DOI 10.1007/s00360-007-0210-3
O R I G I N A L P A P E R
Molecular cloning and tissue distribution of three estrogen
receptors from the cyprinid
Wsh Varicorhinus barbatulus
Keng-Yen Fu · Chung-Yuan Chen · Chi-Tsai Lin · Whei-Meih Chang
Received: 17 May 2007 / Revised: 27 August 2007 / Accepted: 29 August 2007 / Published online: 19 October 2007 © Springer-Verlag 2007
Abstract We present molecular cloning and tissue expression analysis of three estrogen receptor (ER) sub-types, vbER, vbER1 and vbER2, from liver of the cyprinid Wsh Varicorhinus barbatulus through reverse transcription-polymerase chain reaction (RT-PCR) and rapid ampliWcation of cDNA ends (RACE). The sequence alignment and phylogenetic analysis reconWrmed the evolu-tionary relationship of V. barbatulus within the family Cyp-riniformes. Directional constraints for subtype-speciWc substitution of critical amino acids were observed in the E2 binding region. For amino acid substitution, vbER exhib-ited a M517L change in the ligand-dependent transactiva-tion region. The tissue distributransactiva-tions were investigated using RT-PCR with subtype-distinguishable primers. Both vbER and vbER1 were most highly expressed in liver, while
vbER2 was higher in intestine. Here we demonstrate that
the identiWcation and cloning of ER subtypes using PCR is feasible in wildlife in that the temporal and spatial
observa-tions are consistent with those from phylogeny analysis and crystal structural investigation by others.
Keywords Estrogen receptor subtype cloning · Phylogenetic analysis · Tissue distribution · RT-PCR ·
Varicorhinus barbatulus Abbreviations AF Activation function CK-II Casein-kinase II DBD DNA binding-domain ER Estrogen receptor ERR Estrogen-related receptor LBD Ligand binding-domain
MAPK Mitogen-activated protein kinase
NCBI National Center for Biotechnology Information PKC Protein kinase C
RACE Rapid ampliWcation of cDNA end
RT-PCR Reverse transcription-polymerase chain reaction
vbER Estrogen receptor of Varicorhinus barbatulus
Introduction
Estrogen receptors (ERs) are members of the steroid hor-mone receptor family that are capable of binding ligands as receptors and transactivating genes as transcription factors involved in growth, development and diVerentiation of many reproductive and non-reproductive tissues. In response to endocrine signals such as 17-estradiol, ERs can act through transcription activation (genomic) and/or cytosolic (non-genomic) signaling pathways (Nilsson et al.
2001). Stereotypic structures of ERs are recognizable by their A to F domains from N- to C-termini (Krust et al.
1986). The A/B domain is the Wrst region to exhibit cell
Communicated by I.D. Hume.
K.-Y. Fu · C.-Y. Chen
Institute of Environmental Engineering, National Chiao Tung University, Hsinchu 300, Taiwan, ROC
C.-T. Lin
Institute of Bioscience and Biotechnology, National Taiwan Ocean University, Keelung 202, Taiwan, ROC
W.-M. Chang (&)
Department of Bioinformatics, Chung Hua University, 707, Sec. 2, WuFu Rd., Hsinchu 30012, Taiwan, ROC e-mail: wmchang@chu.edu.tw
type- and promoter-speciWc transactivation functions (AF-1). The C domain (also called the DNA binding-domain; DBD) is the most conserved region, and contains two zinc-Wnger motifs responsible for the recognition and binding of ERE regulatory elements in the target promoters. The D domain, which is poorly conserved, is a hinge linking C and E domains. The E domain (also called ligand binding-domain; LBD) is rich in hydrophobic residues and is important for speciWc binding of steroid hormones or xenoestrogens. The E/F domain exhibits the second trans-activation function (AF-2) for target genes.
In vertebrate ERs, , and (or 2) subtypes are found in Wsh while only and subtypes are found in mammals. Subtypes of ER in mammals are encoded by diVerent genes that diVer in their aYnity for estrogenic or anti-estrogenic ligands (Barkhem et al. 1998), the transcription mecha-nisms for their target genes (Tremblay et al. 1997), spatial/ temporal expression patterns (Kuiper et al. 1997), and even ontogenic development (Enmark and Gustafsson 1999). It would be interesting to know how functional diVerences in
ERs in reproduction, diVerentiation, development,
metabo-lism, metamorphosis and homeostasis are related to ER par-alogs and how the additional (or 2) subtype in Wsh contributes to the ER functional picture.
