O R I G I N A L P A P E R
Lysophosphatidic acid-induced interleukin-1
b expression
is mediated through G
i/Rho and the generation of reactive
oxygen species in macrophages
Chi-Lun ChangÆ Mu-En Lin Æ Hsien-Yeh Hsu Æ Chao-Ling Yao Æ Shiaw-Min HwangÆ Chien-Yuan Pan Æ Chi-Yen Hsu Æ Hsinyu Lee
Received: 27 August 2007 / Accepted: 12 November 2007 / Published online: 25 November 2007 Ó National Science Council Taipei 2007
Abstract Lysophophatidic acid (LPA), a low-molecular-weight lysophospholipid enriched in platelets and mildly oxidized low-density lipoproteins, is known to regulate inflammation and atherosclerosis by binding to its cognate receptors. In this study, we reported that LPA upregulated interleukin-1b (IL-1b) expression in mouse J774A.1 mac-rophages. By using pharmacological inhibitors, it was suggested that Gi/Rho activation and subsequent reactive
oxygen species (ROS) production were involved in IL-1b induction. In addition, IL-1b induction by LPA was also observed in human primary macrophages. In summary, LPA is involved in the processes of inflammation by affecting macrophage behavior.
Keywords LPA Macrophage IL-1b ROS Inflammation
Introduction
Lysophosphatidic acid (LPA) is a simple lysophospholipid with a variety of biological activities. Sources of LPA are mainly platelets and mildly oxidized low-density lipoproteins (mox-LDLs) [8, 30]. The biological effects elicited by LPA are mediated through recognition of LPA by a series of G protein-coupled LPA receptors, LPA1,
LPA2, and LPA3, encoded by endothelial differentiating
genes [1].
In human endothelial cells, LPA facilitates wound healing; cell proliferation; cell migration; ICAM-1, inter-leukin-8 (IL-8) and MCP-1 expressions; matrix metalloprotease-2 (MMP-2) activation; and cell invasion [18,20,21,32]. Recent studies demonstrated that LPA is an important regulator of atherosclerosis by activating human monocytic cells [4, 10] and inducing neointimal formation in a rat carotid artery model [34]. In addition, macrophages are also involved in the process of inflam-mation and atherosclerosis [22]. However, the relation-ship between LPA and macrophages is not clearly understood.
The present study demonstrated that in J774A.1 mac-rophages, LPA upregulated IL-1b expression by activating Rho- and Gi-dependent pathways. In addition,
LPA-induced ROS production, which is downstream of Gi/Rho
signals, was also involved in the production of IL-1b. Moreover, IL-1b was also elevated by LPA in human macrophages derived from umbilical cord blood. These results suggest that LPA regulates inflammation-related functions in both mouse and human macrophages.
C.-L. Chang M.-E. Lin C.-Y. Pan C.-Y. Hsu H. Lee Institute of Zoology, National Taiwan University, Taipei, Taiwan
C.-Y. Pan H. Lee (&)
Department of Life Science and Institute of Zoology, National Taiwan University, 1 Roosevelt Rd. Section 4, Taipei 106, Taiwan
e-mail: [email protected]
H.-Y. Hsu
Institute of Biotechnology in Medicine, National Yang-Ming University, Taipei, Taiwan
C.-L. Yao S.-M. Hwang
Bioresource Collection and Research Center, Food Industry Research and Development Institute, Hsinchu, Taiwan
Materials and methods Reagents
1-Oleoyl-lysophosphatidic acid (LPA), pertussis toxin (PTx), actinomycin D, and N-acetylcysteine (NAC) were purchased from Sigma (St. Louis, MO). Diphenyleneiod-onium chloride (DPI) was purchased from Tocris Cookson (Ellisville, MO). The C3 exozyme (C3) was purchased from BIOMOL (Plymouth Meeting, PA). The monoclonal rat anti-mouse IL-1b antibody was obtained from R&D System (Minneapolis, MN). TRIzol, the Superscript II kit, and dihydrorhodamine 123 (DHR-123) were purchased from Invitrogen (Grand Island, NY).
Cell line and culture
The murine macrophage cell line, J774A.1, was obtained from American Type Culture Collection (ATCC, Manas-sas, VA). Cells were cultured in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS, HyClone, Logan, UT) at 37°C under a humidified atmosphere of 5% CO2.
