Androgen receptor promotes the migration and invasion of upper urinary
tract urothelial carcinoma cells through the upregulation of MMP9 and
COX-2
CHI-CHENG CHEN2,*,TENG-FU HSIEH2,*, CHAO-HSIANG CHANG1, WEN-LUNG MA1, XIAO-FAN HUNG1, YI-RU TSAI1, MENG-HSUEH AMANDA LIN1, CAIXIA ZHANG5, CHAWNSHANG CHANG1,3,¶ AND CHIH-RONG SHYR1,¶
1Sex Hormone Research Center, China Medical University/Hospital, Taichung 404, Taiwan 2Divisions of Urology, Department of Surgery, Buddhist Tzu Chi General Hospital, Taichung Branch, Taichung 427, Taiwan
3George Whipple Lab for Cancer Research, Departments of Pathology, Urology, and Radiation Oncology and The Wilmot Cancer Center, University of Rochester Medical Center, Rochester, New York 14642, USA
*These authors contributed equally to this work. ¶ Corresponding authors
Correspondence: Chih-Rong Shyr, PhD, Sex Hormone Research Center, China Medical
University/Hospital, Taichung 404, Taiwan, Email: chshyr@hotmail.com; and Chawnshang Chang PhD, George Whipple Lab for Cancer Research, Departments of Pathology, Urology, and Radiation Oncology and The Wilmot Cancer Center, University of Rochester Medical Center, Rochester, New York 14642, USA, Email: chang@urmc.rochester.edu.
Abstract
Dysregualted androgen receptor (AR) signaling is implicated in several types of tumors, including carcinomas of the prostate, breast, liver, and bladder. However, the contribution of AR to the progression of upper urinary tract urothelial carcinomas (UUTUC) has not been clearly investigated. In this study, we demonstrated that the overexpression of AR is involved in metastasis and invasiveness of upper urinary tract urothelial carcinoma cells. We
investigated the role of the AR in UUTUC by using UUTUC derived BFTC 909 cells. The overexpression of AR promotes migration and invasion of BFTC 909 cells. Expression of migration/invasion related genes was increased in BFTC 909 cell overexpressing AR as examined by Q-RT-PCR and Western blot analyses. The results showed that AR-enhanced migration and invasion of UUTUC cells are linked to the upregulation of matrix degrading enzyme MMP9 and cyclooxygenase (COX) –2. Subsequently, the blocking of MMP9 and Cox-2 signalings by inhibitors suppressed AR-enhanced cell migration and invasion. The results of present study, for the first time provide the evidence for AR’s role in motility and invasion of UUT cancer cells and support the hypothesis that the AR may play a critical role in the establishment of the invasive phenotype in urothelial neoplasia of UUT. Thus, the AR may also serve as a novel biomarker and potential therapeutic target for UUT cancer.
Introduction
Upper urinary tract urothelial carcinoma (UUTUC) is a devastating urologic malignancy associated high morbidity and mortality although relatively rare, accounting for
approximately 5-10 % of all urothelial tumors (1). The natural history of upper tract UC is different from UC of the bladder with higher incidence of high-grade deeply invasive disease in the upper urinary tract than the one in the bladder (2). UUT-UCCs that invade the muscle wall usually have a very poor prognosis with 5-yr specific survival less than 50 % for
pT2/pT3 and less than 10 % for pT4 (1, 3). And the median survival of pT4 patients was only 7- 9 months even with radical nephroureterectomy and chemotherapy (3, 4). Therefore, UUTUC presents a serious public health problem and a challenge to clinical physicians and basic scientists to find more effective systemic adjuvant therapy to improve the outcome of UUTUC patients.
UUTUC is a male-dominant disease with the male to female ratio: 2:1 to 2.5:1(5, 6). Survival of UUTUC patients was significantly influenced by the male gender, age over 80 years, a two-incision operation, location in both the pelviocaliceal system and the ureter, grade III, and stage T3 and T4 with adjusting for sex and age (7). Sex and stage of UUTUC patients were the only independent prognostic factors predictive of overall survival and female gender was associated with a better survival (7). These studies suggest that gender plays an important role in affecting the development and progression of UUTUC. However
gender differences in malignant diseases, including UUTUC, are incompletely understood, and therefore more studies are required to elucidate their pathological mechanisms.
Androgens and androgen receptor (AR) are demonstrated to play an important role in male dominant cancers such as liver and bladder cancer by affecting tumor initiation and
progression (8-10). Therefore in this study, we hypothesized that AR also plays a role in the progression of UUTUC to account for high incidence and poor prognosis of UUTUC in males.
