• 沒有找到結果。

γ-Crystallin genes in carp: cloning and characterization

N/A
N/A
Protected

Academic year: 2021

Share "γ-Crystallin genes in carp: cloning and characterization"

Copied!
4
0
0

加載中.... (立即查看全文)

全文

(1)

Biochimica et Biophysica Acta, 1090 (1991) 261-264

© 1991 Elsevier Science Publishers B.V. All rights reserved 0167-4781/91/$03.50 ADONIS 016747819100235L

BBAEXP 90273

S h o r t S e q u e n c e - P a p e r

261

y-Crystallin genes in carp: cloning and characterization

T s c h i n i n g C h a n g ~, C h i n g - L u n g L i n 2, P e n g - H u i C h e n 2 a n d W e n - C h a n g C h a n g 1,2

I Institute of Biological Chemistry, Academia Sinica, Taipei (Taiwan, R.O.C.) and 2 Institute of Biochemical Sciences, National Taiwan

University, Taipei (Taiwan, R.O.C.) (Received 6 August 1991)

Key words: y-Crystallin; Gene structure; Amino acid sequence; (C. carpio)

The carp y-crystallin gene family was found to be composed of at least three members: y m l , ym2 and 3"m3. The

encoded products are very similar to other known y-crystallins but with their own peculiarities: (1) they all have a

high methionine content: 12.4%, 14% and 8.4% in y m l , ym2 and ym3, respectively; and (2) the amino acid

sequences are aberrant in the region before connecting peptides and its corresponding region in motif 4. Their

protein structures might remain the same as those of other y-crystollins since they retain all the conserved amino

acid residues essential for maintaining the loops in the protein structures.

The crystallins account for over 90% of the soluble

proteins of the eye lens [1,2]. Immunologically, they

can be distinguished into four major groups: a, //, 3'

and 8 with 8 restricted to birds and reptiles [3-5]. The

short-range spatial order of crystallins was suggested to

be important for lens transparency [6] and the 3'-crys-

tallins are of additional interest because of their impli-

cation in cataractogenesis [7]. Investigaters studying

the lenses of human [8], rat [9] and mice [10] have

concluded that the 3'-crystallins are encoded .by a

multigene family. Those genes are highly conserved in

structure with three exons and two introns in each

gene. The 5' exon is small and encodes three amino

acids. The other two larger exons correspond to two

structurally similar 'Greek key'-like domains of the

protein. Recent studies on the promoter functions of

these genes cor~firmed that they are expressed in a

tissue-specific manner [11,12].

In fish, 3'-crystallins exhibit the conserved structural

features of the known 3'-crystallins but with their own

peculiarities: high methionine content [13] and se-

quence aberrancy in motif 2 and its corresponding

region in motif 4 of the protein (see text). Since the

fish lives in a very different environment compared to

The sequence data in this paper have been submitted to the EMBL Data Library under the accession numbers X55945 (for 3,ml) and X55946 (for 3,m3).

Correspondence: W.C. Chang, Institute of Biological Chemistry, Academia Sinica, P.O. Box 23-106, Taipei, Taiwan, R.O,C.

the terrestrial animals and exhibits remarkable species

diversity [14], it is interesting to study lens crystallins of

fish concerning the gene structure, regulation and

molecular evolution. In this report we will present two

nucleotide sequences and structural features of carp

3'-crystallin genes.

Five positive clones were obtained from a genomic

library of 2- 10 s plaques with 3'ml cDNA as probe.

After restriction enzyme mapping, four of them were

found to be identical and designated as pEM64. The

remaining positive clone was named pEM101. The

complete nucleotide sequences are shown in Fig. 1.

