• 沒有找到結果。

Cloning and characterization of monacolin K biosynthetic gene cluster from Monascus pilosus

N/A
N/A
Protected

Academic year: 2021

Share "Cloning and characterization of monacolin K biosynthetic gene cluster from Monascus pilosus"

Copied!
8
0
0

加載中.... (立即查看全文)

全文

(1)

Cloning and Characterization of Monacolin K

Biosynthetic Gene Cluster from Monascus pilosus

Y

I

-P

EI

C

HEN

,

†,‡

C

HING

-P

ING

T

SENG

,

L

I

-L

ING

L

IAW

,

C

HUN

-L

IN

W

ANG

,

I-C

HING

C

HEN

,

W

EN

-J

UNG

W

U

,

M

ING

-D

ER

W

U

,

† AND

G

WO

-F

ANG

Y

UAN

*

,† Bioresource Collection and Research Center, Food Industry Research and Development Institute, and Department of Biological Science and Technology, National Chiao Tung University, HsinChu, Taiwan

Monacolin K is a secondary metabolite synthesized by polyketide synthases (PKS) from Monascus, and it has the same structure as lovastatin, which is mainly produced by Aspergillus terreus. In the present study, a bacterial artificial chromosome (BAC) clone, mps01, was screened from the BAC library constructed from Monascus pilosus BCRC38072 genomic DNA. The putative monacolin K biosynthetic gene cluster was found within a 42 kb region in the mps01 clone. The deduced amino acid sequences encoded by the nine genes designated as mokA-mokI, which share over 54% similarity with the lovastatin biosynthetic gene cluster in A. terreus, were assumed to be involved in monacolin K biosynthesis. A gene disruption construct designed to replace the central part of mokA, a polyketide synthase gene, in wild-type M. pilosus BCRC38072 with a hygromycin B resistance gene through homologous recombination, resulted in a mokA-disrupted strain. The disruptant did not produce monacolin K, indicating that mokA encoded the PKS responsible for monacolin K biosynthesis in M. pilosus BCRC38072.

KEYWORDS: Monacolin K; polyketide synthases; Monascus pilosus; bacterial artificial chromosome INTRODUCTION

Monascus spp. are filamentous fungi that have been used in

Chinese fermented foods for thousands of years. They are known

as producers of various secondary metabolites with polyketide

structures, including monacolins, pigments, and citrinin (1–4).

Monacolin K, a cholesterol synthesis inhibitor, was first isolated

from the medium of Monascus ruber (1), and the same substance

was found in Aspergillus terreus as lovastatin (5). It belongs to

polyketide synthesized by the iterative type I PKSs. The

structure of monacolin K shares similarity with HMG-CoA;

therefore, monacolin K competitively inhibits HMG-CoA

re-ductase with HMG-CoA during cholesterol synthesis resulting

in the reduction of cholesterol synthesis (6).

In previous studies, the lovastatin biosynthetic pathway was

proposed in A. terreus. Two polyketide synthases (loVB and

loVF), transesterase (loVD), enoyl reductase (ER) (loVC), and

P450 monooxygenase (loVA) have been proven to be involved

in the structural biosynthesis of lovastatin (7–9). Transformation

of an extra copy of the loVE gene-encoded transcription factor

into the wild-type strain resulted in a 7-10-fold overproduction

of lovastatin (7). Although the lovastatin biosynthetic gene

cluster in A. terreus has been characterized (10), the structural

genes responsible for monacolin K (lovastatin) biosynthesis in

Monascus are still unclear. In the present study, to explore the

monacolin K biosynthetic gene cluster, construction of a

bac-terial artificial chromosome (BAC) library from M. pilosus

BCRC38072 producing monacolin K was carried out. According

to the conserved region of the loVB gene (lovastatin nonaketide

synthase, LNKS), A. terreus was designed as a probe (11), and

the mps01 clone containing the putative monacolin K

biosyn-thetic gene cluster was isolated. Analysis of the disruption of

the polyketide synthase gene (mokA) was conducted to identify

the gene involved in monacolin K biosynthesis.

MATERIALS AND METHODS

Strain Used and Growth Conditions. M. pilosus BCRC38072, which is a monacolin K-producing strain isolated from red rice (anka), was collected from a local traditional market and used in this study. To identify the transcripts from monacolin K biosynthetic genes, the strain was incubated on YM (DIFCO 271120, Detroit, MI) agar for 1 week, and spore suspensions were obtained by washing cultured YM agar plates with distilled water. Mycelia were harvested after incubation for 12 days at 25°C with constant agitation in liquid medium (7% glycerol, 3% glucose, 3% monosodium glutamate, 1.2% polypetone, 0.2% NaNO3, and 0.1% MgSO4· 7H2O).

BAC Library Construction. The methods of Peterson et al. (12) were used to construct the BAC library. Fragments of genomic DNA ranging in size from 150 to 300 kb were excised from pulse field gel electrophoresis (PFGE) and recovered by electroelution (BioRad, Hercules, CA). The eluted DNA was used for ligation. To perform the ligation, 100-200 ng of electroeluted DNA was mixed with 50 ng of linearized vector DNA (pIndigoBAC-5 HindIII Ready, Epicenter, Madison, WS), after which the ligation products were used to transform * To whom correspondence should be addressed. Tel:

+886-3-5223191ext. 580. Fax: +886-3-5224171. E-mail: address: gfy@ firdi.org.tw.