During progression of tumors from primary sites to metastasis, specific proteins and signals are activated to enable cancer cells to detach from neighboring cells, re-orientate their polarity invade, migrate, survive and proliferate in foreign microenvironments. These proteins include ECM-degrading enzymes, such as matrix metalloproteinases (MMPs) and cathepsins, which help the degradation of basement membrane and extracellular matrix (ECM) (11, 12). There are also signal molecules with capability to induce stress-fiber assembly and
contraction for mobility, such as small G-protein Rho and its important downstream effector, the Rho-associated serine/threonine kinase (ROCK), which are also involved in tumor cell migration and invasion (13-16). In UUTUC, the mRNA levels of RhoA and RhoA protein were higher in tumor and metastatic lymph node tissues than in non-tumor tissues,suggesting that RhoA-ROCK 1 signaling is involved in the invasion and metastasis of upper urinary tract cancer (17). The expression of MMP-2, MMP-9, and TIMP-1 was an independent predictor of
high pT stage (18) and elevated expression levels of MMP-9 and MMP-2, and were associated with poor prognosis (19)
AR has been shown to regulate MMP2 and 9 in prostate (20) and in prostate cancer (21) and AR action in migration is mediated by RhoA-ROCK signaling axis that control cell motility in PCa (22). The up-regulation of cyclooxygenase 2 (COX-2) expression occurs frequently in a variety of different tumors and cyclooxygenase-2 (COX-2). Cox2 is also shown to be an important signal molecule which regulates cell motility (23, 24). Androgen receptor (AR) agonist dihydrotestosterone (DHT) was shown to increases levels of the vascular inflammatory mediator cyclooxygenase (COX)-2 (25).
However how AR affects the above signals related to the progress of UUTUC is not clear? In this study, we aimed to answer this question by making AR overexpression in UUTUC cells to observe the role of AR in cell migration and invasion as well as possible genes involved in the regulatory role of AR in migration and invasion in UUTUCs
Materials and methods
Cell lines and chemicals. The UUTUC cell line, BFTC 909 cells (from a UUTUC of renal
pelvis patient) were a generous gift from Dr. Tzeng CC (26) and cultured in Dulbecco's modified Eagle's medium, containing 10 % heat-inactivated fetal bovine serum (FBS) at 37 °C in an atmosphere of 5 % CO2. SV-HUC cells (ureter cells immortalized by SV40, from an 11-year-old male accident victim) were obtained from ATCC and cultured in Ham's F-12 medium, containing 10 % heat-inactivated fetal bovine serum (FBS) at 37 °C in an
atmosphere of 5 % CO2. To exogenously express AR in cells, a recombinant lentiviral vector containing wild-type AR (pWPI hAR) (27) and a control lentiviral vector expressing the enhanced green fluorescent protein (pWPI) were used to over express AR. Lentiviral PWPI-AR/PWPI-control with pMD2.G packaging and psPAX2 envelope plasmids
(lentivirus:packaging:envelopeZ 2:1:1) were co-transfected into 293T cells. After 48 h of transfection, target cells were cultured in the presence of viral supernatant containing 8 mg/ml polybrene (Millipore, Billerica, MA, USA) for 6 h.
MMP-9 inhibitor I was purchased from Calbiochem (Frankfurter, Germany) and celecoxib and casodex were purchased from Sigma-Aldrich (Buchs SG, Switzerland)
Wound-healing migration assay. Cells were seeded onto 35-mm plates until confluence, the
monolayer. Cells were analyzed and photographed with a microscope. Photographs of cell wound were taken at 0 h and 24h of migration. The relative migration was calculated by setting the percentage of wound closure in control cells after 24 h was set as 1
Transwell migration assay. Cells were first harvested from the culture dish and 1.0 × 104 cells
in 200 μL of serum-free medium were transferred to the transwell inserts (the top
compartment, 8-μm pore size) and 750 μL of medium placed in the lower chamber. After incubation at 37°C for 4 h in cell culture incubator, filters were washed, fixed, and stained with Crystal violet. Cells on the upper surface of the filters were removed with cotton swabs. Cells that had moved to the lower surface of the filter were counted under the microscope. Migrated cells in each filed were quantified. Results are presented as relative migration by setting the migrating cell number of control cells as 1.