Umbilical Cord Blood (UCB) sample collection, Mononuclear Cell (MNC) processing, and macrophage generation
Term UCB was harvested with a standard 250-ml blood bag (Terumo, Shibuya-ku, Tokyo, Japan) with informed consent and was processed within 24 h. Buffy-coat cells were obtained, and then these cells were layered onto a Ficoll–Paque solution (q = 1.077 g/ml, Amersham
Biosciences, Uppsala, Sweden) at 7009g for 40 min. For macrophage generation, MNCs were incubated with mac-rophage induction medium (1:1 mixture of RPMI 1640 and Panserin 401 medium) supplemented with a cocktail of cytokines (25 ng/ml of GM-CSF and M-CSF) and 10% FBS. Cells were subcultured for experiments 1 week after induction. The purity of the macrophages was confirmed by flow cytometry.
LPA treatment
LPA, at 1 mM, was prepared in methanol and stored at -20°C. Cells were cultured at 75% confluence in complete medium, and then starved in serum-free medium overnight. LPA was added to serum-free RPMI 1640 containing 0.005% fatty acid-free bovine serum albumin (BSA) as a carrier.
RNA Isolation, Reverse-transcription Polymerase Chain Reaction (RT-PCR), and Real-time PCR analysis Total cellular RNA was extracted from cells using the TRIzol reagent. Complementary DNAs were synthesized with an oligo-dT primer using a Superscript II kit. PCR products were resolved on 1.5% agarose gels stained with ethidium bromide and then photographed. Real-time PCR was carried out using an iCycler iQ real-time detection system (Bio-Rad, Hercules, CA) with iQ SYBR Green Supermix (Bio-Rad). The specificity was confirmed by melting-curve detection following the real-time PCR reaction. All gene-specific oligonucleotides sequences, annealing temperatures (Tm), and cycle numbers are described in Table1.
Table 1 Primer sets
Primer Sequences (F, forward; R, reverse) Tm (°C) Cycle Size (bp) Human F: GGTGGTCTCCTCTGACTTCAAC 60 40 215 GAPDH* R: TCTCTCTTCCTCTTGTGTTCTTG Human F: CCGACCACCACTACAGCAAGG 60 40 88 IL-1b* R: GGGCAGGGAACCAGCATCTTC Mouse F: ACCACAGTCCATGCCATCAC 62 20 452 GAPDH R: TCCACCACCCTGTTGCTGTA Mouse F: TTGACGGACCCCAAAAGATG 62 30 204 IL-1b R: AGAAGGTGCTCATGTCCTCA Mouse F: AAGGCTGTGGGCAAGGTCATC 60 40 105 GAPDH* R: CAGGCGGCACGTCAGATCC Mouse F: GCCTCGTGCTGTCGGACC 60 40 114 IL-1b* R: TGTCGTTGCTTGGTTCTCCTTG
Western blot analysis
Cells were lysed on ice with RIPA buffer. Samples were separated by 12% sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinyli-dene fluoride (PVDF) membranes (Millipore, Bedford, MA). The immunoreactive proteins were visualized by enhanced chemiluminescence (Pierce, Rockford, IL) and quantified using TotalLab 2.01 software (Nonlinear, Durham, NC).
Intracellular Reactive Oxygen Species (ROS) measurement
Intracellular ROS were detected by flow cytometry using DHR-123 as a fluorescent probe for ROS. Starved cells were loaded with 10 lM DHR-123 in PBS for 30 min. Loaded cells were washed with PBS, followed by incubation with the indicated treatments for 30 min. The fluorescence intensities of different treatments were determined in 10,000 cells using a CyFlow flow cytometry (Partec, Muester, Germany). For quantification, the means of the histograms were calculated using the Flowmax program (Partec).
Enzyme-linked Immunosorbent Assay (ELISA) for human IL-1b
IL-1b of human macrophages was measured with an ELISA kit from Cayman (Ann Arbor, MI). In brief, 1 9 106cells were seeded in a 6-cm dish with complete culture medium for 24 h. Cells were starved overnight, followed by treat-ment with 5 lM LPA or vehicle in a volume of 1.5 ml for 8 h. IL-1b levels of different treatments were assessed immediately after the supernatants were collected.
Statistical analysis
Each result was obtained from at least three independent experiments and is presented as the mean ± SD. Data were statistically analyzed using one-way analysis of variance (ANOVA), followed by Fisher’s protected least-significant difference test.
