Quercetin, but not rutin and quercitrin, prevention of H
2O
2-induced
apoptosis via anti-oxidant activity and heme oxygenase 1
gene expression in macrophages
Jyh-Ming Chow
a, Shing-Chuan Shen
b,c, Steven K. Huan
d,e, Hui-Yi Lin
f, Yen-Chou Chen
f,*
a
Section of Hematology-Oncology, Department of Internal Medicine, Taipei Municipal Wan-Fang Hospital, Taipei Medical University, Taiwan
bDepartment of Dermatology, Taipei Municipal Wan-Fang Hospital, Taipei, Taiwan c
Department of Dermatology, School of Medicine, Taipei Medical University, Taipei, Taiwan
d
Division of Urology, Department of Surgery, Chi Mei Medical Center, Taiwan
eGraduate Institute of Medical Sciences, College of Medicine, Taipei Medical University, Taiwan fGraduate Institute of Pharmacognosy, School of Pharmacy, Taipei Medical University, Taipei, Taiwan
Received 18 February 2005; accepted 30 March 2005
Abstract
In the present study, we examine the protective mechanism of quercetin (QE) on oxidative stress-induced cytotoxic effect in RAW264.7 macrophages. Results of Western blotting show that QE but not its glycoside rutin (RUT) and quicitrin-induced HO-1 protein expression in a time- and dose-dependent manner, and HO-1 protein induced by QE was blocked by an addition of cycloheximide or actinomycin D. Induction of HO-1 gene expression by QE was accompanied by inducing ERKs, but not JNKs or p38, proteins phosphorylation. Addition of PD98059, but not SB203580 or SP600125, significantly attenuates QE-induced HO-1 protein and mRNA expression associated with blocking the expression of phosphorylated ERKs proteins. H2O2addition reduces the viability of cells by MTT assay, and appearance of
DNA ladders, hypodiploid cells, and an increase in intracellular peroxide level was detected. Addition of QE, but not QI or RUT, significantly reduced the cytotoxic effect induced by H2O2 associated with blocking the production of intracellular peroxide, DNA
ladders, and hypodiploid cells. QE protection of cells from H2O2-induced apoptosis was significantly suppressed by adding HO inhibitor
SnPP or ERKs inhibitor PD98059. Additionally, QE protects cells from H2O2-induced a decrease in the mitochondrial membrane
potential and a release of cytochrome c from mitochondria to cytosol by DiOC6 and Western blotting assay, respectively. Activation of apoptotic proteins including the caspase 3, caspase 9, PARP, D4-GDI proteins was identified in H2O2-treated cells by Western blotting and
enzyme activity assay, and that was significantly blocked by an addition of QE, but not RUT and QI. Furthermore, HO-1 catalytic metabolites carbon monoxide (CO), but not Fe2+, Fe3+, biliverdin or bilirubin, performed protective effect on cells from H2O2-induced cell
death with an increase in HO-1 protein expression and ERKs protein phosphorylation. These data suggest that induction of HO-1 protein may participate in the protective mechanism of QE on oxidative stress (H2O2)-induced apoptosis, and reduction of intracellular ROS
production and mitochondria dysfunction with blocking apoptotic events were involved. Differential anti-apoptotic effect between QE and its glycosides RUT and QI via distinct HO-1 protein induction was also delineated.
# 2005 Elsevier Inc. All rights reserved.
Keywords: Flavonoids; Quercetin; Heme oxygenase 1; Reactive oxygen species; ERKs
1. Introduction
Reactive oxygen species (ROS) are generated under various physiological and pathological conditions such as inflammation, aging, and carcinogenesis [1–3]. An increase in intracellular ROS level has been shown to damage tissues and cells via lipid peroxidation, protein cross-linkage, and DNA breakage processes, which is partially prevented by anti-oxidants and free radical scavengers. Therefore, agents with ability to prevent
www.elsevier.com/locate/biochempharm
Abbreviations: HO-1, heme oxygenase 1; SnPP, tin protoporphyrin; CO, carbon monoxide; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide; NBT, nitroblue tetrazolium; BCIP, 5-bromo-4-chloro-3-indolyl phosphate; RT-PCR, reverse transcriptase-polymerase chain reaction; GAPDH, glutaldehyde-3-phosphate dehydrogenase; H2O2, hydrogen peroxide; ERKs, extracellular regulatory kinases; MAPKs,
mitogen activated protein kinases; JNKs, c-Jun N-terminal kinases * Corresponding author. Tel.: +886 2 27361661x6152; fax: +886 2 23787139.
E-mail address: yc3270@tmu.edu.tw (Y.-C. Chen).
0006-2952/$ – see front matter # 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.bcp.2005.03.017
ROS-induced injury may reserve potential to be further developed.
Some natural anti-oxidant products have been shown to protect cells from oxidative injury. Flavonoids are found in plants, and act as pharmacological active components in Chinese herbs. Multiple biological activities of flavonoids including vasodilatory, inflammatory, viral, anti-oxidant, and anti-carcinogenic effects have been identified
[4–8], and the anti-oxidant activity of flavonoids has been given more attention. Flavonoids such as quercetin, cate-chin and kaempferol are better oxidants than the anti-oxidants Vitamin C and Vitamin E [9]. Among them, quercetin is one of the most widely distributed flavonoids in plants, and several pharmacological effects such as suppression of cell proliferation, protection of LDL oxida-tion, prevention of platelet aggregaoxida-tion, and induction of apoptosis have been found[10,11]. The preventive effects of quercetin from apoptosis have been reported in several cells such as fibroblasts, cardiomyoblast cells, and epithe-lial cells[12,13]. Generally, quercetin was able to induce apoptosis in tumor cells through activation of caspase 3 cascade and suppression of heat shock protein 70[14,15]. Yokoo and Kitamura[16]indicated that quercetin inhibi-tion of apoptosis via blocking activator protein 1 (AP-1) activation. However, the relationship between HO-1 and quercetin prevention of apoptosis is still undefined.
Heme oxygenases (HOs) are enzymes responsible for catalyzing heme degradation, and four metabolites includ-ing iron, carbon monoxide (CO), biliverdin, and biliverdin have been identified. There are three types of HOs includ-ing 1, 2 and 3 were found. Among them, HO-1 is inducible and localized in the non-neural tissues in response to stressful conditions, whereas HO-2 and HO-3 are constitutively expressed and predominantly found in neural cells [17]. Recent evidences indicated that HO-1 played as a key role in defence mechanisms against oxidative damages [18,19]. Mice lacking functional HO-1 showed alternative iron metabolism and chronic inflam-mation, and an increased mortality after lipopolysacchar-ide (LPS) challenge was observed. Overexpression of HO-1 in cells resulted in a marked reduction in injury and cytotoxicity induced by oxidative stress [20,21]. In con-trast, Dennery et al.[22]found that disruption of HO-1 was able to protect against hyperoxia via diminishing the generation of toxic reactive intermediates such as iron and H2O2 in the lung. Therefore, most of evidences
supported that HO-1 participated in the protective mechan-ism of cells from oxidative damages, however it is still unclear if HO-1 is involved in flavonoids protection of cell death induced by oxidative stress.