Transwell invasion assay. Cell invasion through a three-dimensional extracellular matrix was
assessed by a Matrigel invasion assay using BD Matrigel coated-transwell with 8.0 μm filter membranes. Cells resuspended in 200 μL of serum free medium were plated onto each filter, and 750 μL of DMEM containing 10 % FBS was added into the lower compartment of invasion chambers. After 24 h, filters were washed, in 4 % paraformaldehyde and stained with 1 % crystal violet. Cells on the upper surface of the filters were removed with cotton
swabs. Cells that had invaded to the lower surface of the filter were counted under the microscope.
In vitro adhesion to fibronectin assay. Twenty-four-well culture dishes were pre-coated with
80 µl of Fibronectin (2.5 mg/ml) adhesion buffer (0.25 % BSA in HBSS) for 30 min at 37 °C. 1×105 cancer cells were added to each well. After 30 min at 37°C in a CO2 incubator,
nonadherent cells were removed by gentle wash with HBSS. Then, the cells were fixed with 2 % paraformaldehyde in 1×PBS and the adhesive cancer cells stained with 0.05 % crystal solution. And the staining intensity was quantitated with a spectrometer.
Quantitative real-time RT-PCR. Total RNA was extracted from cells by using TRIzol
(Invitrogen, Carlsbad, CA, USA) and used for first-strand cDNA synthesis. The mRNA levels were measured using CFX96™ real-time system (Bio-Rad) using KAPA SYBR fast qPCR kits (Kapa biosystems Corp.). Specific primers for MMP-2, MMP-9, Rho A, Rock1, COX-2 and -actin were as follows: MMP-2 (F: CCCCAGACAGGTGATCTTGAC-3' and R: 5'-GCTTGCGAGGGAAGAAGTTG-3'), MMP-9 (F: 5'-CGCTGGGCTTAGATCATTCC-3' and R: AGGTTGGATACATCACTGCATTAGG-3'), Rho A (F:
5'-TCAAGCCGGAGGTCAACAAC-3' and R: 5'- ACGAGCTGCCCATAGCAGAA-3'), Rock1 (F: ATGAGTTTATTCCTACACTCTACCACTTTC-3' and R:
TAACATGGCATCTTCGACACTCTAG-3'), COX-2 (F:
5'-CCCTTGGGTGTCAAAGGTAA-3' and R: 5'-GCCCTCGCTTATGATCTGTC-3') and -actin (F: 5'-TCACCCACACTGTGCCCATCTACGA-3' and R: 5'-
CAGCGGAACCGCTCATTGCCAATGG -3'). PCR cycling conditions were 3 min at 95˚C for 1 cycle followed by 40 amplification cycles at 95 ˚C for 10 sec and 52 ˚C (2, MMP-9, Rock-1, COX-2,and β-actin), or 62 ˚C (RhoA) for 30 sec. Expression levels were
normalized to -actin mRNA level determined by the 2−ΔΔCT method.
Western blot analysis. Cell lysates were resolved by sodium dodecyl sulphate-polyacrylamide
gel electrophoresis (SDS-PAGE), transferred to a nitrocellulose membrane and incubated with specific primary antibodies. Protein bands were visualized using horseradish peroxidise (HRP)-conjugated secondary antibodies and enhanced chemiluminescence reagent (Millipore, Bedford, MA, USA) with the Bio-RAD imaging system.
Statistics. Experiments were repeated at least three independent experiments. Results are
expressed as mean ± SD. Two-tailed unpaired t-test was used to compare the results between the two groups. A p-value of less than 0.05 was considered significantly different.
Results
The overexpression of AR in BFTC 909 and SV-HUC cells increases cell migration. To
determine the role of AR in migration of UUTUC cells, we used different UUT urothelial cells including established UUTUC cells: BFTC 909, transformed UUTUC cells: SV-HUC. Because those cells express a very low amount of AR, we exogenously expressed AR with viral infection into these cells to examine how AR affects cell migration. As shown in Fig. 1A, contrast-phase images show that wound area was significantly reduced in BFTC 909 hAR cells with AR overexpression compared to BFTC 909 pWPI. Transwell migration assay also showed that SV-HUC hAR cells migrated more than SV-HUC pWPI cells (Fig. 1B). These results indicate that AR stimulates UUTUC cell migration either in cancer cells or
transformed UC cells.