Food Industry Research and Development Institute.

National Chiao Tung University.

10.1021/jf800595k CCC: $40.75  2008 American Chemical Society Published on Web 06/26/2008

(2)

Escherichia coli strain TransforMax EC 100 electrocompetent

(Epi-center, Madison, WI) by electroporation. Transformed cells were cultured on LB agar plates supplemented with chloramphenicol (12.5

µg mL-1), IPTG (100 µg mL-1), and XGal (50 µg mL-1). The resulting white bacterial colonies were harvested and transferred to 384 well plates for library screening or storage at -80°C in freezing medium (2.5% [w/v] LB, 36 mM K2HPO4, 13.2 mM KH2PO4, 1.7 mM sodium

citrate, 0.4 mM MgSO4, 6.8 mM [NH4]2SO4, and 4.4% v/v

gly-cerol).

Library Screening, Sequencing, and Sequence Analysis. About 12000 clones from the BAC library were cultured on LB agar plates, after which they were transferred to nylon membranes and then subjected to alkali-sodium dodecyl sulfate lysis. The plasmid DNAs extracted from BAC clones were cross-linked to nylon membranes by UV irradiation. According to the conserved region of the ketosynthase domain of the loVB gene in A. terreus (10), the primer set (Mplov1, 5′-TCCACTGCCGTTTATGTTG-3′; Mplov2, 5′-GATGGGGTGAA-GATGACGA-3′) was designed for the probe synthesis using a PCR DIG probe synthesis kit (Roche Diagnostics, Mannheim, Germany). The clones of membranes were screened to find a gene cluster involved in polyketide biosynthesis metabolism. Twenty-five positive BACs were identified in screening by colony hybridization. Two of these, mps01 and mps02, containing the longest inserted DNA, were sequenced. BAC DNA for shotgun sequencing was extracted with a Qiagen Large-Construct kit (Qiagen, Valencia, CA) and sheared by sonication. The DNA fragments were blunted with the Bal31 nuclease and T4 DNA polymerase. Fragments were excised from the gel ranging in size from 1 to 2 kb and inserted into a pUC18/SmaI/CIAP (Amersham Pharmacia Biotech, Piscataway, NJ) vector. The ligation products were transformed into E. coli strain TransforMax EC 100 electrocompent (Epicenter, Madison, WS) by electroporation to construct the subclone library. Transformed cells were cultured on LB agar plates supplemented with ampicillin (50 µg mL-1), IPTG (100 µg mL-1), and XGal (50 µg mL-1). The resulting white bacterial colonies were harvested and transferred to 96 deep well plates for overnight culture in LB broth and ampicillin (50 µg mL-1). The inserts of these subclones were isolated and dissolved in 30 µL of TE. Cycle sequencing reactions were carried out using a BigDye, V3.0 kit with universal primers. DNA sequencing for 10-fold coverage was performed with an ABI Prism 3700 Sequencer (Applied Biosystems, Foster City, CA). The Phred-Phrap-Consed system developed by the Phil Green Laboratory was used to assemble DNA fragments (13, 14). Nucleotide and deduced amino acid sequences were used to interrogate the nonredundant database at GenBank using BLASTN and BLASTX. The BAC mps01 contained the complete monacolin K gene cluster instead of the incomplete mps02.

Nucleic Acid Manipulations. Fungal genomic DNA was isolated by liquid nitrogen treatment according to the method developed by Bingle et al. (15). Colony hybridization, Southern hybridization, and Northern hybridization were performed using the DIG system (DIG wash and buffer set) (Roche Diagnostics, Mannheim, Germany). The manipulations of transfer, immobilization, and hybridization of DNA and RNA were carried out as described in Sambrook et al. (16). Total RNAs of M. pilosus BCRC 38072 were isolated with TRIzol reagent (Invitrogen, Carlsbad, CA) for Northern hybridizations and reverse-transcription polymerase chain reaction (PCR) analyses. The probes of monacolin K biosynthetic genes were DIG-labeled by PCR amplification using the PCR DIG probe synthesis kit (Roche Diagnos-tics, Mannheim, Germany). The primer sets of monacolin K biosynthetic genes were as follows: pmkA-f, ATAGCTCCGAGAATGGTCCC, and pmkA-r, CCATCAAGGATGCTCTGTC; pmkB-f, CTAGACTTTGCT-TCCCACGCC, and pmkB-r, CATTGTCGAGCGTTGGAGTC; pmkC-f, TCAGAGATCTTCGTCCCGAC, and pmkC-r, GGCCTGAGCCGA-AGAAGTAC; pmkD-f, TGATGACTTTGCCCTGGCGG, and pmkD-r, TCACCCAATGACTCTAGCCC; pmkE-f, TTCTCTCCCGACAACT-GCCC, and pmkE-r, AATGGTCACCGCCGACTGGA; pmkF-f, GC-CCCGAATCCTACATGAAG, and pmkF-r, GGCCCACCGTAGTTGAT-GTG; pmkG-f, CCTCGCTCTGAATATGACCC, and pmkG-r, TCGGAT-CGGCTTCTCAAACC; pmkH-f, ACCTCATCGCTCCAGACCAT, and pmkH-r, CTGCGAGAGAATGAGAGTGC; and pmkI-f, CCATACAT-TCTACCTTGCGG, and pmkI-r, CTAGACTCGTTCATCGCGGC.