Results
LPA-induced IL-1b expression in J774A.1 cells
Based on our preliminary studies, we demonstrated that LPA induced IL-1b expression in mouse peritoneal mac-rophages [19]. Thus, we further examined the detailed
effects of LPA in mouse J774A.1 macrophages. By using the RT-PCR analysis, we observed that IL-1b mRNA levels were upregulated by LPA in concentration- and time-dependent manners (Fig.1a, c, upper panel). The quantified results by real-time PCR analysis showed that IL-1b mRNA was significantly induced by 1 lM LPA, and the expression level peaked with 5 lM LPA treatment (Fig. 1a, lower panel). Furthermore, IL-1b mRNA expression was sub-stantially induced by 2 h of LPA treatment (Fig.1c, lower panel). At the protein level, LPA induced IL-1b protein expression in concentration- and time-dependent manners. Results from the dose-response experiment revealed that IL-1b protein was significantly induced by 1 lM LPA, and the induction peaked with 5 lM LPA treatment (Fig. 1b). On the other hand, time-course experiments showed that IL-1b protein was significantly enhanced at 4 h (Fig.1d).
LPA-induced IL-1b Is mediated through Gi-, Rho-, and
transcription-dependent Pathways
The effects of LPA are mainly mediated through G protein-coupled receptors, which activate downstream G proteins (reviewed in [2]). As shown in Fig.2a, IL-1b induction by LPA was significantly attenuated in the presence of 1 lg/ml C3 or 15 ng/ml PTx [20], which are known to block Rho (downstream of G12)- and Gi-dependent signals.
On the other hand, IL-1b could be regulated either at both transcriptional or post-translational levels [7]. By using actinomycin D [31], a general translation inhibitor, we demonstrated that LPA-induced IL-1b protein expression was completely suppressed (Fig.2b). These results indi-cated that LPA regulates IL-1b expression is mostly at the transcriptional levels.
ROS are involved in LPA-enhanced IL-1b expression ROS play important roles in inflammatory processes, and might function as secondary messengers in multiple sig-naling transduction pathways [9, 16]. In the presence of LPA, ROS were enhanced in J774A.1 cells (Fig.3a). Additionally, ROS induction by LPA in mouse RAW264.7 macrophages and human primary macrophages was also observed (data not shown). On the other hand, C3 and PTx partially inhibited LPA-induced ROS production (Fig. 3b). To further assessed the relationship between IL-1b and LPA’s enhancement of ROS, experiments with NAC (an antioxidant) and DPI (an inhibitor of ROS-generating enzyme, NADPH oxidase) were conducted. In the presence of 10mM NAC or 10 lM DPI [4,14], LPA-enhanced ROS were entirely suppressed (Fig.3c). Likewise, LPA-induced IL-1b was significantly inhibited when cells were pretreated
with NAC or DPI, which indicated that the induction of IL-1b is mediated through ROS generation (Fig.3d).
LPA induces IL-1b expression in human macrophages To examine if the effects of LPA are consistent in the human system, human macrophages derived from
umbilical cord blood were used. At the mRNA level, IL-1b was elevated as early as 2 h, and the expression level was sustained by 5 lM LPA at 4 h (Fig.4a). Similar results were also observed in PMA-activated THP-1 cells (data not shown). On the other hand, the IL-1b protein was substantially enhanced from 1.21 to 2.58 pg/ml when cells were incubated with 5 lM LPA for 8 h (Fig.4b).
Fig. 2 Lysophosphatidic acid (LPA)-induced interleukin (IL)-1b(is mediated through Rho-, Gi-, and transcription-dependent pathways.