Estrogen receptors have attracted increasing attention in relation to the monitoring of environmental pollutants (Garcia-Reyero et al. 2001). Xenoestrogens are known to adversely aVect normal endocrine physiology of humans and wildlife by binding with the ER, resulting in interfer-ence with normal estrogen responsive genes (Sonnenschein and Soto 1998). Exposure to xenoestrogens results in poor growth and reproductive performance in both male and female trout (AshWeld et al. 1998; Bjerselius et al. 2001). However, diVerential expression patterns have been observed in goldWsh (Ma et al. 2000) more than in most other bony Wshes (Hawkins et al. 2000; Menuet et al. 2002; Filby and Tyler 2005), suggesting that species from di Ver-ent niches (or taxa) may employ diVerVer-ent estrogenic mech-anisms. The higher concentrations of xenoestrogens detected in aquatic environments in Taiwan than in other countries (Yuan et al. 2002) has led to the search for a sen-tinel species able to faithfully reXect these estrogenic impacts. The indigenous Wsh Varicorhinus barbatulus was selected for our study because it is a ubiquitous resident often found in the upper and mid reaches of Taiwan rivers and is sensitive to most contaminants. Here we report on the cloning and sequence analysis of three subtypes of ER genes from the liver of V. barbatulus. The tissue distribu-tion of vbER subtypes was investigated in both males and females. The results provide additional understanding of
ER functional mechanisms and phylogeny, and may lay the
ground for better assessment of potential estrogenic risks to wildlife of diVerent ecosystems.
Materials and methods
Sample collection and RNA extraction
Taiwanese cyprinid Wshes (V. barbatulus) ranging in length from 18 to 20 cm were reared and maintained in a semi-recirculating tank at room temperature. After treating with 40g/l 17-estradiol for 2 weeks to over-express the ER transcripts, the Wsh were anesthetized and killed by decapi-tation, and their livers were removed and frozen immedi-ately in liquid nitrogen. Total RNA was extracted using Trizol reagent (Gibco-BRL, Gaithersburg, MD, USA) fol-lowing the manufacturer’s instructions. The RNA concen-tration was determined by absorbance at 260 nm, and its quality was monitored both by its integrity on agarose gel and by A260nm/A280nm ratios >1.8.
Cloning of V. barbatulus ER, ER1, and ER2 cDNA Two consecutive steps were used to clone the subtype genes: reverse transcription-polymerase chain reaction (RT-PCR) and rapid ampliWcation of cDNA ends (RACE) from both 5⬘ and 3⬘ ends (Fig.1). In the Wrst step, ER core
regions conserved in all three subtypes were obtained by RT-PCR. For original core region ampliWcation, two degenerate primers (primer 1 and 2; see Fig.1) were designed based on the overlapping DNA and hormone binding domains of ER from six teleost Wsh species includ-ing ER of goldWsh (GenBank accession no. AF061269),
ER of channel catWsh (AF061275), ER of gilthead
sea-bream (AJ006039), ER of medaka (D28954), ER of Atlantic croaker (AF298181), and ER of rainbow trout (AJ242740). Total RNA from Wsh liver was reverse-tran-scribed using the Superscript II (Invitrogen) one-step reverse transcriptase PCR kit and random primers. Poly-merase chain reaction (PCR) ampliWcation of the core region with two degenerate primers (primers 1 and 2; see Fig.1) was carried out as follows: initial denaturation at 94°C for 3 min, then 30 cycles of denaturation for 30 s at 94°C, annealing at 55°C for 30 s, and extension for 1 min at 72°C. A 0.9-kb fragment of the core region was ampliWed and cloned into the pGEM-T Easy vector (Promega) for sequencing. The sequence was conWrmed using BLAST on NCBI (National Center for Biotechnology Information, National Institutes of Health). These new ER genes from
V. barbatulus were given the nomenclature vbERs.
In the second step, the conserved ER core regions were extended toward both 5⬘ and 3⬘ ends using 5⬘ RACE and 3⬘ RACE techniques. The 5⬘ end of vbER or vbER1 was then ampliWed using subtype speciWc primers (primers 3, 4 for vbER and primers 3, 8 for vbER1, see Fig.1) for
5⬘-RACE with the SMART 5⬘-RACE cDNA AmpliWcation Kit (Clontech, Palo Alto, CA, USA). A 3⬘-RACE procedure
using subtype speciWc primers (primers 5, 6, 7 for vbER; primers 9, 10, 11 for vbER1, see Fig.1) was also per-formed to obtain the full 3⬘ extensions of both genes. According to the goldWsh ER1 sequence (GenBank acces-sion no. AF061269), a subtype speciWc primer 12 was designed and ampliWed to the 5⬘ end of vbER2 using a 5⬘-RACE procedure. The full 3⬘ extension of vbER2 was identiWed using designated primers (primers 13, 14, 15) for 3⬘-RACE procedure. The full-length cDNAs of three ER subtypes were assembled by overlapping these sequences. A list of the sequences of primers used is provided in Table1 and the primer sets with the position of these prim-ers according to gene maps are shown in Fig.1.
