from the secondary PCR products described in the context. A, B, and C for individuals with locus of P30, L60, and C at nt -4. D, E, and F for individuals with locus of L30, H62, and T at nt -4.
seeSupplemental Table 2) downstream of the XA gene with one more mutational locus (Fig. 2C) might not produce enzyme activ-ity and might not be considered as carriers due to normal func-tioning of CYP21A2 downstream of the XB gene.
Four normal loci of P30, V281, Q318, and R356 (Table 4) of the CYP21A2 sequence apparently exist in the CYP21A1P pseudogene in our populations and may represent an imprint that gene conver-sions between these two genes previously occurred, or they might have originated from a by-product of the ‘‘incomplete’’ release of selective pressures on the functional gene in evolution. However, the other four normal loci of the I2 splice, I172, cluster E6, and F306/L307 were not found in the CYP21A1P gene with the 3.2-kb TaqI-produced fragment. This might have been caused by ‘‘com-plete’’ selective pressure of the functional gene. Because gene con-versions may occur at meiosis between these two genes, we propose that the 10% allelic frequencies (Table 4) of these individ-uals with the CYP21A2 sequence in the CYP21A1P allele might pro-duce protection against ‘‘invasion’’ of the next gene conversion caused by misalignment.
In conclusion, we have established a protocol to identify CYP21A2-like and duplicated CYP21A2 genes downstream of the XA gene that can distinguish the CYP21A2 gene downstream of the TNXB gene, and it indicates that the existence of the CYP21A2-like gene is more abundant than that of the duplicated CYP21A2 gene. We be-lieve that a better understanding of the underlying genetic mecha-nisms will contribute to more precise diagnoses. We suggest that preparing two PCR products with a full CYP21A2 gene containing the downstream sequence of the XB gene[38]and a full CYP21A1P gene containing the downstream sequence of the XA gene can fault-lessly and accurately detect the molecular CYP21A2 gene of the RCCX module in CAH due to 21-hydroxylase deficiency.
Acknowledgment
This work was supported by a grant (TCRD-TPE-97-C1-4) from Buddhist Tzu Chi General Hospital of Taiwan.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in the online version, atdoi:10.1016/j.ab.2011.02.016.
References
[1] M.I. New, R.C. Wilson, Steroid disorders in children: congenital adrenal hyperplasia and apparent mineral corticoid excess, Proc. Natl. Acad. Sci. USA 96 (1999) 12790–12797.
[2] M.I. New, Extensive clinical experience nonclassical 21-hydroxylase deficiency, J. Clin. Endocrinol. Metab. 91 (2006) 4205–4214.
[3] P.C. White, P.W. Speiser, Congenital adrenal hyperplasia due to 21-hydroxylase deficiency, Endocr. Rev. 21 (2000) 245–291.
[4] B.L. Therrel, Newborn screening for congenital adrenal hyperplasia, Endocrinol. Metab. Clin. North Am. 30 (2001) 15–30.
[5] J. Fitness, N. Dixit, D. Webster, T. Torresani, R. Pergolizzi, P.W. Speiser, D.J. Day, Genotyping of CYP21, linked chromosome 6p marker, and a sex-specific gene in neonatal screening for congenital adrenal hyperplasia, J. Clin. Endocrinol. Metab. 84 (1999) 960–966.
[6] Y. Higashi, H. Yoshioka, M. Yamane, O. Gotoh, Y. Fujii-Kuriyama, Complete nucleotide sequence of two steroid 21-hydroxylase genes tandemly arranged in human chromosome: a pseudogene and a genuine gene, Proc. Natl. Acad. Sci. USA 83 (1986) 2841–2845.
[7] P.C. White, M.I. New, B. Doupont, Structure of human steroid 21-hydroxylase genes, Proc. Natl. Acad. Sci. USA 83 (1986) 5111–5115.
[8] P.C. White, M.I. New, B. Dupont, HLA-linked congenital adrenal hyperplasia results from a defective gene encoding a cytochrome P-450 specific for steroid 21-hydroxylation, Proc. Natl. Acad. Sci. USA 81 (1984) 7505–7509.
[9] L. Shen, L.C. Wu, S. Sanlioglu, R. Chen, A.R. Mendoza, A.W. Dangel, M.C. Carroll, W.B. Zipf, C.Y. Yu, Structure and genetics of the partially duplicated gene RP located immediately upstream of the complement C4A and the C4B genes in the HLA class III region: molecular cloning, exon-intron structure, composition retroposon, and breakpoint of gene duplication, J. Biol. Chem. 269 (1994) 8466–8476.