(a) Starved J774A.1 cells were pretreated with 1 lg/ml C3 or 15 ng/ ml pertussis toxin (PTx) overnight followed by 1 lM LPA treatment for 2 h. IL-1b expression levels were analyzed by real-time PCR. (b)
Starved J774A.1 cells were pretreated with 5 lg/ml actinomycin D (act) for 1 h followed by incubation with 5 lM LPA for 4 h. IL-1b protein levels were analyzed by Western blot. **P \ 0.01, ***P \ 0.001
Fig. 1 Lysophosphatidic acid (LPA) enhances interleukin (IL)-1b expression in J774A.1 cells. To examine the effects of LPA on IL-1b expression, cells were treated as indicated. At the transcriptional level, mRNA was subjected to RT-PCR and real-time PCR analysis. At the translational level, total cell lysates were collected and subjected to Western blot analysis. (a, b) Dose response of LPA-induced IL-1b expression. (c, d) Time course of LPA-induced IL-1b expression. Images of agarose gels and immunoblotting films from one representative experiment are shown here. Each bar of the histogram represents quantified results from three independent experiments and is shown as the mean ± SD. *P \ 0.05, **P \ 0.01 compared to the control level
Discussion
Only limited reports have been published describing the actions of LPA on the inflammatory functions of macro-phages. Previous studies showed that LPA induces calcium mobilization and ROS production in human monocytic cells [4,10], as well as acting as a survival factor in mouse macrophages [17]. Moreover, ROS production stimulated by LPA in other cell types has also been reported [3,29]. On the other hand, it is suggested that Gi or G12-Rho
activation is also involved in ROS production [11,15,25],
and the increased level of ROS could effectively enhance IL-1b expression in J774A.1 cells when treated with LPS [14]. Our current study provides evidence for the first time that LPA induces IL-1b expression and ROS production in both mouse and human macrophages. We also showed that LPA-induced IL-1b is affected by Gi, Rho, and ROS
inhibitors. Compared with the molecular mechanisms exerted by other stimuli, such as LPS, ligands of scavenger receptors, and thrombin [13, 14,24], LPA might act as a novel and critical modulator of IL-1b production in mac-rophages. All effects elicited by LPA discussed in this
Fig. 3 Lysophosphatidic acid (LPA)-induced interleukin (IL)-1b is mediated through reactive oxygen species (ROS) production. To determine intracellular ROS production, starved J774A.1 cells were treated as described in ‘‘Materials and methods’’. (a) Histograms from the flow cytometric analysis represent the fluorescence intensity of DHR-123 in cells treated with phosphate-buffered saline (PBS) (gray shading), 5 lM LPA (dashed line), or 10 lM LPA (black line). (b) J774A.1 cells were pretreated with 1 lg/ml C3 or 15 ng/ml pertussis
toxin (PTx) overnight followed by 10 lM LPA treatment for 30 min. (c, d) J774A.1 cells were pretreated with 10 mM NAC or 10 lM DPI for 1 h. For ROS measurement, pretreated cells were incubated with 10 lM LPA for 30 min and subjected to flow cytometric analysis (c). To evaluate IL-1b mRNA levels, pretreated cells were treated with 1 lM LPA for 2 h and mRNAs were analyzed by real-time PCR (d). **P \ 0.01, ***P \ 0.001
Fig. 4 Lysophosphatidic acid (LPA) induces interleukin (IL)-1b expression in human macrophages. Starved human macrophages derived from umbilical cord blood were treated as indicated. (a) mRNA from treated cells was harvested and subjected to real-time RT-PCR analysis. (b) Conditioned media were subjected to an ELISA analysis. *P \ 0.05, **P \ 0.01
report could be substantially observed with 1–5 lM LPA treatments, which are considered physiological concentra-tions in healthy human plasma [33]. Furthermore, local concentration of LPA could be significantly elevated in wound site and atherosclerotic lesion as a result of platelet activation and oxidized low-density lipoprotein (LDL) accumulation, respectively [30]. Therefore, the activation of macrophages by LPA present in this study might be physiologically relevant.
The proinflammatory roles of IL-1b are well charac-terized [6]. However, it was suggested that there is a dissociation between the transcription and translation of IL-1b despite mRNA being substantially synthesized [7]. Our results showed that LPA upregulates IL-1b expression at both the transcriptional and translational levels, and also showed a novel observation of IL-1b induction in human primary macrophages. The timing of IL-1b expression was also in agreement with previous reports [7, 14], which indicates the direct effects of LPA rather than indirect actions of other mediators regulated by LPA. These results suggest that LPA-induced IL-1b not only acts as an auto-crine mediator, but also activates surrounding endothelial cells at the wound site or in atherosclerotic lesions.
Several reports have suggested that macrophages derived from different species might respond inconsistently [23,27,
28]. However, our data indicated similarities of LPA effects in macrophages originating from different species, and therefore provide crucial information that mouse macro-phages might be utilized as a model in interpreting the functions of LPA. Lipid-laden macrophages, also known as foam cells, play crucial roles in the process of atheroscle-rosis, an inflammation-related disease [26]. Increased foam cell lesions in IL-1ra knockout mice have been reported [5], which indicates that the IL-1 cytokine system is essential to atherogenesis. Moreover, in human endothelial cells, IL-1b is involved in LPA-induced monocyte chemoattractant expressions of IL-8 and MCP-1, which leads to a self-augmented inflammation process [21]. However, the rela-tionship of LPA-induced IL-1b and other cytokines/ chemokines in macrophages is currently unknown. In addition to IL-1b, it was suggested that ROS are also important regulators of inflammation [9,16], and to some extent, facilitate atherogenesis by oxidation of LDL [12]. Oxidized LDL is the main source of LPA in atherosclerotic lesions [30], which might further deteriorate atherogenesis by activating macrophages. Therefore, these results provide essential information on the effects of LPA in macrophages.