The overexpression of AR in BFTC 909 cells increases cell migration. Since, metastatic
process involves several critical steps such as invasion and adhesion (28). We further determined the ability of AR to enhance invasion of UUTUC cells. Consistent with findings in Fig. 1, the overexpression of AR in BFTC 909 hAR cells increased the number of cells invading through matrigel-coated transwell filters (Fig. 2A). Adhesion to extracellular matrix (ECM) is an important capacity for cancer cell to anchor on the matrix for invasion.
overexpression. We coated fibronectin, an important component of ECM, on culture plates to investigate the effect of AR on BFTC 909 cell adhesiveness to fibronectin. The
overexpression of AR significantly enhanced the adhesion of BFTC 909 hAR cells compared to BFTC 909 pWPI cells (Fig. 2B). Collectively, our results suggest that AR not only
stimulates the invading ability of urothelial cancer cells but also the cells' ability to adhere to cell matrix to promote cell invasion.
The genes related to migration and invasion expression changed by AR. To investigate which
signaling pathways are activated by AR to increase cell migration and invasion, we examined the several genes which are involved in the migration and invasion of tumor cells. Previous studies have shown that AR regulates stimulates matrix metalloproteinase-2 expression in human prostate cancer, which is involved in cell migration (29). And AR action in migration is mediated by RhoA-ROCK signaling axis that control cell motility in prostate cancer (22), which regulates the cytoskeleton and cell migration and is frequently overexpressed in tumors. (15). Cyclooxygenase-2 (COX-2) is another important signal molecule which regulates cell motility, and androgen receptor (AR) agonist dihydrotestosterone (DHT) was shown to increases levels of the vascular inflammatory mediator cyclooxygenase (COX)-2 (25). Therefore, we assessed the expression of these genes by Q-RT-PCR and immunoblot analysis in BFTC 909 cells with or without AR overexpression. In mRNA levels, the
expression of MMP9, RhoA and Rock-1 was increased, while the expression of MMP2 and Cox-2 was not changed BFTC 909 hAR cells, when compared with BFTC 909 pWPI cells (Fig. 3A). Furthermore, in protein levels, BFTC 909 hAR cells had higher expression of MMP9, Rock-1 and Cox 2 than BFTC 909 pWPI cells did (Fig. 3B). These results suggest that AR may upregulate these genes at RNA level and protein level to enhance cell migration and invasion.
Inhibitor effects on AR-enhanced cell migration and cell invasion in UUTUC cells. To further
determine the role of MMP9 and COX2 in AR-enhanced migration and invasion, we tested whether MMP9 and COX2 activities were required for enhancing migration and invasion of BFTC 909 hAR cells by performing the same experiments as above but in the presence of MMP-9 Inhibitor I, a cell-permeable, potent, selective, and reversible MMP-9 Inhibitor, or selective COX2 inhibitor (celecoxib) In migration assay, as expected, AR-enhanced cell migration in BFTC 909 hAR cells was repressed by anti-androgen, casodex (Fig. 4A). Furthermore, MMP-9 and COX inhibitors also showed the ability to repress AR-enhanced cell migration (Fig. 4B). In invasion assay, BFTC 909 hAR cells that invaded matrigel to the lower surface of the filter were decreased by anti-androgen, casodex (Fig. 4C) and MMP-9 and COX2 inhibitors also had the same effect (Fig 4D).These results that both migration and invasion were markedly reduced in the presence of casodex, MMP-9 inhibitor and celecoxib
indicate that AR, MMP3, COX2 signaling are involved in ability of AR to promote migration and invasion of BFTC 909 cells.
Discussion
The present study indicates that AR plays a role in the migration and invasiveness of UUTUC cells, based on the results that increased cell migration and invasion upon AR overexpression in UUT-UC cells (Fig. 1 and 2). Our research could be important in clarifying the clinical implications of androgen and androgen receptor signaling in the progression of UUTUC, which may explain higher male ratio in invasive UUTUC. Although our previous study has showed that around 40 % invasive UUTUC were AR positive (30), but the correlation of AR status with relapse and metastasis after radical nephroureterectomy, and survival of patients with invasive UUTUC has not been investigated. Whether AR is critical in influencing UUT-UC progress and survival outcome need further investigation. In this study, we provided the evidence that AR promote UUTUC metastasis involving induction of MMP9 and Cox2 in UUT-UC cells, all of which have well established roles in cancer metastasis (6, 11, 12).