Sequence analysis and phylogenetic classiWcation
Sequence results of vbERs were compared with the Gen-bank/EMBL database by basic BLAST similarity search. The sequence identity for total cDNA nucleotides and the inferred amino acid sequences of six domains derived from Krust et al. (1986) were analyzed using the package of DNAMAN software. The nucleotide sequences were
trans-lated to protein sequences using Translate Tool (http:// www.expasy.org/tools/dna.html) and aligned using the Clustal W program (http://www.ebi.ac.uk/clustalw). The phylogenetic tree was also produced by the same software in which the distance matrix was calculated using the Neighbor-Joining algorithm with the PAM matrix model. Tissue specimens and RT-PCR
Total RNA was extracted using the Trizol reagent (Gibco-BRL, Gaithersburg, MD, USA) from brain, eye, heart, liver, intestine, ovary, and testes of six male and six female Wsh. PuriWed total RNA was reverse transcribed with an oligo(dT) primer and M-MLV reverse transcriptase (Toy-obo). The expression levels of diVerent subtypes were PCR ampliWed using gene-speciWc primer sets (see Fig.1) which span mainly the E domain for vbER, E/F domain junction vbER1, and A/B domain for vbER2. Expres-sion of -actin was used as the endogenous control to con-Wrm that target sequence ampliWed at the same eYciency, and the -actin primers used are 5⬘-GACATCAAGGAGA AGCTGTGC-3⬘ and 5⬘-TCCAGACGGGGTATTTACG Fig. 1 The cloning strategy for
three ER cDNAs, including
vbER, vbER1 and vbER2, in
the cyprinid Wsh (V. barbatulus) using RT-PCR and 5⬘/3⬘ RACE. The positions of the structural domains relative to the putative open reading frames are marked as grey bars. The lengths of cor-responding fragments obtained are shown in base pairs (bps).
Arrows indicate the location and
direction of primers for cloning procedures
C-3⬘. The PCR condition was set to run 35 cycles at 94°C for 30 s for denaturing, 58°C for 30 s for annealing, and 72°C for 40 s for extension. The RT-PCR for -actin was used to normalize the viability produced by enzyme eYciency in all experiments, which were performed in triplicate. A number of controls were performed to ensure proper PCR ampliWcation. Negative controls consisting of no template and PCR performed on samples not subjected to reverse transcription were run in every test. The PCR amplicons were electrophoresed on a 1.5% agarose gel and the bands were visualized by ethidium bromide staining. The staining images were obtained by high-resolution camera and the band densities were calculated by Quanti-tyOne software (Bio-Rad).
Statistical analysis
Statistical analyses were performed using SigmaStat 2.0 software (Jandell ScientiWc). DiVerences in mRNA expression for the three ER subtypes among diVerent tis-sues were analyzed by ANOVA with all pairwise compari-sons performed by the Tukey Test.
Usage of common names
Common names were used for convenience and referred to their oYcial taxonomy as the following: sea bream, Sparus
auratus; largemouth bass, Micropterus salmoides; sea bass, Dicentrarchus labrax; eelpout, Zoarces viviparus; killiWsh, Fundulus heteroclitus; rainbow trout, Oncorhynchus mykiss; channel catWsh, Ictalurus punctatus; goldWsh, Car-assius auratus; zebraWsh, Danio rerio; fathead minnow, Pimephales promelas; Atlantic croaker, Micropogonias undulatus; medaka, Oryzias javanicus; carp, Cyprinus carpio; Japanese eel, Anguilla japonica.