cDNA Analysis. cDNA sequencing of nine genes, designated as

mokA-mokI, was carried out to characterize their structure. First strand

cDNA was synthesized by the ImProm-II Reverse Transcription System (Promega, Madison, WI) and used as the template for PCR. Amplifica-tion of full-length or partial cDNAs was performed with several sets of oligonucleotide primers. Sequences analyses were performed using VectorNTI 9.0 (InforMax, Frederick, MD) software.

Targeted Gene Disruption of mokA. The human cytomegalovirus (CMV) promoter of plasmid pHygEGFP (BD Biosciences Clontech, Palo Alto, CA) was replaced with a 0.5 kb BglII-XhoI fragment of the heat shock protein 90 (hsp 90) promoter from M. pilosus BCRC38072 (GenBank accession no. DQ983312) to obtain the plasmid pMS-hsp. The hph cassette, a hygromycin B resistance gene, was flanked at the 5′-site by 2.0 kb and at the 3′-site by 3.1 kb, respectively, of the mokA gene to obtain the plasmid pMkAko. The transformant that had mokA replaced with pMkAko by homologous recombination was identified by Southern hybridization.

Transformation of M. pilosus BCRC38072. The conidia from a 1 week culture of M. pilosus were incubated in 100 mL of Vogel medium at 30 °C for 16-18 h. The mycelia were harvested on miracloth (Millipore, Bedford, MA) and washed in MA digestion solution (0.1 M maleic acid, pH 5.5, and 1.2 M (NH4)2SO4). The mycelia were

digested for 4-5 h using 100 mg of Yatalase (Takara, Tokyo, Japan), 100 mg of lysing enzyme (Sigma, St. Louis, MO), and 100 µL of

β-glucuronidase (Sigma, St. Louis, MO) in 50 mL of MA digestion

solution. To remove undigested mycelia, protoplasts were harvested by passing through miracloth and by centrifugation at 1000 rpm for 10 min (Sorvall, Wilmington, United States). The protoplasts were maintained in 80% STC (1 M sorbitol, 50 mM Tris, pH 8.0, and 50 mM CaCl2) and 20% PTC (40% PEG 4000, 50 mM Tris, pH 8.0, and

50 mM CaCl2), and dimethylsulfoxide (DMSO) was added to a final

concentration of 1%. For genetic transformation of M. pilosus, the 100

µL of protoplasts was mixed with 5 µg of linearized DNA. The mixtures

were incubated on ice for 30 min. One milliliter of PTC was added and mixed gently. Following incubation at room temperature for 20 min, the protoplast mixtures were added to 15 mL of SYP medium (1 M sorbitol, 0.1% yeast extract, 0.1% peptone, and 2% agar) that contained 60 µg hygromycin B/mL. Plates were incubated at 28°C, and the transformants were detected by PCR and Southern hy-bridization.

Measurement of Monacolin K. The aliquots of M. pilosus culture were cleared of cells and filtered through a 0.2 mm filter. The supernatants were analyzed by high-performance liquid chromatography (HPLC) performed on a Waters system (Waters, Milford, MA) fitted with a reverse-phase C18column (LichroCART 250-4, Rp-18e, 5 µm).

The HPLC parameters were as follows: solvent A, 0.1% phosphorus acid in water; solvent B, acetonitrile; 35% A and 65% B in 30 min; flow rate, 1.5 mL min-1; and detection by UV spectroscopy (Waters 600 pump and 996 pgotodiode array detector). The monacolin K purified from the cultivation of M. pilosus BCRC38072 was verified by mass and 1H NMR spectroscopic analyses. A standard monacolin K

compound (Sigma, St. Louis, MO) was used to confirm the analysis by HPLC.

Nucleotide Sequence Accession Number. The nucleotide sequence of the monacolin K biosynthetic gene cluster was submitted to GenBank under the accession number DQ176595.

RESULTS

Cloning of Monacolin K Biosynthetic Gene Cluster.

Studies on fungal polyketide biosynthetic genes indicate that

metabolites are largely synthesized by iterative multifunctional

polyketide synthase systems (17). Each PKS minimally carries

keto-synthase (KS), acyltransferase (AT), and acyl carrier protein

(ACP) domains to catalyze different modifications. To search

for the genes related to monacolin K biosynthesis, degenerate

primers designed according to the conserved region of the KS

domain of the loVB gene in A. terreus (11), were used to amplify

genomic DNA from M. pilosus BCRC38072. The candidate

PCR products were sequenced and analyzed. The result of the

(3)

amplified DNA showed that the PCR product shared a 75%

similarity with the KS domain of the loVB gene in A. terreus

(data not shown). This DNA fragment was further used to design

a specific probe for cloning of the PKS gene.