Structural modifications have been shown to affect the biological activities of flavonoids. William et al. [23]
indicated that OH substitutions were important in the anti-oxidant activities of flavonoids. The studies of struc-ture-FPTase inhibitory activity indicated that the number, position and substitution of OH groups of the A and B rings
of flavonoids, and unsaturation of the C2–C3 bond are important factors affecting inhibition on FPTase by flavo-noids[24]. Park and Chiou[25]indicated that OH groups, below three or above four, produced no effects on the ocular blood flow. It appeared that three OH groups in the flavonoids were the best to increase the ocular blood flow. In addition to OH substitutions, glycoside addition is a common event in the metabolism of flavonoids in vivo. Regev-Shoshani et al.[26]indicated that glycosylation of polyphenols was able to inhibit protein oxidation, and maintain their anti-oxidant activity via extending their half-life in the cells. Our previous studies demonstrated that glycoside addition attenuated the apoptotic activities of flavonoids [4]. Additionally, we found that flavonoids without glycosides addition exhibited more significant inhibitory effects on LPS-induced NO and PGE2
produc-tion than respective glycosylated flavonoids via HO-1 induction [8,27]. However, the effect of glycoside on flavonoids prevention of oxidative stress-induced damage is still unclear. Results of the present study show that quercetin, but not its respective glycosides quercitrin or rutin, possessed effective preventive ability on H2O2
-induced apoptosis. The preventive mechanism involving activation of HO-1 gene expression, inhibition of caspases and mitochondrial cascade is delineated.
2. Materials and methods 2.1. Cells
RAW264.7, a mouse macrophage cell line, was obtained from the American Type Culture Collection (ATCC). Cells were cultured in Dulbecco’s Modified Eagle medium (DMEM) supplemented with 2 mM glutamine, antibiotics (100 U/ml penicillin A and 100 U/ml streptomycin), and 10% heat-inactivated fetal bovine serum (Gibco/BRL) and maintained in a 37 8C humidified incubator containing 5% CO2.
2.2. Agents
The structurally related flavonoids including quercetin, quercitrin and rutin were obtained from Sigma Chemical (St. Louis, MO). The chemicals including bilirubin, ferric (III) Chlroide (FeCl3), ferrous (II) Sulfate (FeSO4),
tricarbonyl-dichlororuthenium (II) dimmer [Ru(CO)3Cl2]2(RuCO),
tri-chlororuthenium (RuCl3),
(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) (MTT), hydrogen per-oxide (H2O2), tin protoporphyrin (SnPP), N-acetyl cysteine
(NAC), actinomycin D, cycloheximide, 20, 70 -dichlorodihy-drofluorescein-diacetate (DCHF-DA) and propidium iodine (PI), 3,30-dihexyloxacarbocyanine iodide (DiOC6(3)) were obtained from Sigma Chemical. Biliverdin was purchased from ICN Biomedical (USA). The antibodies of anti-HO-1, a-tubulin, pERK, pP38, and pJNK,
anti-PARP were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). PD98059, SB203580, and SP600125 were obtained from USB Biotechnology.
2.3. Western blotting
Total cellular extracts were prepared according to our previous papers, separated on 8–12% SDS-polyacrylamide minigels, and transferred to immobilon polyvinylidenedi-fluoride membranes (Millipore). Membranes were incu-bated with 1% bovine serum albumin and then incuincu-bated with specific antibodies overnight at 4 8C. Expression of protein was detected by staining with nitroblue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP) (Sigma).
2.4. RT-PCR
Cells were treated with each of the QE and present of PD98059 or SB203580 or SP600125 for 6 h and then washed with ice-cold PBS. Total RNA was isolated using a total RNA extraction kit (Amersham Pharmacia, UK), and the total RNA concentration was detected using a spectrophotometer. Total RNA (2 mg) was converted to cDNA with oligo d(T). PCR was performed on the cDNA using the following sense and antisense primers, respec-tively, for HO-1: CTGTGTAACCTCTGCTGTTCC and CCACACTACCTGA-GTCTACC; and for GAPDH: TG-AAGGTCGGTGTGAACGGATTTGGC and CATGTA-GGCCATGAGGTCCACCAC. The PCR of the cDNA was performed in a final volume of 50 ml containing PCR primers, oligo (d)T, total RNA, and DEPC H2O by
PT-PCR beads (Amersham Biosciences, UK). The ampli-fication sequence protocol was 95 8C for 30 s, 54 8C for 30 s, and 72 8C for 45 s for 30 cycles. The PCR products were separated by electrophoresis on 1.2% agarose gels and visualized by ethidium bromide staining[27]. 2.5. Determination of ROS production
The production of reactive oxygen species (ROS) was monitored by flow cytometry using DCHF-DA. This dye is a stable compound that readily diffuses into cells and is hydrolyzed by intracellular esterase to yield DCHF, which is trapped within cells. Hydrogen peroxide or low-mole-cular weight phydro eroxides produced by cells oxidize DCHF to the highly fluorescent compound, 20,70 -dichloro-fluorescein (DCF). Thus, the fluorescence intensity is proportional to the amount of peroxide produced by the cells. In the present study, cells were treated with QE, QI, RUT or NAC in the present of H2O2 for 2 h. Then the
compound-treated cells were washed twice with PBS to remove the extracellular compounds, and DCHF-DA (100 mM) green fluorescence was added excited using an argon laser and was detected using a 525-nm (FL1-H) band-pass filter by flow cytometric analysis[5].
2.6. Cell viability assay
(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazo-lium bromide) (MTT) was used as an indicator of cell viability as determined by its mitochrondrial-dependent reduction to formazone. Cells were plated at a density of 4 105cells/well into 24-well plates for 12 h, followed by treatment with different concentrations of each com-pound for a further 12 h. Cells were washed with PBS three times, and MTT (50 mg/ml) was added to the medium for 4 h. Then, the supernatant was removed, and the formazone crystals were dissolved using 0.04 N HCl in isopropanol. The absorbance was read at 600 nm with an ELISA analyzer (Dynatech MR-7000; Dynatech Laboratories). Data of cellular viability were expressed as the percentage of control (survival of control) in the present study.