Results
Sequence analysis
We cloned the full-length cDNAs for ER, ER1 and ER2 from livers of V. barbatulus using consecutive techniques of PCR ampliWcation by degenerate primers designed to match the conserved core regions and 5⬘-RACE/3⬘-RACE Table 1 The sequences and the relative positions of oligonucleotide primers used for the cloning the full-length cDNAs of vbER, vbER1 and
vbER2
Primer Target gene Cloning step Primer sequence (5⬘!3⬘) Location
1 vbER
vbER1 vbER2
Conserved core region CA(G/A)GG(T/A)CACAATGA(T/C)TA(C/T)AT 830–849(F) 679–698(F) 633–652(F)
2 vbER
vbER1 vbER2
Conserved core region TG(C/G)TCCATGCCTTTGTT(A/G)CT 1,745–1,764(R) 1,579–1,598(R) 1,560–1,579(R) 3 vbER vbER2 5⬘ RACE CATCATGCCCACTTCATAGCAC 922–943(R) 725–746(R)
4 vbER 5⬘ RACE CCAACACCTGCCTGCTGAGA 626–645(R)
5 vbER 3⬘ RACE TGTACTCTGGATCAAGAGCCG 687–707(F)
6 vbER 3⬘ RACE GTCAGTGCTTTATGTATGCCTC 1,106–1,127(F)
7 vbER 3⬘ RACE TCATTCTGCTCCAGTCCAGT 1,571–1,590(F)
8 vbER1 5⬘ RACE ACCATCACCATCCAGTTGCTG 477–497(R)
9 vbER1 3⬘ RACE GAAACTCATGTTCTCACCTGACC 1,208–1,230(F)
10 vbER1 3⬘ RACE CAGCAACAGTCCATCCGGCT 1,500–1,519(F)
11 vbER1 3⬘ RACE CATCGAGTGGACATGGACACAG 1,833–1,854(F)
12 vbER2 5⬘ RACE CAAAGAGGTAGAAGTCTCCTCT 546–567(R)
13 vbER2 3⬘ RACE CTCTCTCGCAAGTACAGTCT 35–54(F)
14 vbER2 3⬘ RACE CGTCGGAGGGAGGAGAGGAGC 1,412–1,432(F)
15 vbER2 3⬘ RACE CCCAAAGAGAGCAAAGCTGTC 1,720–1,741(F)
16 vbER Tissue PCR GGCTCGCTTCCGTAGTCTCA 1,489–1,508(F)
17 vbER Tissue PCR TGCTGCTGGTTGTGGGTGTA 1,897–1,916(R)
18 vbER1 Tissue PCR GTCAACCATGAAGAGAAAAAAC 1,583–1,604(F)
19 vbER1 Tissue PCR CCCTACATTGGAAAAGCGGCA 1,923–1,943(R)
20 vbER2 Tissue PCR TCTCGCAAGTACAGTCTACGAA 38–59(F)
techniques for the terminal extension (Fig.1). Following the deWnition of oYcial nomenclature of nuclear receptors (Nuclear Receptors Nomenclature Committee 1999) based on results of sequence alignments, the deduced amino acid sequences were 612 residues for vbER; 612 residues for
vbER1, and 558 residues for ER2. The sequences were
deposited in GenBank with the accession numbers AJ547632 (vbER), AJ314603 (vbER1) and AJ547633 (vbER2). Interestingly, the vbER possessed a putative internal ATG (at position 132 bp downstream of the Wrst ATG) co-aligning with the translation starts of ER from goldWsh and zebraWsh, whereas the most 5⬘ ATG producing a longer form aligned with the translation starts of ER from rainbow trout, sea bass, and channel catWsh (Fig.2).
The highest identities of the three subtypes showed that
vbER is 93% similar with minnow ER, vbER1 is 92%
similar with goldWsh ER2, and vbER2 is 95% similar with carp ER; overall of 88–90% with zebraWsh. For inter-subtype sequence comparison within V. barbatulus, there was 42% identity between vbER and vbER1, 41% between vbER and vbER2, and 50% between vbER1 and vbER2. The shorter sequence of vbER than vbER1 and vbER2 was also observed in other teleosts (Filby and Tyler 2005; Pakdel et al. 1990). The vbERs contained the
ER signature domains that separated them from other
clas-ses of nuclear receptors. As expected, there was 80–91 and 57–69% identity, respectively, in the conserved domains C and E/F between vbERs and human ERs.
We then examined the conservation of functional resi-dues (Fig.3). Four residues, L349, M421, Y526, and C530, important for E2 ligand binding (Hawkins and Thomas
2004; Filby and Tyler 2005), showed subtype-speciWc
sub-Fig. 2 The optimal alignment of 5⬘-terminal amino acids for diVerent
ER subtypes between the cyprinid Wsh (V. barbatulus) in this study and
other organisms. The sequences used are from goldWsh (gfER; AY055725), zebraWsh (zfER; BAB16893); rainbow trout (rtER; AJ242740), channel catWsh (ccER; AF253505), sea bass (sbER;
AJ505009), medaka (mdER; D28954), Oreochromis aureus (orER; CAA63774); Xenopus laevis (xeER; P81559), chicken (chER; X03805), human (hER; P03372), mouse (mER; NM_007956), and rat (rER; NM_012689). Asterisks indicate the conserved residues shared in these species. The possible initiator methionines (M) are underlined
Fig. 3 Alignment of amino acid sequences of vbER, vbER1,
vbER2 with human ER
sub-types (hER and hER). The consensus residues are marked by asterisks at the bottom. The functional domains from A to F are annotated with broken
ar-rows. The eight-cysteine
resi-dues consisting of two zinc-Wnger motifs are designated by
Wlled circles. The P- and D-box,
the AF-2, the potential CK-II, and PKC phsophorylation sites are boxed. The tyrosine kinase phosphorylation site is marked with Tyr. The functional resi-dues presented in three vbER subtypes are also identiWed in term of E2 dependent activation (open triangle) and the E2 ligand binding (arrows pointing
down-ward) as proposed by human ERs
stitution such that ER, ER1 and ER2 display particular residues in the aligned positions. The two residues, M517, and Y526, important for ligand-dependent transactivation (Ekena et al 1996) appeared to show species-speciWc substitution such that ER exhibits a M517L change in