A BAC library consisting of 12000 clones was constructed

from the total DNA of M. pilosus BCRC38072. By screening

the library with the specific PKS probe, 25 positive BACs were

identified. To evaluate the sizes of the BACs, PFEG and

Southern hybridization were carried out. The BAC designated

as mps01 was selected for shotgun sequencing. It yielded a

contig of approximately 160 kb. Database searches and open

reading frame (ORF) prediction further provided information

on the putative gene loci. The whole sequences of mps01 were

annotated by BLASTN and BLASTX, and 30 ORFs were

predicted.

Identification of Genes Involved in Monacolin K

Biosyn-thesis. Within the 30 putative genes, nine genes were found to

have strong homology to the genes involved in the lovastatin

biosynthetic gene cluster (10), and they were presumed to

encode proteins required for monacolin K biosynthesis (Table

1). The putative gene cluster of monacolin K covered 42 kb

(Figure 1A) (GenBank accession no. DQ176595). Moreover,

they also shared high similarity with the genes involved in the

compactin biosynthetic gene cluster of Penicillium citrinum (18).

The structure of monacolin K differs from that of compactin,

in which a methyl group derived from S-adenosyl-

L

-methionine

(SAM) is introduced at the C-6 position of the

nonaketide-derived backbone. An extensive comparison analysis of these

nine genes indicated the presence of two polyketide synthase

genes by BLAST. One was predicted to be responsible for the

synthesis of the nonaketide skeleton (mokA), while the other

was for the synthesis of the diketide skeleton (mokB). Also

included were a P450 monooxygenase gene (mokC), an

oxi-doreductase gene (mokD), a dehydrogenase gene (mokE), a

tran-sesterase gene (mokF), an HMG-CoA reductase gene (mokG),

a transcription factor gene (mokH), and an efflux pump gene

(mokI).

To assess the transcription of the predicted monacolin K

biosynthetic genes, Northern hybridizations were performed with

DIG-labeled probes. Transcripts of the putative monacolin K

biosynthetic genes could be detected on the eighth day (Figure

1B). The cDNA sequences were used to annotate the nine gene

sequences. For this, several sets of oligonucleotide primers were

designed to amplify cDNAs by reverse-transcription PCR. Only

the mokD gene revealed no intron, and others contained at least

one intron with sizes ranging from 52 to 109 bp. The deduced

amino acid sequences of the putative monacolin K biosynthetic

gene cluster were confirmed, and the sequence similarity among

corresponding genes of A. terreus and P. citrinum is shown in

Table 1. Several conserved domains were recognized in MokA

and MokB by comparing their amino acid sequences with those

of known PKSs. The domains of KS, AT, DH, MeT, KR, and

ACP are included in both MokA and MokB. Additionally,

MokB comprised an additional ER domain similar to the

corresponding gene loVF of A. terreus, as shown in Figure 1C.

The mokH gene-encoded transcription factor was suggested to

be a positive regulatory protein for the production of monacolin

K just like loVE, which is involved in lovastatin biosynthesis

in A. terreus (Figure 2) (10). The arrangement of a

cysteine-rich nucleotide-binding domain indicated that the consensus

sequence CX

2

CX

6

CX

11

CX

2

CX

6

C represented a Zn

2

Cys

6

type

zinc finger (7, 10).

Polyketides are frequently synthesized from CoA

thioesteri-fied carboxylic acids, and the extent of keto-group processing

varies from one condensation cycle to another (7). In this study,

the phylogeny was further constructed according to the

con-served domain of KS (Figure 3A). The result showed that the

PKSs were divided into three clades. The clade of mokA and

mokB was subdivided into two subclades belonging to the

structural type of highly reduced polyketide. Because the MeT

domain in mlcA of the compactin biosynthetic gene cluster is

assumed to be inactive (18), the domain was compared among

corresponding PKSs from M. pilosus, P. citrinum, and A.

terreus, and our results showed that the amino acid residues of

mlcA in consensus motifs were different from those of the other

PKS, as boxed (Figure 3B).

Disruption of mokA Gene in M. pilosus BCRC38072. The

mokA gene-encoded polyketide synthase was suggested to

synthesize the nonaketide of monacolin K. In this study, the

mokA gene was disrupted in M. pilosus BCRC38072 by

homologous recombination to identify the gene involved in

monacolin K biosynthesis. Plasmid pMkAko was linearized at

the FspI sites and was used to transform strain BCRC38072

(Figure 4A). Forty-four transformants were isolated, one of

which had a MokA

s

genotype by Southern hybridization.

Southern hybridization analysis of NdeI-digested DNA

in-dicated that instead of a 7.1 kb fragment corresponding to the

mokA gene in wild-type BCRC38072, a 3.8 kb NdeI fragment

was present in the disruptant BCRC38135 (Figure 4B,C). Thus,

our result revealed that disruption of mokA gene had occurred.