2.7. LDH release assay
The percentage of LDH release was expressed as the proportion of LDH released into medium compared to the total amount of LDH present in cells treated with 2% tritox-100 treated in the cells. The activity was monitored as the oxidation of NADH at 530 nm by an LDH assay kit (Roche).
2.8. DNA gel electrophoresis
Cells under different treatments were collected, washed with PBS twice, and lysed in 80 ml of lysis buffer (50 mM Tris, pH 8.0; 10 mM ethylenediaminetetraacetic acid (EDTA); 0.5% sodium sarkosinate, and 1 mg/ml proteinase K) for 3 h at 56 8C and then treated with 0.5 mg/ml RNase A for another hour at 56 8C. DNA was extracted with phenol/chloroform/isoamyl alcohol (25/24/1) before load-ing. Samples were mixed with loading buffer (50 mM Tris, 10 mM EDTA, 1% (w/w) low-melting point agarose, and 0.025% (w/w) bromophenol blue) and loaded onto a pre-solidified 2% agarose gel containing 0.1 mg/ml ethidium bromide. The agarose gels were run at 50 V for 90 min in TBE buffer. The gels were observed and photographed under UV light.
2.9. Flow cytometry analysis
Cells were treated with the indicated compounds for a further 12 h. Trypsinized cells were washed with ice-cold PBS and were in 70% ethanol at20 8C for at least 1 h. After fixation, cells were washed twice, incubated in 0.5 ml 0.5% Triton X-100/PBS at 37 8C for 30 min with 1 mg/ml of RNase A, and stained with 0.5 ml of 50 mg/ml PI for 10 min. Fluoresence emitted from the PI–DNA complex was quantified after excitation of the fluorescent dye by FACScan flow cytometry (Becton Dickinson, San Jose, CA).
2.10. Caspase 3/CPP32 activity assay
After different treatments, cells were collected and washed three times with PBS and resuspended in 50 mM Tris–HCl (pH 7.4), 1 mM EDTA, and 10 mM ethyleneglycoltetraacetic acid (EGTA). Cell lysates were clarified by centrifugation at 15,000 rpm for 3 min, and clear lysates containing 100 mg of protein were incubated with 100 mM enzyme-specific colorimetric substrates including Ac-DEVD-pNA for caspase 3/CPP32 at 37 8C for 1 h. Alternative activity of caspase 3 was described as the cleavage of colorimetric substrate by measuring the absorbance at 405 nm.
2.11. Measurement of mitochondrial membrane potential 3,30-Dihexyloxacarbocyanine iodide (DiOC6(3)), a lipophilic cationic cyanine dye that alters occur at the mitochondrial level and is widely used to determine of mitochondrial membrane potential. Cells were treated with QE, QI or RUT in the present or without H2O2for 6 h and
then incubated with DiOC6(3) (40 nM) for 30 min at 37 8C. After treatment, cells were washed with ice-cold PBS and trypsinized cells were washed with ice-cold PBS. Cells were collected by centrifugation at 3000 rpm for 10 min and resuspended in 500 ml of PBS. Fluorescence intensities of DiOC6(3) were analyzed on a flow cytometer (FACScan, Becton Dickinson) with excitation and emis-sion settings of 484 and 500 nm, respectively.
2.12. Cytochrome c release from mitochondrial in RAW264.7 cells
Cells were treated with QE, QI or RUT in the present of H2O2for 12 h and harvested by centrifugation at 3000 rpm
for 5 min at 4 8C. The cells pellets were washed once with ice-cold PBS and resuspended with 5 volumes of 20 mM HEPES-KOH (pH 7.5), 10 mM KCl, 1.5 mM MgCl2, 1 mM
EDTA, 1 mM EGTA, 1 mM DTT, 0.1 mM PMSF, and 250 mM sucrose. The cells were homogenized and centri-fuged at 1200 rpm for 10 min at 4 8C to supernatants and pellets. The supernatants were then centrifuged at 12,000 rpm for 15 min at 4 8C and the obtained supernatants were used for identification of cytosolic cytochrome c by immunoblotting. The pellets were lysed with 50 ml of lysis buffer consisting of 10 mM Tris–HCl (pH 7.4), 1 mM EDTA, 1 mM EGTA, 0.15 M NaCl, 5 mg/ml aprotinin, 5 mg/ml leupeptin, 0.5 mM PMSF, 2 mM sodium orthovanadate, and 1% SDS at 4 8C. The lysed solution was then centrifuged at 15,000 rpm for 30 min at 4 8C and used for the identifica-tion of mitochondrial cytochrome c by immunoblotting. 2.13. Statistical analysis
Values are expressed as the mean S.E. The signifi-cance of the difference from the respective controls for
each experimental test condition was assayed using Stu-dent’s t-test for each paired experiment. A p value <0.05 or 0.01 was regarded as indicating a significant difference.
3. Results
3.1. Quercetion but not its glycosides quercitrin and rutin induces HO-1 protein expression in RAW264.7
macrophages
The chemical structures of quercetin (QE), quercitrin (QI) and rutin (RUT) were shown inFig. 1A. QI and RUT possess a rhamnose and a rutinose (glucose + rhamnose) at the C3 of QE, respectively. Results ofFig. 2A showed that QE (but not QI and RUT) at the dose of 50 mM time-dependently induced HO-1 protein in RAW264.7 macro-phages. As the same part of experiment, QE, at the doses of 25, 50, and 100 mM, dose-dependently induced HO-1 protein expression (Fig. 2B). No significant HO-1 protein induction was detected in QI- or RUT-treated cells. Addi-tion of actinomycin D (ActD; 1 and 10 mg/ml) or cyclo-heximide (CHX; 0.25 and 0.5 mg/ml) significantly inhibited HO-1 protein expression induced by QE (Fig. 2C). We further examine the cytotoxic effect of QE, QI, and RUT in RAW264.7 cells by MTT assay. Results of Fig. 2D indicated that QE at the dose of 25 and 50 mM exhibited no significant reduction in cellular viability, however a slight but significant cytotoxic effect was detected in QE (100 mM)-treated cells. None cytotoxic effect was observed in QI- or RUT-treated RAW264.7 cells. These data indicated that QE is an HO-1 inducer,
Fig. 1. Chemical structures of quercetin (QE), quercitrin (QI) and rutin (RUT).
and de novo protein synthesis is essential for QE induction of HO-1 protein.