V. barbatulus, while there is a M517V change in Perciformes.
Phylogenetic analysis
To elucidate how these vbERs compare with their verte-brate orthologs, 42 related ERs (in amino acid sequences) of species including Wsh and mammals were collected to construct a phylogenetic tree (Fig.4). Human
estrogen-related receptor (ERR) was used as an outgroup to root the tree since ERR is an orphan nuclear receptor deviating from
ERs for their constitutive activities without a known ligand
(Gaillard et al. 2007). Most nodes of this phylogenetic tree were well supported and showed the evolutionary relation-ship in the generally accepted taxonomic groupings. Com-mon trends were found such that two main clades of ER and ER subtypes constituted the Wrst separation and each subtype clade was further divided into sister clades includ-ing teleost ERs and mammal ERs. The teleost ER clade showed a further duplication in ER to produce ER1 and
ER2 (or ER), as was observed by others
(Robinson-Rech-avi et al. 2001). The vbER, vbER1 and vbER2 pos-Fig. 4 Molecular phylogeny of
vbER, vbER1 and vbER2
based on protein sequences. The deduced amino acid sequence of
vbER subtypes were aligned
with ER proteins from teleost Wsh and representative mammals with sequences available. Hu-man ERR is used as an outgroup to root the tree. NCBI database accession numbers of the se-quences are indicated in brack-ets. Numbers at nodes are support in percentage of 1,000 bootstrap replicates
sessed lineages within the Euteleostei, were grouped together with their Cypriniformes relatives including gold-Wsh, carp and zebragold-Wsh, and branched out from Perciformes including bass, croaker, seabream, killiWsh and medaka. The results of phylogenetic analysis were consistent with the results of sequence identity analysis from multiple sequence alignment, indicating that target species exhibit-ing close resemblance in sequence of vbER paralogs sup-ported the relationship of V. barbatulus in Euteleostei phylogeny.
Tissue distributions of vbER, vbER1 and vbER2 The tissue distribution of the three ER subtypes in male and female Wsh was investigated by semi-quantitative RT-PCR technique (Fig.5). The expression levels of ER mRNA were normalized against that of -actin to eliminate the sporadic variation caused by diVerences in enzyme eYciency. Expression of the vbERs was not conWned to reproductive tissues. Moderate (0.2–0.7-fold of -actin) expression was observed in brain, eye, heart, liver, intestine and gonads for all vbERs. The highest transcription level of
vbER was found in liver among six tissues in male and
female Wsh. The vbER1 was detected most strongly in liver, followed by intestine, then gonad and brain, with the lowest expression in heart and eye, in both males and females. The vbER2 expressed most highly in liver, intes-tine and gonad. In general, the highest expression levels of
vbER and vbER1 were found in liver, and of vbER2 in
intestine. The relative expression of each vbER subtype in male tissues mirrored expression levels in females.
Discussion
This study presents the cloning of members of the estrogen receptor family and the expression of their mRNA in adult tissues of the cyprinid Wsh V. barbatulus. The fact that the highest identities were found in ERs of goldWsh and zebraWsh matches well with the close taxonomic grouping of goldWsh and zebraWsh with V. barbatulus in the Cyprini-formes. This also conWrmed that the design of teleost degenerate primers is eVective. For inter-subtype sequence comparison, there was 42–50% identity between vbER and vbER, indicating that these ERs are from diVerent loci of the genome, making vbER1 and vbER2 unlikely to be alleles on the same locus, or products of alternative splic-ing. These vbER genes are functional as shown in our recent study (Fu et al. 2007) in which we explored the tran-scriptional abilities of vbERs transformed into yeast expres-sion vector to detect the potential estrogenic eVects of xenoestrogens.