Acknowledgments We appreciate Mr. Yu-Ting Kuo of the Department of Life Science, National Taiwan University for technical assistance. This work was supported by grants (NSC95-2311-B-002-018-MY2; to HL) from the National Science Council, Taiwan, and (95-EC-17-A-17-R7-0525; to SMH) from the Ministry of Economic Affairs, Taiwan.
References
1. Anliker B, Chun J (2004) Cell surface receptors in lysophos-pholipid signaling. Semin Cell Dev Biol 15(5):457–465 2. Anliker B, Chun J (2004) Lysophospholipid G protein-coupled
receptors. J Biol Chem 279(20):20555–20558
3. Chen Q, Olashaw N, Wu J (1995) Participation of reactive oxy-gen species in the lysophosphatidic acid-stimulated mitooxy-gen- mitogen-activated protein kinase kinase activation pathway. J Biol Chem 270(48):28499–28502
4. D’Aquilio F, Procaccini M, Izzi V, Chiurchiu V, Giambra V, Carotenuto F, Di Nardo P, Baldini PM (2007) Activatory Prop-erties of Lysophosphatidic Acid on Human THP-1 Cells. Inflammation 30(5):167–177
5. Devlin CM, Kuriakose G, Hirsch E, Tabas I (2002) Genetic alterations of IL-1 receptor antagonist in mice affect plasma cholesterol level and foam cell lesion size. Proc Natl Acad Sci USA 99(9):6280–6285
6. Dinarello CA (1997) Interleukin-1. Cytokine Growth Factor Rev 8(4):253–265
7. Dinarello CA (1998) Interleukin-1 beta, interleukin-18, and the interleukin-1 beta converting enzyme. Ann NY Acad Sci 856: 1–11
8. Eichholtz T, Jalink K, Fahrenfort I, Moolenaar WH (1993) The bioactive phospholipid lysophosphatidic acid is released from activated platelets. Biochem J 291(Pt 3):677–680
9. Forman HJ, Torres M (2002) Reactive oxygen species and cell signaling: respiratory burst in macrophage signaling. Am J Respir Crit Care Med 166(12 Pt 2):S4–8
10. Fueller M, Wang de A, Tigyi G, Siess W (2003) Activation of human monocytic cells by lysophosphatidic acid and sphingo-sine-1-phosphate. Cell Signal 15(4):367–375
11. Fujii T, Onohara N, Maruyama Y, Tanabe S, Kobayashi H, Fukutomi M, Nagamatsu Y, Nishihara N, Inoue R, Sumimoto H, Shibasaki F, Nagao T, Nishida M, Kurose H (2005) Galpha12/13-mediated production of reactive oxygen species is critical for angiotensin receptor-induced NFAT activation in cardiac fibro-blasts. J Biol Chem 280(24):23041–23047
12. Heinecke JW, Baker L, Rosen H, Chait A (1986) Superoxide-mediated modification of low density lipoprotein by arterial smooth muscle cells. J Clin Invest 77(3):757–761
13. Hsu HY, Chiu SL, Wen MH, Chen KY, Hua KF (2001) Ligands of macrophage scavenger receptor induce cytokine expression via differential modulation of protein kinase signaling pathways. J Biol Chem 276(31):28719–28730
14. Hsu HY, Wen MH (2002) Lipopolysaccharide-mediated reactive oxygen species and signal transduction in the regulation of interleukin-1 gene expression. J Biol Chem 277(25):22131– 22139
15. Idzko M, Laut M, Panther E, Sorichter S, Durk T, Fluhr JW, Herouy Y, Mockenhaupt M, Myrtek D, Elsner P, Norgauer J (2004) Lysophosphatidic acid induces chemotaxis, oxygen radi-cal production, CD11b up-regulation, Ca2+ mobilization, and actin reorganization in human eosinophils via pertussis toxin-sensitive G proteins. J Immunol 172(7):4480–4485,
16. Kaul N, Forman HJ (1996) Activation of NF kappa B by the respiratory burst of macrophages. Free Radic Biol Med 21(3):401–405