3.2. QE induction of HO-1 gene expression via activation of ERKs in macrophages
We further investigate if activation of MAPKs cascades is involved in QE induction of HO-1 gene expression. RAW264.7 macrophages were treated with different doses of QE, QI or RUT for 40 min, and expression of phos-phorylated MAPKs including ERKs, JNKs, and p38 pro-teins were examined by Western blotting using specific antibodies. Results ofFig. 3A show that QE (but not QI or RUT), at the doses of 25, 50, and 100 mM, induces the phosphorylation of ERKs, but not JNKs or p38, proteins in RAW264.7 cells. Pharmacological studies using specific inhibitors of MAPKs including PD98059 for blocking EKRs, SB203580 for blocking p38, and SP600125 for blocking JNKs, were performed in the study. Addition of
PD98059 dose-dependently inhibits QE-induced ERKs protein phosphorylation, however neither SB203580 nor SP600125 exhibits effect in cells (Fig. 3B). And, PD98059 (but not SB203580 and SP600125), at the doses of 25 and 50 mM, significantly reduces the expression of HO-1 pro-tein induced by QE (Fig. 3C). Results of RT-PCR using specific primers for HO-1 and GAPDH indicated that QE was able to induce HO-1 gene expression at mRNA level, which was inhibited by adding PD98059 (but not SB203580 and SP600125) (Fig. 3D). These data suggest that activation of ERKs locates at the upstream of HO-1 gene expression induced by QE.
3.3. QE protection of RAW264.7 cells from H2O2-induced
cell death
We further examine the protective activity of QE, QI, and RUT on oxidative stress (H2O2)-induced cell death.
Addition of H2O2at the dose of 400 mM for 24 h decreased Fig. 2. Quercetin (QE), but not rutin and quercitrin, induction of HO-1 protein expression in RAW264.7 cells. (A) QE induction of HO-1 protein expression in a time-dependent manner. Cells were treated with rutin, quercetin, and quercitrin (50 mM) for 4, 8, 12, and 24 h, and expression of HO-1 protein was detected by Western blotting. (B) QE induction of HO-1 protein expression in a dose-dependent manner. Cells were treated with different concentrations (25, 50, and 100 mM) of rutin, quercetin, and quercitrin for 12 h, and the expression of HO-1 protein was analyzed. (C) Inhibition of QE-induced HO-1 protein expression by actinomycin D (ActD) or cycloheximide (CHX). Cells were treated with QE (50 mM) in the presence or absence of ActD (1 and 10 mg/ml) or CHX (0.25 and 0.5 mg/ml) for 12 h, and the expression of HO-1 protein was analyzed. (D) Examination of cytotoxic effect of rutin, quercetin, and quercitrin on RAW264.7 cells. Cells were treated with different concentrations (25, 50, and 100 mM) of rutin, quercetin, and quercitrin for 12 h. The viability of cells under different treatments was detected by MTT assay, and expressed as the percentage of control (survival of control). a-Tubulin was used as an internal control. C, control. Data are expressed as the mean S.E.**
the viability of cells about 53% by MTT assay. Incubation of cells with different doses of QE, but not QI and RUT, (25 and 50 mM) with H2O2 (400 mM) showed significant
protection on H2O2-induced cytotoxicity in RAW264.7
macrophages (Fig. 4A). In the condition of QE, QI or RUT pre-treatment for 6 h followed by H2O2 (400 mM)
addition for a further 12 h, QE but not QI and RUT exhibited the activity to suppress the cytotoxicity induced by H2O2(Fig. 4B). The protective effect of QE on H2O2
-induced cell death was confirmed by LDH release assay as described inFig. 4C. In order to examine if HO-1 involve-ment in QE protection of H2O2-induced cell death, an HO
inhibitor tin protoporphyrin (SnPP) and ERKs inhibitor PD98059 were used in the study. As illustrated inFig. 4D, neither SnPP nor PD98059 affects the viability of cells, and the protective effect of QE on H2O2-induced cell death was
significantly attenuated by adding SnPP or PD98059 by MTT and the LDH release assays (Fig. 4D and data not shown).
3.4. QE inhibits H2O2-induced cytotoxicity through
blocking apoptosis in macrophages
Both apoptosis and necrosis induced by H2O2have been
identified previously. Therefore, it is interesting to examine which type of cell death induced by H2O2was prevented by
QE. As illustrated inFig. 5A, an increase in DNA ladders was detected in H2O2-treated cells, and that was inhibited
by QE (but not QI and RUT) addition. Results of flow cytometry analysis showed that an increase in hypodiploid cells induced by H2O2was blocked by QE (but not QI and
RUT) addition (Fig. 5B and C). Results of Western blotting showed that induction of caspase 3 and caspase 9 protein processing, represented here is a decrease in pro-caspase 3 and pro-caspase 9 protein, with an increase in the cleaved fragment (85 kDa) of PARP and cleaved fragment (15 kDa) of D4-GDI was detected in H2O2-treated cells,
which was significantly blocked by an addition of QE but not QI and RUT (Fig. 5D). Additionally, a colometric
Fig. 3. Involvement of ERKs activation in QE induction of HO-1 gene expression. (A) QE induction of ERKs, but not p38 and JNKs, protein phosphorylation in RAW264.7 cells. Cells were treated with different concentrations (50, 100, and 200 mM) of QE for 40 min, and expression of phosphorylated and total ERKs/ p38/JNKs protein was detected by Western blotting using specific antibodies. (B) PD98059, but not SB203580 and SP600125, inhibition of QE-induced ERKs (but not p38 and JNKs) proteins phosphorylation. Cells were pre-treated with or without PD98059, SB203580, and SP600125 (25, 50, and 100 mM) for 30 min followed by incubating with QE (50 mM) for a further 40 min. Expressions of phosphorylated and total ERKs (upper panel), p38 (middle panel) and JNKs (lower panel) proteins were analyzed by Western blotting using specific antibodies. (C) PD98059, but not SB203580 and SP600125, inhibition of QE-induced HO-1 protein expression in RAW264.7 cells. Cells were pre-treated with PD98059, SB203580, or SP600125QE (25 and 50 mM) for 30 min followed by incubating with QE (50 mM) for a further 12 h. The expression of HO-1 protein was analyzed by Western blotting. (D) PD98059 inhibition of QE-induced HO-1 mRNA expression. Cells were pre-treated with PD98059, SB203580, or SP600125QE (50 mM) for 30 min followed by incubating with QE (50 mM) for a further 6 h, and HO-1 mRNA level was analyzed by RT-PCR using specific primers. GAPDH was used as an internal control. 1, control; 2, QE; 3, QE + PD98059; 4, QE + SB203580; 5, QE + SP600125.
caspase 3-specific substrate Ac-DEVD-pNA was used to examine the activity of caspase 3 under different treat-ments. Results ofFig. 5E indicated that H2O2induction of
caspase 3 enzyme activity was detected in RAW264.7 cells, and the inductive caspase 3 activity was significantly blocked by QE (but not QI and RUT) (Fig. 5E). These data suggest that QE prevention of RAW264.7 cells from H2O2
-induced cytotoxicity is via blocking the occurrence of apoptotic events.