Both pEM64 and pEM101 contain a 3'-crystallin gene

with similar features: three exons and two introns on

the basis of the known carp 3'-crystallin cDNA se-

quences (Fig. 1). The first exon of both genes contains

a 9 bp coding region with translation start codon. Exon

2 would encode motifs 1 and 2 of both gene products,

while exon 3 corresponds to motifs 3 and 4 plus the 3'

untranslated region. All the introns are small. The first

intron is 162 bp and 275 bp long for 3'ml and 3'm3,

respectively, while the second contains 138-139 bp,

much smaller than those of mammalian 3'-crystallins,

most of which are larger than I kb in size [8,16]. All the

introns start with GT and end with AG, in agreement

with the G T / A G splice site rule. The 5' and 3' un-

translated regions of both genes are short (Fig. 1). The

polyadenylation signal, AATAAA, was found in the 3'

untranslated region of both genes. The termination

codons, T A A (for both 3'ml and ym3), were not far

from the polyadenylation signals.

(2)

262 yml y m 3 yml 7 m 3 T m 2 yml Y m 3 Tml Tin3 ¥ml Ym3 Tin1 ym3 "Ym2

Tin1

ym2

ym3

7ml

"Ym3 Tm2

yml

Tm3 Tm2 7ml

Ym3

Tm2 Tml 7 m 3 "(ml

Tm3

Tml

"Ym3

~fm2

Tin1

7 m 3 7 m 2 7ml Tm3 "Tm2 yml 7m3 ~m2 'Yml Ym3 'Ym2 Yml 7m3

7ml

7m3 1 C C A T C A A A G T A C A G C T G G T A C A G T G A G C T G A A G C A C T G A G A T A A A C A A C A C T C T A C C A T C ~ T G G A C A G A A T C C C A C G A A G A C T A G C A A A C

r

T G G G C A A ~ g t a a t t t g t t t g a a a t a a g t a t g c t t a a t t t t t t a a g c t t t a g t t t c a t a t

~

t a t g t a t a g g g t g g c c t t a a t c c a g c a g a g t a g a g c t g c c a a a a a c a g c a t g c a t c g a g t t t t t a t t t a a a g a a t a a a g a c g a a c a g t a t g c a a t t c a g a t c t a a a a g g c a a a t c c t c c a t a a a t t t a a t a a a t g c a a a g a t g g c t t t t t t t t t t t t g t g g a a a t g g t t a a a t t a a t t a t a a a t t t t t t g a a a a c a c t t a a a t t t t c a a t c c c a t c a a c a g . . . g g t a a t t a t a t t c a a c a t t t g c t a c a t a a a c a a g c t c t a a t a c a a a t a c c t g t t g t g t a a ... t g c a a g c c a a a a a a g c c a g t t a c t t c a a a t g t t a a a g g t t a c t g t t t a c a g a g a g c c a c t . . . ~ A T C A T C T T C T A C G A C q c a t a t t t t a a t a t t a a c a t t g t a t t a a a a a a t t t t t c t t t g c a ~ G | I G C T T G J A C A G G A A C T T C C A G G G C C G C A G C T A T G A C g G C A T G A G C G A C T G C T C T G A T A T C T C C T C T ~ T T C G G C T G T A C J T T C T T T G C T C |

I

A C C T G A G C C G C G T T G G T T C A A T C A G G G T G G A G A G T G G T T G T T T C A T G G T C T A T G A G C G C ~ C T G C C A T G A C C C T G C G T A T G C A C T T G A C C ¢ A ¢ G ~ A G C T A A ~ A C A G C T A C A T G G G G A A C C A G T T C T T C C T G A G G A G G G G C G A G T A C C A T G A T A T G C A G C G C ~ T A A T A T G C G T A C A T | A A T A T T T A T G C . T A C A T T C T J T G A T G A G C A T G G G C A T G A T T T T T G A C A C T A T C A G A T C C T G C C G C A T G A T T C C T C C ~ g t a c . . . A G G A G --- G T G

A~gtaa

T T G A A . . . A T G C G C T A C A T ~ g g c t c t c a c t t t g t t t a c a g t a t t g t g t a g a t t t a g t a a t g c a c a c c t t t t a a t g a t a t t c a a a a a a t a a a a c a a t a a t a a t a t t a t c a t t t t a a t c a t t a a c a a t a a t a g t t c a a t t g c a t a c t g t a c t a t g c t a t a c t a t a g a a a c t g c t a a a t a a t g a t g a t a t t c t a a t c a a t c t t t a a a t t g t t c a g a c t g t a t t g a a t t a g a a a t g c a t t g a a t c t g a c t g a g t c a a t a c a t t t

tctttgttttacagJTACAGGGGTTCCTACAGAATGAGGATCTACGAGAGGGACAACTT~

c t t t a c a t c t t a c a ~ A C | C A G

I

G G A G G A C A G A T G C A C G A G G T G A T G G A T G A C T G T G A C A A C A T C A T G G A A C G T T A C C G T A T g T T T T c c A T T C T G c T c / A T G c T ^ A G c c G T c c /