Putative protein functional sites for vbERs showed con-sistency with all ERs. Regions that are conserved in all
vbERs are cysteine residues for two zinc Wngers, P-box,
D-box, and a cAMP site in the DBD domain, an AF-2 site, and a PKC phosphorylation site in the LBD domain (Fig.3). The P- and D-boxes were shown to be crucial for
Fig. 5 The tissue distributions of vbER, vbER1, and vbER2 using semi-quantitative RT-PCR. Gene-speciWc primers for each ER subtype were used to investigate the relative expression levels of vbER paralogs in males (the upper panel) and females (the lower panel) with -actin as an internal control. The tissues were collected from brain (B), eye (E),
heart (H), liver (L), intestine (I), testis (T), and ovary (O). DiVerent
let-ters above the bars indicate signiWcant diVerences in levels of ER
tran-scriptions. Data are shown as mean § standard deviation (n = 6) from six males and six females Wsh after normalization to -actin activity
DNA-binding by Härd and Gustafsson (1993). Conserva-tion in aspects of DNA binding speciWcity, ligand-depen-dent transcriptional activation, and kinase regulation for the three vbERs is hence inferred. The functional signiWcance of PKC sites in all ERs was shown by Cho and Katzenel-lenbogen (1993) in that activation of PKC markedly enhances ER-mediated transcriptional activation in a ligand-dependent manner. As for subtype-speciWc conser-vation, the putative MAPK phosphorylation site in the A/B domain were conserved only in the ER subtype both in sequence and position, as observed by others (Kato et al.
1995; Socorro et al. 2000). The MAPK pathway was reported capable of inXuencing ligand-independent tran-scriptional activity of ER in both mammalian ER and ER (Lannigan 2003). The potential tyrosine (Tyr) kinase phos-phorylation sites (KGMEHLY) were found uniquely in
vbER and casein-kinase II phosphorylation site (CK-II)
only in vbER subtypes, consistent with observations of others (Le GoV et al. 1994). These phosphorylation sites suggest that vbER subtypes might adopt diVerent functions coupled with distinctive regulation mechanisms.
In mammals, transcription variants have arisen for ER from alternative usage of exons (reviewed by Herynk and Fuqua 2004). In human, usage of internal initiator methio-nine (ATG) generates a shorter form of hER without exon 1 with defect function in domain A/B. The short form ER was reported to exhibit dominant negative eVects by form-ing a heterodimer with the longer (wild-type) ER that interfered with the AF-1 transcription activity of the ER dimer in osteoblasts (Sanyal et al. 2005). It was suggested that the short form in trout ER exhibits 15–25% of the total receptor activity in a cell-, promoter-speciWc and hor-mone-independent manner (Nagler et al. 2000). Transcrip-tional variants from each vbER subtype of this study were not detectable.
The conservation of putative functional residues in the core region of the E domain was examined, and showed subtype- and even species-speciWc substitution. First, resi-dues M421, Y526, and C530, (Hawkins and Thomas 2004; Filby and Tyler 2005) are important for ligand binding. We found that the three residues substituted as a set in a sub-type-speciWc manner such that the (M, Y, C) residue set is substituted to be (I, S, R) in ER1; while (F, H, M) is found in ER2. Crystal structural evidence showed that inter-changes of hydrophobic M, F, and I residues in hER M421 could mimic other subtypes, resulting in changes of binding aYnities toward diethylstilbestrol and tamoxifen (Hawkins and Thomas 2004). Secondly, residue M517, which is important for ligand-dependent transactivation (Ekena et al.
1996) showed that ER exhibited a M517L change in V.
barbatulus, and a M517V change in Percomorpha.
While the sequence of vbERs shared greater similarity with data from minnow ER, goldWsh ER2 and carp ER,
the expression proWle of vbERs resembled more closely results from fathead minnow in the family Cyprinidae. The highest expression in liver for vbER and vbER1 and in intestine for vbER2 matched subtype expression patterns in fathead minnow (Filby and Tyler 2005). Although gold-Wsh ER1, zebragold-Wsh ER1 and ER2, and gilthead sea-bream ER were mainly expressed in gonads, the general expression in heart, liver, intestine and kidney showed largely overlapping expression patterns with our cyprinid Wsh V. barbatulus (Socorro et al. 2000). The overlapping but not identical expression patterns of the vbERs might suggest that subtype-specialization has occurred. For exam-ple, paralogs of nuclear receptors were shown to adopt sep-arate expression patterns, which might lead to new functions. PPAR (peroxisome proliferator-activated recep-tor alpha) was expressed in a large spectrum of but not all tissues, PPAR was expressed ubiquitously, and PPAR was expressed only in fat tissues (Michalik et al. 2006). We also noticed that moderate (0.2–0.7-fold of -actin) expres-sion was observed in all tissues inspected for all vbERs. Likewise, expression of ER1 and ER2 in sea bass was widespread, with similar levels among tissues (Halm et al.
2004). The similar levels of expression are probably because the technique prevents sharp distinction of fold change under the nearly saturated ampliWcation of PCR. The other possibility was that when non-genomic mechanisms were examined, activity enhancement instead of changes in amounts served as the critical index for ER function.