3.5. QE reduction of intracellular ROS production and maintenance of mitochondrial membrane potential in H2O2-treated RAW264.7 cells
We further investigate the effect of QE on ROS produc-tion and mitochondrial membrane potential in the presence of H2O2treatment. Results ofFig. 6A showed a
represen-tative of flow cytometry analysis using DCHF-DA as a fluorescent dye for ROS detection under different
treat-ments in RAW264.7 cells, and data quantitated from three-independent experiments were described in Fig. 6B. It indicates that H2O2addition induces an increase in
intra-cellular peroxide level, which was significantly reduced by QE (but not QI and RUT) in RAW264.7 cells (Fig. 6). N-acetyl cysteine (NAC), a well-known ROS scavenger, blocking peroxide production induced by H2O2 was
described as a positive control here. Additionally, we identified the effect of QE on mitochondrial function in H2O2-treated macrophages by flow cytometry analysis
using DiOC6as a fluorescent dye. A decrease in
mitochon-drial membrane potential was observed in RAW264.7 cells under H2O2 treatment, and QE (but not QI and RUT)
addition significantly attenuated H2O2-induced a loss in
mitochondrial membrane potential (Fig. 7A). A release of cyt c from mitochondria to cytosol has been found in mitochondria-dependent apoptosis. Results ofFig. 7B indi-cate that addition of H2O2 induces the release of cyt c
protein from mitochondria to cytosol, which was blocked
Fig. 4. QE protection of RAW264.7 cells from H2O2-induced cell death, which was attenuated by SnPP and PD98059 addition. (A) QE, (but not QI and RUT)
inhibition of H2O2-induced cell death by MTT assay. Cells were treated with different concentrations (25 and 50 mM) of QE, QI, and RUT in the presence of
H2O2(400 mM) treatment for a further 12 h. The cellular viability was detected by MTT assay as described in Section2. (B) Pretreatment of QE inhibits H2O2
-induced cell death. Cells were pretreated with QE, QI, and RUT (25 and 50 mM) for 8 h followed by H2O2(400 mM) treatment for a further 12 h. The cellular
viability was detected by MTT assay. (C) QE inhibition of H2O2-induced LDH release in the culture medium. Cells were treated with QE, QI, and RUT (50 mM)
in the presence of H2O2for a further 12 h, and LDH released in medium was detected as described in Section2. (D) Attenuation of QE protection of H2O2
-induced cell death by addition of SnPP and PD98059. Cells were treated with QE (50 mM) in the presence or absence of SnPP (10 mM) or PD98059 (20 mM) followed by H2O2treatment for a further 12 h. The viability of cells was detected by MTT assay. Data are expressed as the mean S.E.**p< 0.01 indicates a
by addition of QE (but not QI and RUT). These data indicate suppression of ROS production and a loss in mitochondiral membrane potential is involved in the QE prevention of H2O2-induced cell death.
3.6. Differential effect of HO metabolites on HO-1 induction and H2O2-induced cytotoxicity in RAW264.7
macrophages
Previous data indicated that induction of HO-1 protein might be involved in QE inhibition of cell death induced by H2O2, however the effect of HO metabolites on H2O2
-induced cell death is still undefined. Five HO metabolites including [Ru(CO)3Cl2]2 (CO, a CO donor), Fe
2+
, Fe3+, biliverdin, bilirubin were used to examine their effects on H2O2-induced cytotoxicity in macrophages. None of Fe2+,
Fe3+, biliverdin and bilirubin performed effect on HO-1 protein expression and H2O2-induced cytotoxicity by
Wes-tern blotting and MTT assay, respectively (Fig. 8A). In contrast, CO donor at the doses of 25, 50, 100 mM
sig-nificantly induced HO-1 protein expression with an increase in the level of ERKs protein phosphorylation (Fig. 8B; upper and middle panels). Attenuation of H2O2-induced cytotoxicity by CO donor at the doses of
25, 50, 100 mM was also observed in RAW264.7 cells (Fig. 8B; lower panel).
4. Discussion
Results of the present study show that QE but not its respective glycosides RUT and QI prevents H2O2-induced
apoptosis in macrophages, and suppression of both caspase 3 activation and decreasing mitochondrial membrane apoptotic cascades with an increase in HO-1 gene expres-sion was identified in its preventive mechanism. Glycoside substitution playing as a negative moiety in the anti-apoptotic effect of flavonoids was identified in the present study.
Fig. 5. QE, but not QI and RUT, decreased H2O2-induced apoptosis in RAW264.7 cells. (A) Cells were treated with QE (a), QI (b), and RUT (c) (50 mM) with or
without H2O2(400 mM) for 12 h. DNA integrity in cells was analyzed by agarose electrophoresis. (B) Cells were treated as described in (A), and the ratio of
hypodiploid cells under different treatments was detected by flow cytometry analysis. A representative of data of flow cytometry analysis was presented. (C) The percentage of hypodiploid cells under different treatments was measured and quantitated from three-independent experiments. (D) Under the same condition in (A), the expression of caspase 3, caspase 9, PARP, D4-GDI, and a-tubulin protein was detected by Western blotting using specific antibodies. (E) Caspase 3 enzyme activity in cells under different treatments was measured using caspase 3-specific substrate Ac-DEVD-pNA. Each value is presented as the mean S.E. of three-independent experiments.**p< 0.01 indicates a significant difference from the control.##p< 0.01 indicates a significant difference between indicated groups, as analyzed by Student’s t-test.
The protective effects of QE have been identified in different cells, however the mechanism is still unclear. Park et al. [28] indicated that QE was able to inhibit H2O2
-induced apoptosis in H9c2 cells via blocking mitochon-drial dysfunction. Ishikawa and Kitamura [29] indicated that the anti-apoptotic effect QE is by intervention in the JNK and ERK-mediated apoptotic pathways. Musonda and Chipman [30] indicated that the anti-oxidant potential might contribute to anti-carcinogenic and anti-inflamma-tory effects of QE. In contrast, QE also possessed ability to induce DNA damage via increasing intracellular H2O2
level, and induce DNA mutation in cells[31,32]. There-fore, the biological effects of QE in cells are controversial, and remain to be further elucidated. In the present study, we found that QE induced HO-1 gene expression via inducing ERKs phosphorylation, and inhibited H2O2
-induced apoptosis in RAW264.7 cells. PD98059, an inhi-bitor of ERKs, attenuated the preventive effect of QE on H2O2-induced cytotoxicity with a decrease in HO-1 gene
expression. Activation of caspase 3 cascade and a loss in mitochondrial membrane potential induced by H2O2was
significantly suppressed by QE. It suggests that ERK activation and HO-1 induction with blocking both caspase 3 cascade and a loss in mitochondrial membrane potential participate in QE prevention of H2O2-induced apoptosis.