I

T C T G A C T G G C A G T C T T G T C A T G T G A T G G A C G G C C A C T G G C T C T T C T A T G A G C A G C C A C A q c c c A G c I c c c c c A S C I T A C A G A G G C A G A A T G T G G T A C T T C K G G C C T G G A G A G T A C A G G A G C T T C A G A G A T A T G G G ~ C G T A T A C G ] , G A c A T A C A G C A A C A T G A G A T T C A T G A G C A T G A G G C G T A T C A C T G A T A T C T G T - - . - T A i ~ A C A G C T G C A GCTCTG T AA A TG CT G - - - p, TTCAC G A ~ . . . T G C T C G T A C q A G A A T A T A G A A G G A A A T A A A ~ A G T T A T T T T C A C A A T T A g c t g t g g t g t c t g t g t t a t t g g A G T C T G A A A C T A T A A A T G A T A A C A T A A T C A T A A A C A A T A A A T T T C T C A C C A T G C A T T T T T t t a t t a t t t t a t t a t a t t a c a t t t c g t a g a t t a t t a a a t t t c t g t t g t c t t g g t c t g t t t t c c c c g g c c t t t t 60 120 180 240 300 360 420 480 5 4 0 6 0 0 6 6 0 720 7 8 0 8 4 0 900 9 6 0 1 0 2 0 1 0 8 0

(3)

Carp 7ml Carp ym3 Carp ym2 Calf yII o • • • 2 0 • G K I I F Y E D R N F Q G R S Y D C M S D C S D I S S Y L S R V G S I R V E S G K I I F Y E D R N F Q G R S Y E C S S D C S D M S T Y L S R C H S C R V E S K V I F Y E D R N F Q G R S Y D C M S D C A D F S S Y M S R C H S C R V S H G K I T F Y E D R G F Q G H C Y E C S S D C P N L Q P Y F S R C N S I R V D S MOTIF t

263

100 120 YPMRIYERDNFGGQMHEVMD DCDNIMERYRMS DWQSCH VMD YPMRTYERENFGGQMYDLTD DCDSFVDRYRMS DCQSCH VMD YPMRIYERENFMGQMYEMAD DCDSIMDRYRMP HCQSCH VMD FRMRIYERDDFRGQMSEITD DCPSLQDRFHLT EVHSLN VLE

t

t

t

40 60 80

M O T I F 3

GCFMVYERNSYMGNQFFLRRGEYHDMQR ~ T I R S C R M I P PYRGS

GCFVVYDVPNYMGMQFFMRRGEYADYMR I M GM S ~ T R S C R M V P QYRGP MOTIF 2 GCWMMYDQPNYMGNQYFFRRGEYADYMS [ MF GM S~CIRSCRMIP MHRGS

GCWMLYERPNYQGHQYFLRRGDYDDYQQ WM GF NDSTRSCRLIP QHTGT

1

t I

t

1 40 1 6 0

GHWLFYEQPHYRGRbIWYFRPGEYRSFRD

~ - ' ~ F M S I ~ R R ITDI C

GHWDMYEQPHYRGRTVYFRPGEYRSFRD I M GYSTKFSSVRRTMDLC MOTIF 4 GHWLMYEQPHYRGRMWYFRPGEYRSFSN [M GG ~KFMSMRRIMDSWY

GSWVLYEMPSYRGRQYLLRPGEYRRYLD W GAMNAKVGSLRRVMDFY

t

Fig. 2. Comparison of deduced amino acid sequences of ~,ml, 7m2 and ym3 with calf y-ll protein sequence. Conserved amino acids are labelled with filled circles. The sequences are so aligned that the topologically equivalent amino acid residues can be easily compared. The sequence-aberrant regions are boxed. The conserved methionine i'esidues in all carp y-crystailins are indicated by arrows. The numbering for calf

y-I| sequence is used as reference.