When the phylogenetic tree of vbERs was analyzed, there was consistency with other trees in euteleostei Wsh ER evolution in that no vbER subtype was found to redirect into clades of diVerent families. Each vbER was placed in the same clade with, and sister to its goldWsh ortholog. Gen-erally, the vbER, vbER1 and vbER2 that had lineages within the Euteleostei were grouped together with their Cypriniformes relatives and branched out from the Perci-formes. The position of V. barbatulus in Euteleostei phy-logeny supports the resultant target species by sequence alignment. The presence of three duplicated vbERs was consistent with the hypothesis that a single primitive inver-tebrate ERR underwent gene duplication events, one after divergence between vertebrates and Amphioxus, and one before the divergence between lamprey, hagWsh and gnat-hostomes (Ohno 1999).
In conclusion, we present molecular cloning and tissue expression analysis of three estrogen receptor subtypes,
vbER, vbER1 and vbER2, from the cyprinid Wsh V. bar-batulus. The sequence alignment and phylogenetic analysis
reconWrmed the evolutionary relationship of V. barbatulus within the Cypriniformes. The overlapping but not identical expression patterns of vbERs suggest that subtype-special-ization may have occurred. Here, we demonstrate that the cloning of ER subtypes from wildlife using PCR is feasible
in that temporal and spatial observations are consistent with those from phylogeny analysis and crystal structural inves-tigation by others. Furthermore, we were able to show that estrogenic chemicals aVect a sentinel species at the molecu-lar level.
Acknowledgments This work was supported by research grant NSC 91-2211-E-009-034 from the National Science Council of Taiwan, ROC, to C.-Y. Chen.
References
AshWeld LA, Pottinger TG, Sumpter JP (1998) Exposure of female juvenile rainbow trout to alkylphenolic compounds results in modiWcations to growth and ovosomatic index. Environ Toxicol Chem 3:679–686
Barkhem T, Carlsson B, Nilsson Y, Enmark E, Gustafsson J, Nilsson S (1998) DiVerential response of estrogen receptor alpha and estrogen receptor beta to partial estrogen agonists/antagonists. Mol Pharmacol 54:105–112
Bjerselius R, Lundstedt-Enkel K, Olsen H, Mayer I, Dimberg K (2001) Male goldWsh reproductive behaviour and physiology are severe-ly aVected by exogenous exposure to 17-estradiol. Aquat Toxi-col 53:139–152
Cho H, Katzenellenbogen BS (1993) Synergistic activation of estrogen receptor-mediated transcription by estradiol and protein kinase activators. Mol Endocrinol 7:441–452
Ekena K, Weiss KE, Katzenellenborgen JA, Katzenellenbogen BS (1996) IdentiWcation of amino acids in the hormone binding do-main of the human estrogen receptor important in estrogen bind-ing. J Biol Chem 271:20053–20059
Enmark E, Gustafsson JA (1999) Oestrogen receptors: an overview. J Intern Med 246:133–138
Filby AL, Tyler CR (2005) Molecular characterization of estrogen receptors 1, 2a, and 2b and their tissue and ontogenic expression proWles in fathead minnow (Pimephales promelas). Biol Reprod 73:648–662
Fu KY, Chen CY, Chang WM (2007) Application of a yeast estrogen screen in non-biomarker species Varicorhinus barbatulus Wsh with two estrogen receptor subtypes to assess xenoestrogens. Toxicol In Vitro 21:604–612
Gaillard S, Dwyer MA, McDonnell DP (2007) DeWnition of the molec-ular basis for estrogen receptor-related receptor-alpha-cofactor interactions. Mol Endocrinol 21:62–76
Garcia-Reyero N, Grau E, Castillo M, Lopez de Alda MJ, Barcelo D, Pina B (2001) Monitoring of endocrine disruptors in surface waters by the yeast recombinant assay. Environ Toxicol Chem 20:1152–1158 Halm S, Martinez-Rodriguez G, Rodriguez L, Prat F, Mylonas CC,
Carrillo M, Zanuy S (2004) Cloning, characterisation, and expres-sion of three oestrogen receptors (ERalpha, ERbeta1 and ERbe-ta2) in the European sea bass, Dicentrarchus labrax. Mol Cell Endocrinol 223:63–75