Activation of intracellular kinase cascades has been shown in the regulation of HO-1 gene expression. Kietz-mann et al. [33]showed that activation of JNK and p38 kinases was involved in induction of HO-1 gene expression in rat primary hepatocytes. Elbirt et al. [34]showed that HO-1 induced by arsenite was through activation of ERK and p38 in hepatoma cells. Our previous study showed that QE was an effective inducer of HO-1 gene[8]However, in related to the kinases involved in QE induction of HO-1 gene is still undefined. Here, we found that activation of ERKs but not JNK and p38 was identified in QE-treated macrophages, and attenuation of ERKs activation by PD98059 significantly reduced HO-1 protein expression induced by QE. It suggests that HO-1 gene induced by QE is through activation of ERKs but not JNK and p38 in RAW264.7 cells.
HO is the rate-limiting enzyme in the degradation of heme into bilirubin, carbon monoxide (CO), and free divalent iron (Fe2+), and three isoforms have been identi-fied. Among them, HO-1 is strongly induced by a variety of physiologic and pathophysiologic stimuli, including heme, heavy metals, cytokines, and nitric oxide. Accumulating evidence shows that the pivotal importance of HO-1 in mediating anti-oxidant, anti-inflammatory and anti-apop-totic effects. Choi et al.[35]indicated that over-expression
Fig. 6. QE (but not QI and RUT) reduces H2O2-induced intracellular peroxide level in RAW264.7 cells by DCHF-DA assay. RAW264.7 cells were treated with
QE, QI, RUT (50 mM), and N-acetyl cysteine (NAC; 10 mM) in the presence or absence of H2O2(400 mM) for 2 h. The level of intracellular peroxide in cells
was measured by flow cytometry analysis using DCHF-DA as a fluorescence dye. (A) A representative of the data if flow cytometry analysis. (B) Data are derived and quantitated from three-independent experiments, and each value is presented as the mean S.E.##
p< 0.01 indicates a significant difference between indicated groups, as analyzed by Student’s t-test.
of HO-1 inhibited FAS-induced apoptosis involving iron production. Vulapalli et al.[36]indicated that induction of HO-1 prevented IR-induced cardiac dysfunction and apop-tosis. Braudeau et al. [37]indicated that HO-1 induction prolonged the survival of cardiac allograft. However, the role of HO-1 in flavonoids prevention of oxidative stress-induced apoptosis is still unclear. Results of the present showed that inhibition of HO-1 expression by PD98059 or HO-1 enzyme activity by SnPP significantly attenuated the preventive effect of QE on H2O2-induced apoptosis. It
suggests that HO-1 may play a role in QE prevention of apoptosis induced by H2O2.
At least four metabolites produced by HO-1 including divalent iron, carbon monoxide (CO), biliverdin, and bilir-ubin have been reported. Several previous studies indicated that biliverdin and bilirubin were potent anti-oxidants, and possessed ability to inhibit ROS-induced DNA damages. Foresti et al.[38]reported that bilirubin induced by HO-1 decreased peroxynitrite-mediated cytotoxicity and reduc-tion of postischemic myocardial dysfuncreduc-tion in rat heart. Stocker et al. [39] showed that bilirubin was able to scavenge peroxyl radicals in vitro and the anti-oxidant activity of bilirubin surpasses that of a-tocopherol. Addi-tionally, CO has been shown to regulate vasocontriction/
Fig. 7. QE (but not QI and RUT) protects RAW264.7 cells from H2O2-induced a loss of mitochondrial membrane potential and cytochrome c (cyt c)
translocation. (A) Cells were treated with QE, QI, and RUT (50 mM) in the presence or absence of H2O2(400 mM) for 6 h. The mitochondrial membrane
potential of cells under different treatment was detected by flow cytometry analysis using DiOC6 as a fluorescence dye. Left panel, a representative of the data of flow cytometry analysis was presented. Right panel, ratio of M1 in different groups was quantitated from three-independent experiments. (B) QE (but not QI and RUT) at the concentration of 50 mM inhibited H2O2-induced cytochrome c release from mitochondria to cytosol. Cells were treated with of QE, QI, and RUT
(50 mM) in the presence of H2O2(400 mM) for 12 h. The expression of cytochrome c protein in the cytosolic and mitochondrial fractions was detected by
Western blotting using specific antibody.**p< 0.01 indicates a significant difference from the control.##p< 0.01 indicates a significant difference between indicated groups, as analyzed by Student’s t-test.
vasprelaxation and production of proinflammatory mole-cules via activation of guanylyl cyclase/cyclic GMP (cGMP) and p38 mitogen-activated protein kinase (MAPK) in cells [40]. Otterbein et al. [41,42] indicated that exposure of low concentration of CO was able to increase the tolerance to hyperoxic lung injury in rats. Sato et al.[43]reported that CO suppressed graft rejection via inhibiting platelet aggregation, vascular thrombosis and myocardial infarction. Results of the present study appeared that CO, but not divalent ferric, bilirubin and biliverdin, effectively reduced H2O2-induced cell death in
macrophages. It suggests that CO provides an important role in the cytoprotective effect of HO-1 induction.