AR expression levels in the tumor and/or its microenvironment affect prostate cancer metastasis (31, 32). Exogenous expression of AR in AR-negative PC3 prostate cancer cells decreased their invasive properties, and treatment with androgen further reduced invasion of these cells (33), but AR functions in prostate stromal cells as a promoter for prostate cancer proliferation and metastasis (34). Although the role of AR in UUTUC has not been
investigated, in UC of bladder, AR was shown to promote BBN induced bladder cancer in mice (9) and bladder cancer cell migration and invasion (35), suggesting AR also play an
important role in urothelial carcinoma. Our study was first to show the role of AR in increasing UUT-UC cell migration and invasion, which is contrast to the effect of AR on prostate cancer although others also reported that AR promotes the invasiveness of prostate cancer cells (21, 29). These studies indicate that AR may have diverse effects on molecules involved in cancer invasion and metastasis by repressing or stimulating cancer cell migration and invasion, which may due to the tumor microenvironment, coregulators of AR and
alterations of growth factors and their receptors in tumors (36). The exact mechanisms by which AR exerts in different cancer cells needs be further investigated to dissect the multiple roles of AR in cancer progression and metastasis.
In delineating the molecules regulated by AR for affecting UUT-UC metastasis, we examined the genes including MMPs, involved in the degradation of the extracellular matrix, which is a key step in the process of cancer invasion and metastasis. Our results showed that among different matrix metalloproteinases (MMPs): MMP-2 and MMP-9, AR increased MMP 9 expression both in mRNA and protein level, but not MMP-2 in UUTUC cells (Fig. 3A). In prostate cancer cells, regulation of MMP-2 or MMP-9 by AR signaling has different results from different groups. Some studies have reported that androgen stimulates pro-MMP-2 expression but not pro-MMP-9 in LNCaP cells (pro-MMP-29) and both MMP-pro-MMP-2 and MMP-9 are stimulated by AR signaling in a MDA-I cells (21), but Miyamoto et al reported that androgen decreases MMP-9 secretion in PC-3 cells stably expressing AR (37). Therefore, the molecular
mechanism on the upregulation of MMP9 expression of AR needs further studied, but the inhibitors of MMP9 was shown able to block AR-enhanced cell migration and invasion. Since matrix metalloproteinases (MMPs) inhibitors have been proposed as promising targets for cancer therapy (38), the combination of AR antagonist is likely to increase treatment efficacy in AR positive UUT-UC cells.
To metastasize, tumor cells need to increase motility by remodelling of the cytoskeletons and cell contacts with the extracellular matrix, which is regulated by Rho A and ROCK-1 kinase (15). Although we have demonstrated the increase of Rho A and ROCK-1 expression in BFTC 909 cells overexpressing AR, the inhibitors of ROCK-1 failed to block
AR-enhanced migration and invasion (data not shown), suggesting that Rho A and ROCK-1 may not significantly affect AR function. The higher expression level of COX-2 has been shown to increase invasiveness in colon cancer and prostate cancer cells (24, 39). For UUTUC,
overexpressed COX-2 was also found in patients and was associated with the pathologic stage and grade, indicating that COX-2 may be involved in UUTUC carcinogenesis and
development (40, 41). The effect of the specific COX-2 inhibitor on AR-enhanced migration and invasion clearly demonstrated the essential role of COX-2 in cell migration and invasion (Fig 4B&D).
Inhibition of COX-2, and MMP-9 all suppressed AR-enhanced cell migration and invasion in UUTUC (Fig.4B&D). This finding provides the rationale to develop new
therapeutic treatment by combining AR blockade and chemotherapy or target therapy, which may produces better efficacy. Since COX-2 and MMP-9 are also associated with tumor progression, inhibition of COX-2 and MMP- 9 pathways could be an effective therapeutic approach for advanced UUTUCs. The combined therapy combining androgen deprivation and other anti-AR therapies with inhibition of COX-2, and MMP-9 pathways may have better therapeutic efficacy on advanced UUTUCs. Therefore, our study has several important clinical implications. First, our data have proved that the expression of AR is linked to tumor cell migration and invasion although whether AR overexpression in UUTUCs is associated with higher clinical stage and poor clinical outcome needs further investigated. And second implication of our study is to implicate that the addition of AR blockade in therapeutic regimens combining with targeted drugs may have better responses in UUTUC patients who have AR positive tumors. Adjuvant chemotherapy after surgery is currently used in UUTUC patients to prevent cancer relapse and metastasis, but adjuvant chemotherapy only achieves a 5-year recurrence-free rate of up to 50 % with minimal impact on survival (42);Hellenthal, 2009 #151}. Since AR blockade has been commonly used and shown to improve survival of men with locally advanced and high-grade prostate cancers (43), the combination of AR blockade with either traditional chemotherapy or target therapy may increase efficacy of therapeutic regimes on advanced UUTUCs.