Härd T, Gustafsson JA (1993) Structure and function of the DNA-bind-ing domain of the glucocorticoid receptor and other members of the nuclear receptor supergene family. Acc Chem Res 26:644–650 Hawkins MB, Thomas P (2004) The unusual binding properties of the third distinct estrogen receptor subtype ERba are accompanied by highly conserved amino acid changes in the ligand binding do-main. Endocrinology 145:2968–2977
Hawkins MB, Thornton JW, Crews D, Skipper JK, Dotte A, Thomas P (2000) IdentiWcation of a third distinct estrogen receptor and reclassiWcation of estrogen receptors in teleosts. Proc Natl Acad Sci USA 97:10751–10756
Herynk MH, Fuqua SA (2004) Estrogen receptor mutations in human disease. Endocr Rev 25:869–898
Kato S, Endoh H, Masuhiro Y, Kitamoto T, Uchiyama S, Sasaki H, Mas-ushige S, Gotoh Y, Nishida E, Kawashima H, Metzger D, Chambon P (1995) Activation of the estrogen receptor through phosphoryla-tion by mitogen-activated protein kinase. Science 270:1491–1494 Krust A, Green S, Argos P, Kumar V, Walter P, Bornert J-M,
Cham-bon P (1986) The chicken oestrogen receptor sequence: homol-ogy with v-erbA and the human oestrogen and glucocorticoid receptors. EMBO J 5: 891–897
Kuiper GG, Carlsson B, Grandien K, Enmark E, Haggblad J, Nilsson S, Gustafsson JA (1997) Comparison of the ligand binding spec-iWcity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology 138:863–870
Lannigan DA (2003) Estrogen receptor phosphorylation. Steroids 68:1–9
Le GoV P, Montano MM, Schodin DJ, Katzenellenbogen BS (1994) Phosphorylation of the human estrogen receptor. IdentiWcation of hormone-regulated sites and examination of their inXuence on transcriptional activity. J Biol Chem 269:4458–4466
Ma CH, Dong KW, Yu KL (2000) cDNA cloning and expression of a novel estrogen receptor beta-subtype in goldWsh (Carassius
aura-tus). Biochim Biophys Acta 1490:145–152
Menuet A, Pellegrini E, Anglade I, Blaise O, Laudet V, Kah O, Pakdel F (2002) Molecular characterization of three estrogen receptor forms in zebraWsh: binding characteristics, transactivation proper-ties, and tissue distributions. Biol Reprod 66:1881–1892 Michalik L, Auwerx J, Berger JP, Chatterjee VK, Glass CK, Gonzalez
FJ, Grimaldi PA, Kadowaki T, Lazar MA, O'Rahilly S, Palmer CN, Plutzky J, Reddy JK, Spiegelman BM, Staels B, Wahli W (2006) International Union of Pharmacology. LXI. Peroxisome proliferator-activated receptors. Pharmacol Rev 58:726–741 Nagler JJ, Krisfalusi M, Cyr DG (2000) QuantiWcation of rainbow
trout (Oncorhynchus mykiss) estrogen receptor-alpha messenger RNA and its expression in the ovary during the reproductive cy-cle. J Mol Endocrinol 25:243–251
Nilsson S, Makela S, Treuter E, Tujague M, Thomsen J, Andersson G, Enmark E, Pettersson K, Warner M, Gustafsson JA (2001) Mech-anisms of estrogen action. Physiol Rev 81:1535–1565
Nuclear Receptors Nomenclature Committee (1999) A uniWed nomencla-ture system for the nuclear receptor superfamily. Cell 97:161–163 Ohno S (1999) The one-to-four rule and paralogues of sex-determining
genes. Cell Mol Life Sci 55:824–830
Pakdel F, Le Gac F, Le GoV P, Valotaire Y (1990) Full-length se-quence and in vitro expression of rainbow trout estrogen receptor cDNA. Mol Cell Endocrinol 71:195–204
Robinson-Rechavi M, Marchand O, Escriva H, Bardet PL, Zelus D, Hughes S, Laudet V (2001) Euteleost Wsh genomes are character-ized by expansion of gene families. Genome Res 11:781–788 Sanyal A, Riggs BL, Spelsberg TC, Khosla S (2005) Bone marrow
stromal cells express two distinct splice variants of ER-alpha that are regulated by estrogen. J Cell Biochem 94:88–97
Socorro S, Power DM, Olsson PE, Canario AV (2000) Two estrogen receptors expressed in the teleost Wsh, Sparus aurata: cDNA clon-ing, characterization and tissue distribution. J Endocrinol 166:293–306
Sonnenschein C, Soto AM (1998) An updated review of environmental estrogen and androgen mimics and antagonists. J Steroid Bio-chem Mol Biol 65:143–150
Tremblay GB, Tremblay A, Copeland NG, Gilbert DJ, Jenkins NA, Labrie F, Giguere V (1997) Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor beta. Mol Endocrinol 11:353–365
Yuan SY, Liu C, Liao CS, Chang BV (2002) Occurrence and microbial degradation of phthalate esters in Taiwan river sediments. Che-mosphere 49:1295–1299