[10] S.E. Gitelman, J. Bristow, W.L. Miller, Mechanism and consequences of the duplication of the human C4/P450c21/gene X locus, Mol. Cell Biol. 12 (1992) 2124–2134.
[11] J. Bristow, M.K. Tee, S.E. Gitelman, S.H. Mellon, W.L. Miller, Tenascin-X: A novel extracellular matrix protein encoded by the human XB gene overlapping P450c21B, J. Cell Biol. 122 (1993) 265–278.
[12] C.A. Blanchong, B. Zhou, K.L. Rupert, E.K. Chung, K.N. Jones, J.F. Sotos, W.B. Zipf, R.M. Rennebohm, C.Y. Yu, Deficiencies of human complement component C4A and C4B and heterozygosity in length variants of RP-C4-CYP21-TNX (RCCX) modules in Caucasians: the load of RCCX genetic diversity on major histocompatibility complex-associated disease, J. Exp. Med. 191 (2000) 2183–2196.
[13] H.H. Lee, Diversity of the CYP21P-like gene in CYP21 deficiency, DNA Cell Biol. 24 (2005) 1–9.
[14] C.A. Blanchong, E.K. Chung, K.L. Rupert, Y. Yang, Z. Yang, B. Zhou, J.M. Moulds, C.Y. Yu, Genetic, structural, and functional diversities of human complement components C4A and C4B and their mouse homologues, Slp and C4, Intl. Immunopharmacol. 1 (2001) 365–392.
[15] P.F. Koppens, T. Hoogenboezem, H.J. Degenhart, Duplication of the CYP21A2 gene complicates mutation analysis of steroid 21-hydroxylase deficiency: characteristics of three unusual haplotypes, Hum. Genet. 111 (2002) 405–410. [16] A. Wedell, B. Stengler, H. Luthman, Characterization of mutations on the rare duplicated C4/CYP21 haplotype in steroid 21-hydroxylase deficiency, Hum. Genet. 94 (1994) 50–54.
[17] S.M. Baumgartner-Parzer, P. Nowotny, W. Waldhäusl, H. Vierhapper, A rare duplicated 21-hydroxylase haplotype and a de novo mutation: a family analysis, J. Clin. Endocrinol. Metab. 88 (2003) 2794–2796.
[18] B. Ezquieta, M. Beneyto, R. Munoz-Pacheco, R. Barrio, M. Oyarzabal, J.L. Lechuga, C. Luzuriaga, F. Hermoso, S. Quinteiro, S. Martinez, Gene duplications in 21-hydroxylase deficiency: the importance of accurate molecular diagnosis in carrier detection and prenatal diagnosis, Prenat. Diagn. 26 (2006) 1172– 1178.
[19] S. Kleinle, R. Lang, G.F. Fischer, H. Vierhapper, F. Waldhauser, M. Födinger, S.M. Baumgartner-Parzer, Duplications of the functional CYP21A2 gene are primarily restricted to Q318X alleles: evidence for a founder effect, J. Clin. Endocrinol. Metab. 94 (2009) 3954–3958.
[20] H.H. Lee, J.M. Kuo, H.T. Chao, Y.J. Lee, J.G. Chang, C.H. Tsai, B.C. Chung, Carrier analysis and prenatal diagnosis of congenital adrenal hyperplasia caused by 21-hydroxylase deficiency in Chinese, J. Clin. Endocrinol. Metab. 85 (2000) 597–600.
[21] H.H. Lee, H.T. Chao, H.T. Ng, K.B. Choo, Direct molecular diagnosis of CYP21 mutations in congenital adrenal hyperplasia, J. Med. Genet. 33 (1996) 371– 375.
[22] H.H. Lee, S.F. Chang, F.J. Tsai, L.P. Tsai, C.Y. Lin, Mutation of IVS2-12 A/C->G in combination with 707-714delGAGACTAC in the CYP21 gene is caused by deletion of the C4-CYP21 repeat module with steroid 21-hydroxylase deficiency, J. Clin. Endocrinol. Metab. 88 (2003) 2726–2729.