Figure legends
Figure 1. The cell migration assay on UUTUC cells infected with pWPI or hAR by lentiviral
system to overexpress AR. For wound-healing migration assay, cells were plated at high density for 24 h, and then the cell monolayer was scratched and incubated for additional 24 h for cell migration into the wound area. The wounds were taken photos and the recovered areas were calculated. Wound healing was analyzed by comparing the wound healing rate (% wound healing = [Initial wound width – current wound width]/Initial wound width) at 2 different intervals. (A) The Quantitative relative migration data and representative
microscopic images for BFTC 909 pWPI and BFTC 909 hAR cells. (B) Quantitative relative migration data for SV HUC pWPI and SV HUC hAR cells by transwell migration assay. Data represent the mean ±SD, * p<0.05 from at least 3 independent experiments and were analyzed by t-test
Figure 2. Matrigel invasion and adhesion assay on BFTC 909 cells infected with pWPI or
hAR by lentiviral system to overexpress AR. The bottoms of the top well in transwell setting were all coated with a thin layer of matrigel and only the cells in the top well with invasive capacity could migrate through the matrigel layer and 8.0 µm pores. The cells with invasion potential through matrigel-coated transwells were monitored by crystal violet staining. (A) The quantitative relative migration data and representative microscopic images for BFTC 909
pWPI and BFTC 909 hAR cells. Relative invasion of BFTC 909 hAR cells was normalized to vector-infected cells, set at 1. (B) For adhesion assay, BFTC 909 pWPI and BFTC 909 hAR cells were seeded on the culture dishes that were pre-coated with 80 µl of fibronectin (2.5 mg/ml) for 4h and then washed with PBD. The adhesive cancer cells stained with 0.05 % crystal solution. And the staining intensity was quantitated with a spectrometer. Data
represent the mean ±SD of at least 3 independent experiments and were analyzed by t-test. * p < 0.05 versus vector control cells.
Figure 3. (A) The expression of pro-invasion/metastasis genes on BFTC 909 pWPI and
BFTC 909 hAR cells. RNAs from BFTC 909 pWPI and BFTC 909 hAR cells were analyzed by RT-qPCR on mRNA levels of pro-invasion/metastasis genes: MMP2, MMP9, Rho, ROCK1 and Cox2. Each transcript level from BFTC 909 pWPI cells was set as 1. Data represent the mean ± SD of 3 independent experiments and were analyzed by t-test ** p < 0.01 and *** p < 0.001 versus vector infected control cells. (B) The expression of proteins related to migration and invasion changed by AR expression. BFTC 909 pWPI and BFTC 909 hAR cells. The cells were lysed. Equal amounts of protein were analyzed by SDS-PAGE and immunoblotted with anti-ROCK1, anti-E-cadherin, anti-COX2, anti-MMP9, and anti--actin antibodies. Shown are representative blots of more than three independent studies.
Figure 4. Inhibitor effects on AR-enhanced cell migration and invasion in BFTC 909 cells.
The inhibitory effect of (A) casodex, (B) MMP9-I inhibitor or COX-2 on the AR-enhanced migration of BFTC 909 hAR cells was assessed by wound healing assay. BFTC 909 hAR cells were incubated with casodex, MMP9-I and COX-2 inhibitors for 24 h. Relative
quantification of wound repair of each inhibitor treatment group was quantified by setting the migration rate of no treatment BFTC 909 hAR cells group as 1. The inhibitory effect of (C) casodex, (D) MMP9-I inhibitor, or COX-2 inhibitor on the AR-enhanced invasion of BFTC 909 hAR cells was assessed by transwell invasion assay. BFTC 909 hAR cells were incubated with casodex, MMP9-I or COX-2 inhibitors for 24 h in transwell coated with a thin layer of matrigel. Relative quantification of cell invasion of each inhibitor treatment group was quantified by setting invading cell number of no treatment BFTC 909 hAR cells group as 1. Values are mean ±SD from at least 3 independent experiments. * p<0.05, ** p < 0.001 versus untreated BFTC 909 hAR cells.
1. Roupret M, Zigeuner R, Palou J, et al.: European guidelines for the diagnosis and management of upper urinary tract urothelial cell carcinomas: 2011 update. Eur Urol 59: 584-594, 2011.
2. Stewart GD, Bariol SV, Grigor KM, Tolley DA and McNeill SA: A comparison of the pathology of transitional cell carcinoma of the bladder and upper urinary tract. BJU Int 95: 791-793, 2005.