A precise gene replacement, in which the nonfunctional mokA

gene construct (pMkAko) replaced the functional chromosomal

mokA gene, yielded NdeI fragments of 3.8 kb. In addition, the

amount and structure of monacolin K produced from M. pilosus

BCRC38072 and BCRC38135 on the eighth day of cultivation

were further determined by HPLC, mass, and

1

H NMR

spectroscopic analyses. Monacolin K was detectable in

wild-type M. pilosus BCRC38072, as confirmed by UV light

Table 1. Summary of Genes Identified in BAC mps01 Obtained from M. pilosus BCRC38072

mok genes amino acidsa

putative molecular mass

(kDa) proposed functionb homologous lov genec protein similarity (%)d homologous mlc genee

protein similarity (%)d

mokA 3075 338.1 polyketide synthase lovB 76 mlcA 66

mokB 2547 278.3 polyketide synthase lovF 73 mlcB 61

mokC 524 60.6 P450 monooxygenase lovA 85 mlcC 67

mokD 263 28.9 oxidoreductase lovG 67 mlcF 53

mokE 360 38.9 dehydrogenase lovC 81 mlcG 70

mokF 413 46.8 transesterase lovD 74 mlcH 63

mokG 1052 113.0 HMG-CoA reductase lvrA 69 mlcD 39

mokH 455 49.4 transcription factor lovE 54 mlcR 49

mokI 543 57.5 efflux pump lovI 81 mlcE 68

aThe deduced amino acid sequences were determined from cDNA sequences.bThe proposed gene functions were based on their homology to proteins in the GenBank database.cThe lovastatin biosynthetic gene cluster.dSimilarity was obtained by alignment using VectorNTI 9.0 (InforMax) software.eThe compactin biosynthetic gene cluster.

(4)

absorption, mass, and

1

H NMR spectra (Figure 5). The peak

of monacolin K from M. pilosus BCRC38072 was identified

by comparison to the monacolin K standard, which showed three

maximum absorptions at (λ

max

) 230, 237, and 246 nm (Figure

Figure 1. Identification of the monacolin K biosynthetic gene cluster of M. pilosus BCRC38072. (A) The genes involved in the biosynthesis of monacolin K. For proposed functions of assigned ORFs, see Table 1. The small black bars indicated the probes for Northern hybridization analysis. The lovastatin biosynthetic gene cluster in A. terreus was obtained from the GenBank database using the following accession numbers: AF141924, AF151722, and AF141925. The compactin biosynthetic gene cluster in P. citrinum was obtained from the GenBank database using the following accession number: AB072893. (B) Northern hybridization analyses. Total RNA isolated after 12 days of cultivation was blotted. Total RNA (6 µg per lane) was separated on 0.8% agarose gels by electrophoresis. The size of each transcript was estimated by comparison with markers of known size. (C) Arrangement of functional domains of genes encoding PKSs in the biosynthesis of monacolin K. DH, dehydratase; MeT, methyltransferase; KR, keto-reductase; and ACP, ACP.

Figure 2. Deduced amino acid sequences alignment of transcription factors from the mokH, lovE, and mlcR genes. The cysteine-rich nucleotide-binding domain represented a Zn2Cys6type zinc finger with the consensus sequence CX2CX6CX11CX2CX6C shown boxed.

(5)

5A). The mass spectrum of monacolin K revealed that the

molecular weight was 404, which also agreed with the standard

(C

24

H

36

O

5

) (Figure 5B). Moreover, the structure of monacolin

K was further verified by

1

H NMR spectrum [

1

H NMR (400

Hz, CDCl

3

): δ 5.98 (1H, d, J ) 10.0 Hz, H-5), 5.76 (1H, dd, J

) 6.4, 6.0 Hz, H-6), 5.50 (1H, d, J ) 2.8 Hz, H-4), 5.36 (1H,

dt, J ) 4.8, 3.2 Hz, H-1), 4.60 (1H, m, H-5

′), 4.33 (1H, m,

H-3

′), 2.72 (1H, dd, J ) 5.2, 4.8 Hz, H

ax

-2′), 2.62 (1H, ddd,

J ) 3.6, 3.2, 2.4, H

eq

-2′), 2.43 (2H, m, H-3), 2.38 (1H, m,

H-7), 2.36 (1H, m, H-2

′′), 2.27 (1H, dd, J ) 2.8, 2.8 Hz, H-8a),

1.98 (1H, m, H

eq

-4′), 1.95 (2H, m, H-2), 1.89 (1H, m, H-6′),

1.72 (1H, m, H-8), 1.65 (1H, m, H

ex

-4′), 1.63 (1H, m, H-3′′),

1.48 (1H, m, H-7

′), 1.42 (1H, m, H-3′′), 1.38 (1H, m, H-7′),

1.29 (1H, m, H-6

′), 1.11 (3H, d, J ) 7.2 Hz, H-2′′-CH

3

), 1.06

(3H, d, J ) 7.2 Hz, H-3-CH

3

), 0.88 (3H, d, J ) 7.2 Hz,

H-7-CH

3

), 0.86 (3H, t, J ) 7.6 Hz, H-4

′′)]. However, the disruptant

M. pilosus BCRC38135 did not produce monacolin K, indicating

that the mokA gene is responsible for monacolin K biosynthesis

in M. pilosus BCRC38072 (Figure 5C).