[23] J.M. Bischof, A.P. Chiang, T.E. Scheetz, E.M. Stone, T.L. Casavant, V.C. Scheffied, T.A. Braun, Genome-wide identification of pseudogene capable of disease-causing gene conversion, Hum. Mutat. 27 (2006) 545–552.
[24] G.H. Fujii, A.M. Morimoto, A.E. Berson, J.B. Bolen, Transcriptional analysis of the PTEN/MMAC1 pseudogene, CPTEN, Oncogene 18 (1999) 1765–1769. [25] D. Zheng, Z. Zhang, P.M. Harrison, J. Karro, N. Carriero, M. Gerstein, Integrated
pseudogene annotation for human chromosome 22: evidence for transcription, J. Mol. Biol. 349 (2005) 27–45.
[26] P.M. Harrison, D. Zheng, Z. Zhang, N. Carriero, M. Gerstein, Transcribed processed pseudogenes in the human genome: an intermediate form of expressed retrosequence lacking protein-coding ability, Nucleic Acids Res. 33 (2005) 2374–2383.
[27] H.H. Lee, The chimeric CYP21P/CYP21 and 21-hydroxylase deficiency, J. Hum. Genet. 49 (2004) 65–72.
[28] H.H. Lee, Chimeric CYP21P/CYP21 and TNXA/TNXB genes in the RCCX module, Mol. Genet. Metab. 84 (2005) 4–8.
[29] P. Concolino, E. Mello, A. Minucci, E. Giardina, C. Zuppi, V. Toscano, E. Capoluongo, A new CYP21A1P/CYP21A2 chimeric gene identified in an Italian woman suffering from classical congenital adrenal hyperplasia form, BMC Med. Genet. 10 (2009) 72.
[30] A. Endoh, L. Yang, P.J. Hornsby, CYP21 pseudogene transcripts are much less abundant than those from the active gene in normal human adrenocortical cells under various conditions in culture, Mol. Cell Endocrinol. 137 (1998) 13– 19.
[31] J. Bristow, S.E. Gitelman, M.K. Tee, B. Staels, W.L. Miller, Abundant adrenal-specific transcription of the human P450c21A ‘‘pseudogene’’, J. Biol. Chem. 268 (1993) 12919–12924.
[32] L. Loidi, C. Quinteiro, S. Parajes, J. Barreirot, D.G. Leston, J.M. Cabezas-Agricola, A.M. Sueiro, D. Araujo-Vilar, L. Catro-Feijoo, J. Costas, M. Pombo, F. Dominguez, High variability in CYP21A2 mutated alleles in Spanish 21-hydroxylase deficiency patients, six novel mutations, and a founder effect, Clin. Endocrinol. 64 (2006) 330–336.
[33] D. Owerbach, Y.M. Crawford, M.B. Draznin, Direct analysis of CYP21B genes in 21-hydroxylase deficiency using polymerase chain reaction amplification, Mol. Endocrinol. 4 (1990) 125–131.
[34] D.J. Day, P.W. Speiser, P.C. White, F. Barany, Detection of steroid 21-hydroxylase alleles using gene-specific PCR and a multiplexed ligation detection reaction, Genomics 29 (1995) 152–162.
[35] D. Keen-Kim, J.B. Redman, R.U. Alanes, M.M. Eachus, R.C. Wilson, M.I. New, J.M. Nakamoto, R.G. Fenwick, Validation and clinical application of a locus-specific polymerase chain reaction- and minisequencing-based assay for congenital adrenal hyperplasia (21-hydroxylase deficiency), J. Mol. Diagn. 7 (2005) 236–246. [36] R.C. Wilson, J.Q. Wei, K.C. Chen, A.B. Mercado, M.I. New, Rapid deoxyribo nucleic acid analysis by allele-specific polymerase chain reaction for detection of mutations in the steroid 21-hydroxylase gene, J. Clin. Endocrinol. Metab. 80 (1995) 1635–1640.
[37] P. Concolino, E. Mello, V. Toscano, F. Ameglio, C. Zuppi, E. Capoluongo, Multiple ligation-dependent amplification (MLPA) assay for the detection of CYP21A2 gene deletions/duplications in congenital adrenal hyperplasia: first technical report, Clin. Chim. Acta 402 (2009) 164–170.
[38] H.H. Lee, Y.J. Lee, C.Y. Lin, PCR-based detection of the CYP21 deletion and TNXA/TNXB hybrid in the RCCX module, Genomics 83 (2004) 944–950.