3. Li CC, Chang TH, Wu WJ, et al.: Significant predictive factors for prognosis of primary upper urinary tract cancer after radical nephroureterectomy in Taiwanese patients. Eur Urol 54: 1127-1134, 2008.
4. Hall MC, Womack JS, Roehrborn CG, Carmody T and Sagalowsky AI: Advanced transitional cell carcinoma of the upper urinary tract: patterns of failure, survival and impact of postoperative adjuvant radiotherapy. J Urol 160: 703-706, 1998.
5. Munoz JJ and Ellison LM: Upper tract urothelial neoplasms: incidence and survival during the last 2 decades. J Urol 164: 1523-1525, 2000.
6. Ozsahin M, Zouhair A, Villa S, et al.: Prognostic factors in urothelial renal pelvis and ureter tumours: a multicentre Rare Cancer Network study. Eur J Cancer 35: 738-743, 1999. 7. Papatsoris AG, Chrisofos M, Skolarikos A, et al.: Upper urinary tract transitional cell carcinoma. A 10-year experience. Tumori 94: 75-78, 2008.
8. Wu MH, Ma WL, Hsu CL, et al.: Androgen receptor promotes hepatitis B virus-induced hepatocarcinogenesis through modulation of hepatitis B virus RNA transcription. Sci Transl Med 2: 32ra35, 2010.
9. Miyamoto H, Yang Z, Chen YT, et al.: Promotion of bladder cancer development and progression by androgen receptor signals. J Natl Cancer Inst 99: 558-568, 2007.
10. Ma WL, Hsu CL, Wu MH, et al.: Androgen receptor is a new potential therapeutic target for the treatment of hepatocellular carcinoma. Gastroenterology 135: 947-955, 955 e941-945, 2008.
11. Himelstein BP, Canete-Soler R, Bernhard EJ, Dilks DW and Muschel RJ:
Metalloproteinases in tumor progression: the contribution of MMP-9. Invasion Metastasis 14: 246-258, 1994.
12. Kupferman ME, Fini ME, Muller WJ, Weber R, Cheng Y and Muschel RJ: Matrix metalloproteinase 9 promoter activity is induced coincident with invasion during tumor progression. Am J Pathol 157: 1777-1783, 2000.
13. Riento K and Ridley AJ: Rocks: multifunctional kinases in cell behaviour. Nat Rev Mol Cell Biol 4: 446-456, 2003.
14. Schmitz AA, Govek EE, Bottner B and Van Aelst L: Rho GTPases: signaling, migration, and invasion. Exp Cell Res 261: 1-12, 2000.
15. Sahai E and Marshall CJ: Differing modes of tumour cell invasion have distinct requirements for Rho/ROCK signalling and extracellular proteolysis. Nat Cell Biol 5: 711-719, 2003.
16. Itoh K, Yoshioka K, Akedo H, Uehata M, Ishizaki T and Narumiya S: An essential part for Rho-associated kinase in the transcellular invasion of tumor cells. Nat. Med. 5: 221-225, 1999.
17. Kamai T, Kawakami S, Koga F, et al.: RhoA is associated with invasion and lymph node metastasis in upper urinary tract cancer. BJU Int 91: 234-238, 2003.
18. Miyata Y, Kanda S, Nomata K, Hayashida Y and Kanetake H: Expression of metalloproteinase-2, metalloproteinase-9, and tissue inhibitor of metalloproteinase-1 in transitional cell carcinoma of upper urinary tract: correlation with tumor stage and survival. Urology 63: 602-608, 2004.
19. Inoue K, Kamada M, Slaton JW, et al.: The prognostic value of angiogenesis and metastasis-related genes for progression of transitional cell carcinoma of the renal pelvis and ureter. Clin Cancer Res 8: 1863-1870, 2002.
20. Delella FK, Justulin LA, Jr. and Felisbino SL: Finasteride treatment alters MMP-2 and -9 gene expression and activity in the rat ventral prostate. Int J Androl 33: e114-122, 2010. 21. Hara T, Miyazaki H, Lee A, Tran CP and Reiter RE: Androgen receptor and invasion in prostate cancer. Cancer Res 68: 1128-1135, 2008.
22. Schmidt LJ, Duncan K, Yadav N, et al.: RhoA as a mediator of clinically relevant androgen action in prostate cancer cells. Mol Endocrinol 26: 716-735, 2012.