The amino acid sequences derived from the exons of

both genes show that they are closely related (Fig. 2).

Comparison of pEM64 coding region with that of 7ml

cDNA [!3] reveals only four base changes between

them and rive nucleotide differences in the 5' and 3'

noncoding regions (data not shown). Therefore, pEM64

must contain the genomic equivalent of 7ml crystallin.

Hereafter the symbol 7ml will be used to denote this

particular 7-crystallin and its genomic equivalents. The

coding region of pEMI01 is quite different from that of

7ml and 7m2 [13] and it must encode a new species of

carp 7-crystallin which will be symbolized as ~/m3 to

indicate that it is the third y-crystallin with high me-

thionine content ever found in carp. Compared with

calf 7-11, the amino acid sequences of carp 7-crystai-

lins are aberrant in the region from residues 68 to 72

before the connecting peptide and their counterpart in

motif 4. In this region of motif 2, 7ml has an insertion

of four amino acids, 7m2 has a deletion of 2 amino

acids in motif 4 and 7m3 has a deletion of one amino

acid in motif 2 (Fig, 2). Therefore, these three proteins

might have different fine structures. However, since

those amino acids essential for loop-maintaining, i.e.,

Tyr-6, Glu-7, Gly-1 3, Ser-24 and their equivalents in

Fig. 1. Comparison of carp "~,-crystallin genes. The carp (Cyprinus carl~o) egg genomic library was constructed as described by Chiou et al. [15]. Positive clones were mapped, subeloned and reconfirmed by repeated hybridization with the 7ml eDNA as probe. The nucleotide sequences were determined. Exons are shown by capital letters and introns in lower-case. The numbering of pEM64 (Tml) is shown at right margin and begins with the transcription start site ( + 1). Sequence of pEMI01 (ym3) and 7m2 eDNA are aligned with respect to the coding regions which are boxed. Only the nucleotides different from that of pEM64 in the coding region are shown below it. Dashed lines are used to indicate

(4)

264

TABLE I

Percent homology of amino acid sequence between 7ml, ~m2 and ynO yml/3,m2 y m l / y m 3 ym2/ym3 Motif I 72 82 74 Motif 2 55 62 64 Motif 3 78 76 78 Motif 4 77 81 68

the other

motifs [17] are conserved,

the protein

skele-

ton should still be similar

to those of

mammalian

3'-crystallins. The sequence comparison motif-by-motif

between yml, 3'm2 [13] and 3'm3 reveals

the lowest

homology in motif

2 (Table I) instead

of motif 3 which

is the most diverse motif found in the mammalian

3'-crystallin. The methionine content is high in 3'm3,

e'GID

Fig. 3. The determination o f the transcription start sites of yml and ym3 by primer extension test. Two antisense primers complementary to a stretch o~ 17 bp just upstream from the first start codon of both yml and ym3 [~-,nomic sequences were used: 5'-GATGGTA- GAGTGTTGTr-3' for yml and 5'-GTIWGCTAG'IuI-ICGTG-Y for ~,m3. Lanes A, (3, C and T are sequence bdders. The nucleotide sequences denoted fec lanes -/ml and ~/m3 are the sequences amend the tranKril~Cioa start site which is indicated with an asterisk.

8.4%, although lower than that of 3,ml and 3,m2. Most

of the methionine residues of these three proteins are

relatively conserved (Fig. 2). It is not clear whether

these methionine residues are functionally important

for carp y-crystallins. A detailed X-ray diffraction

analysis might offer more insight into the possible roles

in protein structure and the interactions between pro-

teins and their environment.