DISCUSSION

Monacolin K, also known as lovastatin, is a polyketide used

to reduce serum cholesterol levels in humans. Over the past

years, it has become clear that polyketides are assembled in a

variety of mechanistically complex ways (7). Studies on the

lovastatin biosynthetic gene cluster of A. terreus have shown

18 putative ORFs based on the sequence alignment and

characterization of genetically related fungal strains (10).

Surprisingly, only nine genes in the BAC of M. pilosus

BCRC38072 have revealed high homology to the genes involved

in lovastatin biosynthetic gene cluster of A. terreus (Table 1).

Moreover, the genomic arrangement of monacolin K

biosyn-thetic genes in M. pilosus BCRC38072 has corresponded to the

lovastatin biosynthetic genes in A. terreus (Figure 1A). The

high homology between gene clusters of mok and loV implies

that the mok gene cluster was responsible for monacolin K

biosynthesis. To prove this, we disrupted the mokA

gene-encoded polyketide synthase from wild-type M. pilosus

BCRC38072. The phenotype of lost monacolin K productivity

in the disruptant BCRC 38135 indicates that the mokA gene

was essential for monacolin K production (Figure 5C).

In particular, these genes also showed significant homology

to genes identified in the compactin biosynthetic gene cluster

of P. citrinum (18). However, the genomic arrangement of

compactin biosynthetic genes was different from that of the

monacolin K or lovastatin biosynthetic gene clusters (Figure

1A). The order and direction of P450 monooxygenase (mokC),

polyketide synthase (mokA), oxidoreductase (mokD),

dehydro-genase (mokE), and transesterase (mokF) was the same in M.

pilosus, A. terreus, and P. citrinum, whereas the organization

of other genes of the compactin biosynthetic gene cluster was

different (10, 18). Furthermore, polyketide synthase (mokB),

monooxygenase (mokC), oxidoreductase (mokD), dehydrogenase

(mokE), and an efflux pump (mokI) appeared to have the same

number of introns and similar intron positions among M. pilosus,

A. terreus, and P. citrinum.

A. terreus and P. citrinum both belong to the family

Trichocomaceae, but they are different from M. pilosus, which

Figure 3. (A) Phylogenetic tree of PKSs from M. pilosus BCRC38072 and various organisms. The phylogeny of PKSs based on the conserved KS domains described by Kroken et al. (21) was constructed and rooted using KS domains of Saccharopolyspora erythraea DEBS (X56107 and X62569). Accession numbers for the polyketide synthase genes were used as follows: A. terreus lovF (AF141925), A. terreus lovB (AF151722), P. citrinum mlcA, mlcB (AB072893), Phoma sp. SQTKS (AY217789), Cochliobolus heterostrophus pks1 (U68040), Gibberella moniliformis FUM1 (AF155773), Monascus purpureus pksCT (AB167465), Emericella nidulans wA (X65866), Emericella nidulans stcA (AAC49191), Aspergillus parasiticus aflC (AY371490), Penicillium patulum 6-MSAS (X55776), Aspergillus parasiticus pksL2 (U52151), and A. terreus pksM (U31329). Bootstrap values were shown in the nodes according to 1000 replications. Only bootstrap values >50% are shown. The tree was constructed by the neighbor-joining method (23). (B) Comparison of the MeT domain. The three MeT consensus motifs were shown boxed. The conserved residues of MeT are described by Kagan and Clarke (24).

(6)

belongs to the family Monascaceae (19). Interestingly, lovastatin

biosynthetic genes from A. terreus revealed a higher homology

with monacolin K biosynthetic genes from M. pilosus than with

compactin biosynthetic genes from P. citrinum. Because

polyketides play an ecological role in the environment regarding

microbial competition, genetic differences might reflect extreme

environmental stress and subsequent genetic changes in these

species (20). In addition, many of the predicted PKSs in the

PKS clade that produce highly reduced polyketides have

di-vergent and presumably nonfunctional MeT domains (21). The

structure of monacolin K differs from that of compactin, in which

a methyl group derived from SAM is introduced at the C-6 position

of the nonaketide-derived backbone (18). The MeT domain in

mokA and loVB genes is assumed to be active instead of the mlcA

gene. The consensus motif of the MeT domain of mlcA was found

to be different from the relative PKSs (mokA and loVB) in some

amino acid residues, AfL, GfI, QMfHL, and IfT (Figure 3B).

Furthermore, there were two more introns located at the MeT

Figure 4. (A) Plasmid map of pMkAko for targeted gene disruption of mokA. (B) Disruption of the mokA gene in M. pilosus BCRC38072. The strategy for disrupting mokA gene was done by homologous recombination. A pMkAko vector containing the fusion protein of the hygromycin B resistance gene (HPH) with enhanced green fluorescent protein (EGFP) was flanked at the 5′-site by 2.0 kb (mokA2k) and at the 3′-site by 3.1 kb (mokA3k). pMkAko was linearized at the FspI sites and transformed into M. pilosus BCRC38072. The homologous recombination event between the Monascus genome and the FspI-digested pMkAko fragment resulted in a truncated ORF for mokA gene. (C) Southern hybridization analysis of disruption of mokA gene in the genomes of M. pilosus BCRC38072 (lane 1) and disruptant BCRC38135 (lane 2) hybridized with the probe indicated by a small black bar. The abbreviation F indicates an FspI restriction enzyme site, and N indicates an NdeI restriction enzyme site.