23. Wolff H, Saukkonen K, Anttila S, Karjalainen A, Vainio H and Ristimaki A: Expression of cyclooxygenase-2 in human lung carcinoma. Cancer Res 58: 4997-5001, 1998.
24. Tsujii M, Kawano S and DuBois RN: Cyclooxygenase-2 expression in human colon cancer cells increases metastatic potential. Proceedings of the National Academy of Sciences of the United States of America 94: 3336-3340, 1997.
25. Osterlund KL, Handa RJ and Gonzales RJ: Dihydrotestosterone alters cyclooxygenase-2 levels in human coronary artery smooth muscle cells. Am J Physiol Endocrinol Metab 298: E838-845, 2010.
26. Tzeng CC, Liu HS, Li C, et al.: Characterization of two urothelium cancer cell lines derived from a blackfoot disease endemic area in Taiwan. Anticancer Res 16: 1797-1804, 1996.
27. Ma W-L, Hsu C-L, Yeh C-C, et al.: Hepatic androgen receptor suppresses hepatocellular carcinoma metastasis through modulation of cell migration and anoikis. Hepatology 56: 176-185, 2012.
28. Langley RR and Fidler IJ: The seed and soil hypothesis revisited--the role of tumor-stroma interactions in metastasis to different organs. Int J Cancer 128: 2527-2535, 2011. 29. Liao XB, Thrasher JB, Pelling J, Holzbeierlein J, Sang QXA and Li BY: Androgen stimulates matrix metalloproteinase-2 expression in human prostate cancer. Endocrinology 144: 1656-1663, 2003.
30. Shyr CR, Chen CC, Hsieh TF, et al.: The expression and actions of androgen receptor in upper urinary tract urothelial carcinoma (UUTUC) tissues and the primary cultured cells. Endocrine, 2012.
31. Heinlein CA and Chang C: Androgen receptor in prostate cancer. Endocr Rev 25: 276-308, 2004.
32. Niu Y, Altuwaijri S, Lai KP, et al.: Androgen receptor is a tumor suppressor and proliferator in prostate cancer. Proc Natl Acad Sci U S A 105: 12182-12187, 2008.
33. Bonaccorsi L, Carloni V, Muratori M, et al.: Androgen Receptor Expression in Prostate Carcinoma Cells Suppresses α6β4 Integrin-Mediated Invasive Phenotype. Endocrinology 141: 3172-3182, 2000.
34. Niu Y, Altuwaijri S, Yeh S, et al.: Targeting the stromal androgen receptor in primary prostate tumors at earlier stages. Proc Natl Acad Sci U S A 105: 12188-12193, 2008. 35. Wu JT, Han BM, Yu SQ, Wang HP and Xia SJ: Androgen receptor is a potential therapeutic target for bladder cancer. Urology 75: 820-827, 2010.
36. Baldi E, Bonaccorsi L and Forti G: Androgen receptor: good guy or bad guy in prostate cancer invasion? Endocrinology 144: 1653-1655, 2003.
37. Miyamoto H, Altuwaijri S, Cai Y, Messing EM and Chang C: Inhibition of the Akt, cyclooxygenase-2, and matrix metalloproteinase-9 pathways in combination with androgen deprivation therapy: potential therapeutic approaches for prostate cancer. Mol Carcinog 44: 1-10, 2005.
38. Coussens LM, Fingleton B and Matrisian LM: Matrix Metalloproteinase Inhibitors and Cancer—Trials and Tribulations. Science 295: 2387-2392, 2002.
39. Kirschenbaum A, Liu X-H, Yao S and Levine AC: The role of cyclooxygenase-2 in prostate cancer. Urology 58: 127-131, 2001.
40. Oku S, Higashi M, Imazono Y, et al.: Overexpression of cyclooxygenase-2 in high-grade human transitional cell carcinoma of the upper urinary tract. BJU Int 91: 109-114, 2003. 41. Jeon HG, Jeong IG, Bae J, et al.: Expression of Ki-67 and COX-2 in Patients With Upper Urinary Tract Urothelial Carcinoma. Urology 76, 2010.
42. Vassilakopoulou M, de la Motte Rouge T, Colin P, et al.: Outcomes after adjuvant chemotherapy in the treatment of high-risk urothelial carcinoma of the upper urinary tract (UUT-UC): results from a large multicenter collaborative study. Cancer 117: 5500-5508, 2011.
43. Miyamoto H, Messing EM and Chang C: Androgen deprivation therapy for prostate cancer: Current status and future prospects. The Prostate 61: 332-353, 2004.