Flavonoids have been shown to possess inhibitory activ-ity on intracellular signal transduction process in response to chemical stimulus[44]. Johnson and Loo[45]reported that a lower concentration of quercetin inhibited oxidative stress-induced DNA, and a higher concentration of
quer-cetin induced DNA damages via their proxidant activities. Kong et al.[46]also reported that a lower concentration of quercetin decreased the cell death via activating MAPKs, expressing survival genes (c-Fos, c-Jun) and defensive genes (phase II detoxifying enzymes; glutathione S-trans-ferase, quinone reductase). Results of the present study show that QE at the doses below 100 mM significantly decreases H2O2-induced peroxide production by
DCHF-DA assay without obvious cytotoxicity in cells, however QE induction of apoptosis is detected at the dose of 200 mM (data not shown). These data delineate a dou-ble-blade of QE, and show that lower doses of quercetin may contribute the cytoprotective effect in macrophages. Although QE prevention of oxidative stress-induced cell death has been reported, results of the present provide the first evidence to indicate that HO-1 involves in the pre-ventive mechanism of QE via activation of ERKs. Addi-tionally, glycoside addition may as a negative moiety in QE
Fig. 8. CO (but not bilirubin, biliverdin, Fe2+, Fe3+) exhibits protective effect on H2O2-induced cell death with inducing HO-1 protein expression and ERKs
protein phosphorylation in RAW264.7 cells. (A) Upper panel, cells were treated with FeSO4(Fe2+; 20 and 40 mM), FeCl3(Fe3+; 20 and 40 mM), biliverdin (BV;
10 and 20 mM), and bilirubin (BR; 10 and 20 mM) for 12 h, and expression of HO-1 protein was analyzed. Lower panel, cells were treated as described in ‘‘Upper panel’’ in the presence of H2O2(400 mM) for 12 h. The viability of cells was detected by MTT assay. (B) CO induction of HO-1 protein expression and
ERKs phosphorylation with a reduction in H2O2-induced cytotoxicity in macrophages. Upper panel, cells were treated with a CO donor [Ru(CO)3Cl2]2(25, 50
100 mM) for 12 h and expression of HO-1 protein was detected. Middle panel, cells were treated with [Ru(CO)3Cl2]2(100 mM) for different time points, and
expression of phosphorylated (pERK1/2) and total ERKs (ERK1/2) protein was detected. Lower panel, cells were treated as in ‘‘Upper panel’’ in the presence of H2O2(400 mM) treatment. The viability of cells was analyzed by MTT assay. Data are expressed as the mean S.E. of three-independent experiments. **p< 0.01, indicates a significant difference from H
prevention of H2O2-induced apoptosis in RAW264.7
macrophages. It suggests that flavonoids with ability to induce HO-1 gene expression may reserve potential to protect oxidative damages for further applications.
Acknowledgements
This study was supported by the National Science Council of Taiwan (NSC 91-2320-B-038-040, NSC92-2320-B-038-021, and NSC 92-2321-B-038-007) and the Taipei Medical University-Wan Fang Hospital (93TMU-WFH-05).
References
[1] Dhar A, Young MR, Colburn NH. The role of AP-1, NF-kappaB and ROS/NOS in skin carcinogenesis: the JB6 model is predictive. Mol Cell Biochem 2002;234–235(1–2):185–93.
[2] Kurz DJ, Decary S, Hong Y, Trivier E, Akhmedov A, Erusalimsky JD. Chronic oxidative stress compromises telomere integrity and accel-erates the onset of senescence in human endothelial cells. J Cell Sci 2004;117(Pt 11):2417–26.
[3] Cuda G, Paterno R, Ceravolo R, Candigliota M, Perrotti N, Perticone F, et al. Protection of human endothelial cells from oxidative stress: role of Ras-ERK1/2 signaling. Circulation 2002;105:968–74. [4] Chen YC, Shen SC, Lin HY. Rutinoside at C7 attenuates the
apoptosis-inducing activity of flavonoids. Biochem Pharmacol 2003;66(7): 1139–50.
[5] Ko CH, Shen SC, Chen YC. Hydroxylation at C40or C6 is essential for apoptosis-inducing activity of flavanone through activation of the caspase-3 cascade and production of reactive oxygen species. Free Rad Biol Med 2004;36(7):897–910.
[6] Shen SC, Ko CH, Tseng SW, Tsai SH, Chen YC. Structurally related antitumor effects of flavanones in vitro and in vivo: involvement of caspase 3 activation, p21 gene expression, and reactive oxygen species production. Toxicol Appl Pharmacol 2004;197(2):84–95.
[7] Shen SC, Ko CH, Hsu KC, Chen YC. 3-OH flavone inhibition of epidermal growth factor-induced proliferaton through blocking pros-taglandin E2 production. Int J Cancer 2004;108(4):502–10. [8] Lin HY, Juan SH, Shen SC, Hsu FL, Chen YC. Inhibition of
lipopo-lysaccharide-induced nitric oxide production by flavonoids in RAW264.7 macrophages involves heme oxygenase-1. Biochem Phar-macol 2003;66(9):1821–32.
[9] Noroozi M, Angerson WJ, Lean ME. Effects of flavonoids and Vitamin C on oxidative DNA damage to human lymphocytes. Am J Clin Nutr 1998;67(6):1210–8.
[10] Mardla V, Kobzar G, Samel N. Potentiation of antiaggregating effect of prostaglandins by alpha-tocopherol and quercetin. Platelets 2004;15(5):319–24.
[11] Shen SC, Chen YC, Hsu FL, Lee WR. Differential apoptosis-inducing effect of quercetin and its glycosides in human promyeloleukemic HL-60 cells by alternative activation of the caspase 3 cascade. J Cell Biochem 2003;89(5):1044–55.
[12] Park YH, Chiou GC. Structure–activity relationship (SAR) between some natural flavonoids and ocular blood flow in the rabbit. J Ocul Pharmacol Ther 2004;20(1):35–42.
[13] Yoshizumi M, Tsuchiya K, Kirima K, Kyaw M, Suzaki Y, Tamaki T. Quercetin inhibits Sh and phosphatidylinositol 3-kinase-mediated c-Jun N-terminal kinase activation by angiotensin II in cultured rat aortic smooth muscle cells. Mol Pharmacol 2001;60(4):656–65.
[14] Wei YQ, Zhao X, Kariya Y, Fukata H, Teshigawara K, Uchida A. Induction of apoptosis by quercetin: involvement of heat shock protein. Cancer Res 1994;54(18):4952–7.
[15] Nguyen TT, Tran E, Nguyen TH, Do PT, Huynh TH, Huynh H. The role of activated MEK-ERK pathway in quercetin-induced growth inhibition and apoptosis in A549 lung cancer cells. Carcinogenesis 2004;25(5):647–59.
[16] Yokoo T, Kitamura M. Unexpected protection of glomerular mesan-gial cells from oxidant-triggered apoptosis by bioflavonoid quercetin. Am J Physiol 1997;273(2 Pt 2):F206–12.
[17] Ryter SW, Tyrrell RM. The heme synthesis and degradation pathways: role in oxidant sensitivity. Heme oxygenase has both pro- and anti-oxidant properties. Free Radic Biol Med 2000;28:289–309. [18] Takahashi T, Morita K, Akagi R, Sassa S. Heme oxygenase-1: a novel
therapeutic target in oxidative tissue injuries. Curr Med Chem 2004;11(12):1545–61.
[19] Zhou H, Lu F, Latham C, Zander DS, Visner GA. Heme oxygenase-1 expression in human lungs with cystic fibrosis and cytoprotective effects against Pseudomonas aeruginosa in vitro. Am J Respir Crit Care Med 2004;170(6):633–40.