(7)

domain of mlcA, whereas mokA and loVB contained the same

number of introns and similar intron positions. Therefore, the

differences among amino acid residues could be the reason for

the lack of MeT activity of mlcA in P. citrinum. These results could

form the basis for the study of site-directed mutagenesis to

understand the MeT activity of PKSs (18). Among these genes

shown in Table 1, the transcription factor (mokH, loVE, and mlcR)

and HMG-CoA reductase (mokG, lVrA, and mlcD) were found to

have fewer similarities to each other. The number and positions

of introns were also different from one another. Nevertheless, the

transcription factor and HMG-CoA reductase genes were assumed

to be regulators responsible for up-regulation and down-regulation,

respectively (7, 22). HMG-CoA reductase (mokG) could play a

role in conferring resistance to monacolin K (22), and theoretically,

there was no effect upon the structure of the polyketides (7).

The data for the monacolin K biosynthetic gene cluster can

provide important information about the biosynthesis of

mo-nacolin K (lovastatin) between Monascus and Aspergillus. It is

interesting that polyketide synthases between mok genes and

loV genes are othologues and also related in compactin

biosyn-thesis by P. citrinum. Thus, there are three othologous gene

clusters in different fungi, which are useful to study evolution

of genes for secondary metabolism. Moreover, this suggests that

the structural variety of polyketides produced by fungi

ac-companies the enzymatic variation (7, 11). Studies on the

regulation of fungal secondary metabolism and the development

of novel polyketides have great potential for screening effective

medications.

ACKNOWLEDGMENT

Support of the Ministry of Economic Affairs (Taiwan, ROC)

(Grant 94-EC-17-A-17-R7-0563) to the Food Industry Research

and Development Institute (FIRDI) is appreciated.

LITERATURE CITED

(1) Endo, A. Monacolin K, a new hypocholesterolemic agent produced by a Monascus species. J. Antibiot. (Tokyo) 1979, 32, 852–854. Figure 5. Identification of monacolin K produced by M. pilosus BCRC38072. (A) UV light absorption spectrum of monacolin K between the wavelengths of 210 and 380 nm. (B) Liquid chromatography-mass spectroscopy analysis of monacolin K. m/z, mass-to-charge ratio. (C) HPLC analysis of monacolin K produced from M. pilosus BCRC38072 and BCRC38135 on the eighth day of cultivation.

(8)

(2) Endo, A.; Hasumi, K.; Nakamura, T.; Kunishima, M.; Masuda, M. Dihydromonacolin L and monacolin X, new metabolites which inhibit cholesterol biosynthesis. J. Antibiot. (Tokyo) 1985, 38, 321– 327.

(3) Endo, A.; Komagata, D.; Shimada, H. Monacolin M, a new inhibitor of cholesterol biosynthesis. J. Antibiot. (Tokyo) 1986,

39, 1670–1673.

(4) Shimizu, T.; Kinoshita, H.; Ishihara, S.; Sakai, K.; Nagai, S.; Nihira, T. Polyketide synthase gene responsible for citrinin biosynthesis in Monascus purpureus. Appl. EnViron. Microbiol. 2005, 71, 3453–3457.

(5) Hendrickson, L.; Davis, C. R.; Roach, C.; Nguyen, D. K.; Aldrich, T.; McAda, P. C.; Reeves, C. D. Lovastatin biosynthesis in

Aspergillus terreus: Characterization of blocked mutants, enzyme

activities and a multifunctional polyketide synthase gene. Chem.

Biol. 1999, 6, 429–439.

(6) Tobert, J. A. Lovastatin and beyond: The history of the HMG-CoA reductase inhibitors. Nat. ReV. Drug DiscoVery 2003, 2, 517– 526.

(7) Hutchinson, C. R.; Kennedy, J.; Park, C.; Kendrew, S.; Auclair, K.; Vederas, J. Aspects of the biosynthesis of non-aromatic fungal polyketides by iterative polyketide synthases. Antonie Van

Leeu-wenhoek 2000, 78, 287–295.

(8) Sorensen, J. L.; Auclair, K.; Kennedy, J.; Hutchinson, C. R.; Vederas, J. C. Transformations of cyclic nonaketides by

Aspergil-lus terreus mutants blocked for lovastatin biosynthesis at the loVA

and loVC genes. Org. Biomol. Chem. 2003, 1, 50–59.

(9) Sorensen, J. L.; Vederas, J. C. Monacolin N, a compound resulting from derailment of type I iterative polyketide synthase function en route to lovastatin. Chem. Commun. 2003, 13, 1492–1493. (10) Kennedy, J.; Auclair, K.; Kendrew, S. G.; Park, C.; Vederas, J. C.;

Hutchinson, C. R. Modulation of polyketide synthase activity by accessory proteins during lovastatin biosynthesis. Science 1999,

284, 1368–1372.