In the 5' flanking regions, a TATA box was found

for yml, but two tandem repeats of TATA box were

found for ym3 (data not shown). The presence of such

a 'double' TATA box in a promoter region is rare and

its poss~le functional role should await further analy-

sis. The cap site of the mRNA was determined by

primer extension method as shown in Fig. 3 and was

found to be a cytosine residue in both 3,ml and ym3

genes. The primer extension experiments also indicate

that both 3'ml and 3"m3 genes are expressed in the fish

eye lens.

Although the gene structures of both 3,ml and 3'm3

are very similar to that of known mammalian 3' crys-

tallins, the existence of aberrent amino acid sequences

and high methione content in the proteins may hint

that the fish is one of the radiation points in the

phylogenetic tree of 3,-crystallin gene evolution. The

exact size of this fish gone family and their detailed

structural analyses will be needed to clarify this point.

References

1 Piatigorsky, J. (1984) Cell 38, 620-621. 2 Bloemendal, H. (1977) Science 197, 127-138.

3 McAvoy, J.W. (1978) J. Embryol. Exp. Morph. 45, 271-281. 4 Papaconstantinou, J. (1976) Science 156, 338-347. 5 McAvoy, J.W. (1978) J. Embryol. Exp. Morph. 44, 149-165. 6 Delaye, M. and Tardieu, A. (1983) Nature 302, 415-417. 7 Harding, J.J. (1981) Molecular and Cellular Biology of the Eye

lens, John Wiley and Sons, I New York.

8 Meakin, S.O., Breitman, M.L. and Tsui, L-C. (1985) MoL Cell. Biol. 5, 1408-1414.

9 Den Dunnen, J.T., Moorman, RJ.M., l.ubsen, N.H. and Schoen- makers, J.G.G. (1986) J. Mo. Biol. 189, 37-46.

10 Lok, S., Tsui, L-C., Shinohara, T., Piatigorsky, J., Gold, R., and Breitman, M.L. (1984) Nucleic Acids Res. 12, 4517-4529. 11 Lok, S., Breitman, M.L., Chepelinsky, A. B., Piatigorsky, J., Gild,

RJ.M. and Tsui, L-C. (1985) Mol. Cell. Biol. 5, 2221-2230. 12 Wistow, G3. and Piatigorsky, J. (1988) Annu. Rev. Biochem. 57,

479-504.

13 Chang, T., Jian8, Y-J., Chiou, S-H. and Chang, W-C. (1988) Biochim. Biopbys. Acta 951, 226-229.

14 Powers, D.A. (1989) Science 246, 352-358.

15 Chiou, C.S., Chen, H.-T. and Chang, W-C. (1990) Biochim. Biophys. Acta 1087, 91-94.

16 Den Dunnen, J.T., Moorman, RJ.M., Lubsen, N.H. and Schuen- makers, J.G.G. (1986) J. Mol. Biol. 189, 37-46.

17 Wistow, G., TurneH, B., Summers, L., Slingsby, C., Moss, D., Miller, L., IAndley, P. and BlundeH, T. (1983) J. Mol. Biol. 170, 175-202.

數據

Fig. 2. Comparison  of deduced  amino acid sequences  of ~,ml, 7m2 and  ym3 with calf y-ll protein  sequence
Fig. 3. The determination  o f  the  transcription start sites of yml  and  ym3 by primer  extension test

參考文獻

相關文件

substance) is matter that has distinct properties and a composition that does not vary from sample

 develop a better understanding of the design and the features of the English Language curriculum with an emphasis on the senior secondary level;..  gain an insight into the

Students are asked to collect information (including materials from books, pamphlet from Environmental Protection Department...etc.) of the possible effects of pollution on our

Wang, Solving pseudomonotone variational inequalities and pseudocon- vex optimization problems using the projection neural network, IEEE Transactions on Neural Networks 17

Hope theory: A member of the positive psychology family. Lopez (Eds.), Handbook of positive

Define instead the imaginary.. potential, magnetic field, lattice…) Dirac-BdG Hamiltonian:. with small, and matrix

The existence of cosmic-ray particles having such a great energy is of importance to astrophys- ics because such particles (believed to be atomic nuclei) have very great

Consistent with the negative price of systematic volatility risk found by the option pricing studies, we see lower average raw returns, CAPM alphas, and FF-3 alphas with higher