17. Koh JS, Lieberthal W, Heydrick S, Levine JS (1998) Lysophos-phatidic acid is a major serum noncytokine survival factor for murine macrophages which acts via the phosphatidylinositol 3-kinase signaling pathway. J Clin Invest 102(4):716–727 18. Lee H, Goetzl EJ, An S (2000) Lysophosphatidic acid and
sphingosine 1-phosphate stimulate endothelial cell wound heal-ing. Am J Physiol Cell Physiol 278(3):C612–618
19. Lee H, Liao JJ, Graeler M, Huang MC, Goetzl EJ (2002) Lyso-phospholipid regulation of mononuclear phagocytes. Biochim Biophys Acta 1582(1–3):175–177
20. Lee H, Lin CI, Liao JJ, Lee YW, Yang HY, Lee CY, Hsu HY, Wu HL (2004) Lysophospholipids increase ICAM-1 expression in HUVEC through a Gi- and NF-kappaB-dependent mechanism. Am J Physiol Cell Physiol 287(6):C1657–1666
21. Lin CI, Chen CN, Chen JH, Lee H (2006) Lysophospholipids increase IL-8 and MCP-1 expressions in human umbilical cord vein endothelial cells through an IL-1-dependent mechanism. J Cell Biochem 99(4):1216–1232
22. Linton MF, Fazio S (2003) Macrophages, inflammation, and atherosclerosis. Int J Obes Relat Metab Disord 27Suppl 3:S35–40 23. Mestas J, Hughes CC (2004) Of mice and not men: differences between mouse and human immunology. J Immunol 172(5): 2731–2738
24. Naldini A, Pucci A, Carney DH, Fanetti G, Carraro F (2002) Thrombin enhancement of interleukin-1 expression in mononu-clear cells: involvement of proteinase-activated receptor-1. Cytokine 20(5):191–199
25. Nishida M, Tanabe S, Maruyama Y, Mangmool S, Urayama K, Nagamatsu Y, Takagahara S, Turner JH, Kozasa T, Kobayashi H, Sato Y, Kawanishi T, Inoue R, Nagao T, Kurose H G (2005) alpha 12/13- and reactive oxygen species-dependent activation of c-Jun NH2-terminal kinase and p38 mitogen-activated protein kinase by angiotensin receptor stimulation in rat neonatal cardiomyocytes. J Biol Chem 280(18):18434–18441
26. Ross R (1999) Atherosclerosis-an inflammatory disease. N Engl J Med 340(2):115–126
27. Schneemann M, Schoeden G (2007) Macrophage biology and immunology: man is not a mouse. J Leukoc Biol 81(3):579
28. Schneemann M, Schoedon G (2002) Species differences in macrophage NO production are important. Nat Immunol 3(2):102 29. Sekharam M, Cunnick JM, Wu J (2000) Involvement of lipoxy-genase in lysophosphatidic acid-stimulated hydrogen peroxide release in human HaCaT keratinocytes. Biochem J 346 Pt 3: 751–758
30. Siess W, Zangl KJ, Essler M, Bauer M, Brandl R, Corrinth C, Bittman R, Tigyi G, Aepfelbacher M (1999) Lysophosphatidic acid mediates the rapid activation of platelets and endothelial cells by mildly oxidized low density lipoprotein and accumulates in human atherosclerotic lesions. Proc Natl Acad Sci USA 96(12):6931–6936
31. Witowski J, Thiel A, Dechend R, Dunkel K, Fouquet N, Bender TO, Langrehr JM, Gahl GM, Frei U, Jorres A (2001) Synthesis of C-X-C and C-C chemokines by human peritoneal fibroblasts: induction by macrophage-derived cytokines. Am J Pathol 158(4):1441–1450
32. Wu WT, Chen CN, Lin CI, Chen JH, Lee H (2005) Lysophos-pholipids enhance matrix metalloproteinase-2 expression in human endothelial cells. Endocrinology 146(8):3387–3400 33. Xu Y, Shen Z, Wiper DW, Wu M, Morton RE, Elson P, Kennedy
AW, Belinson J, Markman M, Casey G (1998) Lysophosphatidic acid as a potential biomarker for ovarian and other gynecologic cancers. Jama 280(8):719–723
34. Zhang C, Baker DL, Yasuda S, Makarova N, Balazs L, Johnson LR, Marathe GK, McIntyre TM, Xu Y, Prestwich GD, Byun HS, Bittman R, Tigyi G (2004) Lysophosphatidic acid induces neo-intima formation through PPARgamma activation. J Exp Med 199(6):763–774