(11) Nicholson, T. P.; Rudd, B. A.; Dawson, M.; Lazarus, C. M.; Simpson, T. J.; Cox, R. J. Design and utility of oligonucleotide gene probes for fungal polyketide synthases. Chem. Biol. 2001,

8, 157–178.

(12) Peterson, D. G.; Tomkins, J. P.; Frisch, D. A.; Wing, R. A.; Paterson, A. H. Construction of plant bacterial artificial chromo-some (BAC) libraries: An illustrated guide. J. Agric. Genomics 2000, 5.

(13) Ewing, B.; Green, P. Base-calling of automated sequencer traces using phred. II. Error probabilities. Genome Res. 1998, 8, 186– 194.

(14) Gordon, D.; Abajian, C.; Green, P. Consed: A graphical tool for sequence finishing. Genome Res. 1998, 8, 195–202.

(15) Bingle, L. E. H.; Simpson, T. J.; Lazarus, C. M. Ketosynthase domain probes identify two subclasses of fungal polyketide synthase genes. Fungal Genet. Biol. 1999, 26, 209–223. (16) Sambrook, J.; Fritsch, E.; Maniatis, T. Molecular Cloning: A

Laboratory Manual; Cold Spring Harbor Laboratory Press: New

York, 1989, Vol. 1, p 7.39.

(17) Pfeifer, B. A.; Khosla, C. Biosynthesis of polyketides in heter-ologous hosts. Microbiol. Mol. Biol. ReV. 2001, 65, 106–118. (18) Abe, Y.; Suzuki, T.; Ono, C.; Iwamoto, K.; Hosobuchi, M.;

Yoshikawa, H. Molecular cloning and characterization of an ML-236B (compactin) biosynthetic gene cluster in Penicillium

citri-num. Mol. Genet. Genomics 2002, 267, 636–646.

(19) Kuraishi, H.; Itoh, M.; Katayama, Y.; Hasegawa, A.; Sugiyama, J. Ubiquinone systems in fungi. V. Distribution and taxonomic implications of ubiquinones in Eurotiales, Onygenales and the related plectomycete genera, except for Aspergillus, Paecilomyces,

Penicillium, and their related teleomorphs. Antonie Van Leeuwen-hoek 2000, 77, 179–186.

(20) Duffy, B.; Keel, C.; De´fago, G. Potential role of pathogen signaling in multitrophic plant-microbe interactions involved in disease protection. Appl. EnViron. Microbiol. 2004, 70, 1836–1842. (21) Kroken, S.; Glass, N. L.; Taylor, J. W.; Yoder, O. C.; Turgeon,

B. G. Phylogenomic analysis of type I polyketide synthase genes in pathogenic and saprobic ascomycetes. Proc. Natl. Acad. Sci.

U.S.A. 2003, 100, 15670–15675.

(22) Abe, Y.; Suzuki, T.; Mizuno, T.; Ono, C.; Iwamoto, K.; Hosobu-chi, M.; Yoshikawa, H. Effect of increased dosage of the ML-236B (compactin) biosynthetic gene cluster on ML-ML-236B pro-duction in Penicillium citrinum. Mol. Genet. Genomics 2002, 268, 130–137.

(23) Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. EVol. 1987, 4, 406–425.

(24) Kagan, R. M.; Clarke, S. Widespread occurrence of three sequence motifs in diverse S-adenosylmethionine-dependent methyltrans-ferases suggests a common structure for these enzymes. Arch.

Biochem. Biophys. 1994, 310, 417–427.

Received for review February 27, 2008. Revised manuscript received May 9, 2008. Accepted May 14, 2008.

數據

Table 1. Several conserved domains were recognized in MokA
Figure 1. Identification of the monacolin K biosynthetic gene cluster of M. pilosus BCRC38072
Figure 4. (A) Plasmid map of pMkAko for targeted gene disruption of mokA. (B) Disruption of the mokA gene in M

參考文獻

相關文件

The multi-task learning problem comes from our biological application: Drosophila gene expression pattern analysis (funded by NSF and

The multi-task learning problem comes from our biological application: Drosophila gene expression pattern analysis (funded by NSF and

The resulting color at a spot reveals the relative levels of expression of a particular gene in the two samples, which may be from different tissues or the same tissue under

Wang, Solving pseudomonotone variational inequalities and pseudocon- vex optimization problems using the projection neural network, IEEE Transactions on Neural Networks 17

Clear Cell carcinoma of palatal minor salivary gland harboring a novel EWSR1-ATF1 fusion gene: report of a case and review of the literature. Head

Animal or vegetable fats and oils and their fractiors, boiled, oxidised, dehydrated, sulphurised, blown, polymerised by heat in vacuum or in inert gas or otherwise chemically

Milk and cream, in powder, granule or other solid form, of a fat content, by weight, exceeding 1.5%, not containing added sugar or other sweetening matter.

Consistent with the negative price of systematic volatility risk found by the option pricing studies, we see lower average raw returns, CAPM alphas, and FF-3 alphas with higher