[20] Soares MP, Lin Y, Anrather J, Csizmadia E, Takigami K, Sato K, et al. Expression of heme oxygenase-1 can determine cardiac xenograft survival. Nat Med 1998;4:1073–7.
[21] Taille C, El-Benna J, Lanone S, Dang MC, Ogier-Denis E, Aubier M, et al. Induction of heme oxygenase-1 inhibits NAD(P)H oxidase activity by down-regulating cytochrome b558 expression via the reduction of heme availability. J Biol Chem 2004;279(27):28681–8. [22] Dennery PA, Visner G, Weng YH, Nguyen X, Lu F, Zander D, et al. Resistance to hyperoxia with heme oxygenase-1 disruption: role of iron. Free Radic Biol Med 2003;34(1):124–33.
[23] William RJ, Spencer JP, Rice-Evans C. Flavonoids: antioxidants or signaling molecular? Free Radic Biol Med 2004;36:838–94. [24] Kang HM, Kim JH, Lee MY, Son KH, Yang DC, Baek NI, et al.
Relationship between flavonoid structure and inhibition of farnesyl protein transferase. Nat Prod Res 2004;18(4):349–56.
[25] Park YH, Chiou GC. Structure-activity relationship (SAR) between some natural flavonoids and ocular blood flow in the rabbit. J Ocul Pharmacol Therapeut 2004;20(1):35–42.
[26] Regev-Shoshani G, Shoseyov O, Bilkis I, Kerem Z. Glycosylation of resveratrol protects it from enzymic oxidation. Biochem J 2003;374(Pt 1):157–63.
[27] Lin HY, Shen SC, Chen YC. Anti-inflammatory effect of heme oxygenase 1: Glycosylation and nitric oxide inhibition in macro-phages. J Cell Physiol 2005;202:579–90.
[28] Park C, So HS, Shin CH, Baek SH, Moon BS, Shin SH, et al. Quercetin protects the hydrogen peroxide-induced apoptosis via inhibition of mitochondrial dysfunction in H9c2 cardiomyoblast cells. Biochem Pharmacol 2003;66(7):1287–95.
[29] Ishikawa Y, Kitamura M. Anti-apoptotic effect of quercetin: inter-vention in the JNK- and ERK-mediated apoptotic pathways. Kidney Int 2000;58(3):1078–87.
[30] Musonda CA, Chipman JK. Quercetin inhibits hydrogen peroxide (H2O2)-induced NF-kappaB DNA binding activity and DNA damage
in HepG2 cells. Carcinogenesis 1998;19(9):1583–9.
[31] Laughton MJ, Halliwell B, Evans PJ, Hoult JR. Antioxidant and pro-oxidant actions of the plant phenolics quercetin, gossypol and myr-icetin. Effects on lipid peroxidation, hydroxyl radical generation and bleomycin-dependent damage to DNA. Biochem Pharmacol 1989;38(17):2859–65.
[32] Suzuki S, Takada T, Sugawara Y, Muto T, Kominami R. Quercetin induces recombinational mutations in cultured cells as detected by DNA fingerprinting. Jpn J Cancer Res 1991;82(10):1061–4. [33] Kietzmann T, Samoylenko A, Immenschuh S. Transcriptional
regula-tion of heme oxygenase-1 gene expression by MAP kinases of the JNK and p38 pathways in primary cultures of rat hepatocytes. J Biol Chem 2003;278:17927–36.
[34] Elbirt KK, Whitmarsh AJ, Davis RJ, Bonkovsky HL. Mechanism of sodium arsenite-mediated induction of heme oxygenase-1 in hepa-toma cells. Role of mitogen-activated protein kinases. J Biol Chem 1998;273:8922–31.
[35] Choi BM, Pae HO, Jeong YR, Oh GS, Jun CD, Kim BR, et al. Overexpression of heme oxygenase (HO)-1 renders Jurkat T cells resistant to fas-mediated apoptosis: involvement of iron released by HO-1. Free Radic Biol Med 2004;36(7):858–71.
[36] Vulapalli SR, Chen Z, Chua BH, Wang T, Liang CS. Cardioselective overexpression of HO-1 prevents I/R-induced cardiac dysfunction and apoptosis. Am J Physiol 2002;283(2):H688–94.
[37] Braudeau C, Bouchet D, Tesson L, Iyer S, Remy S, Buelow R, et al. Induction of long-term cardiac allograft survival by heme oxygenase-1 gene transfer. Gene Ther 2004;11(8):701–10.
[38] Foresti R, Sarathchandra P, Clark JE, Green CJ, Motterlini R. Perox-ynitrite induces haem oxygenase-1 in vascular endothelial cells: a link to apoptosis. Biochem J 1999;339:729–36.
[39] Stocker R, Yamamoto Y, McDonagh AF, Glazer AN, Ames BN. Bilirubin is an antioxidant of possible physiological importance. Science 1987;235:1043–6.
[40] Soares MP, Usheva A, Brouard S, Berberat PO, Gunther L, Tobiasch E, et al. Modulation of endothelial cell apoptosis by heme oxygenase-1-derived carbon monoxide. Antioxid Redox Signal 2002;4:321–9.
[41] Otterbein LE, Mantell LL, Choi AM. Carbon monoxide provides protection against hyperoxic lung injury. Am J Physiol 1999;276(4 Pt 1):L688–94.
[42] Otterbein LE, Otterbein SL, Ifedigbo E, Liu F, Morse DE, Fearns C, et al. MKK3 mitogen-activated protein kinase pathway mediates carbon monoxide-induced protection against oxidant-induced lung injury. Am J Pathol 2003;163(6):2555–63.
[43] Sato K, Balla J, Otterbein L, Smith RN, Brouard S, Lin Y, et al. Carbon monoxide generated by heme oxygenase-1 suppresses the rejection of mouse-to-rat cardiac transplants. J Immunol 2001;166: 4185–94.
[44] Ko CH, Shen SC, Lee TJF. Chen YC. Myricetin inhibits matrix metalloproteinase 2 protein expression and enzyme activity in colorectal carcinoma cells. Mol Cancer Ther 2005;4:281–90. [45] Johnson MK, Loo G. Effects of epigallocatechin gallate and quercetin
on oxidative damage to cellular DNA. Mutat Res 2000;459: 211–8.
[46] Kong AN, Yu R, Chen C, Mandlekar S, Primiano T. Signal transduc-tion events elicited by natural products: role of MAPK and caspase pathways in homeostatic response and induction of apoptosis. Arch Pharm Res 2000;23:1–16.
