IL-10 and TNF-α promoter polymorphisms in susceptibility to systemic lupus erythematosus in Taiwan

systemic lupus erythematosus in Taiwan

Y.-J. Lin

_{, L. Wan}

_{, C.-M. Huang}

_{, J. J.-C. Sheu}

_{, S.-Y. Chen}

_{, T.-H. Lin}

_,

D.-Y. Chen

_{, K.-C. Hsueh}

_{, C.-C. Lai}

_{, F.-J. Tsai}

1

_{Department of Medical Research,}

_{Graduate Institute of Chinese Medical Science,}

_{Division of}

Immunology and Rheumatology, and

_{Department of Pediatrics, China Medical University, Taichung,}

Taiwan;

_{Department of Biotechnology and Bioinformatics, Asia University, Taichung, Taiwan;}

_{The Institute of Molecular Biology, National Chung Hsing University, Taichung, Taiwan.}

Abstract

The genetic control of Interleukin-10 (IL-10) and Tumour necrosis factor-α (TNF-α) production and the possible

interaction between the two cytokines in influencing SLE susceptibility as well as clinical features has not been completely

evaluated in the Taiwanese population. We investigated the association of IL-10 and TNF-α promoter polymorphisms

(-1082, -819 and -592 for IL-10 gene; -308 for TNF-α gene) with SLE in a total of 172 Taiwanese patients and 215

controls. Our results indicate that IL-10 A/T/A-A/T/A genotype was associated with Taiwanese SLE, whereas no

significance was observed between TNF-α genotype and SLE. Furthermore, the TNF-α G allele frequency of the

polymorphism at -308 was significantly decreased in patients with oral ulcers. The combined frequencies of IL-10 A/T/A

haplotype and TNF-α G-G genotype were significantly increased in SLE patients. In addition, the combined frequencies

of IL-10 A/T/A haplotype and TNF-α G-G genotype were significantly decreased in patients with oral ulcers. These results

suggest a significant correlation of the combined IL-10 and TNF-α genetic polymorphisms contribute to SLE susceptibility

and clinical features in the Taiwanese population.

Key words

Y-J Lin, L Wan, C-M Huang, J J-C Sheu, S-Y Chen, T-H Lin, D-Y Chen, K-C Hsueh, C-C Lai, Fuu-Jen Tsai

This work was supported by China Medical University (CMU97-CMC-005), China Medical University Hospital (DMR-97-102) and the National Science Council in Taiwan (NSC97-2320-B-039-023-MY3).

Please address correspondence and reprints requests to:

Fuu-Jen Tsai,

Department of Medical Research, China Medical University Hospital, No. 2 Yuh Der Road,

Taichung, Taiwan.

E-mail: [email protected] Received on August 3, 2009; accepted in revised form on December 4, 2009. © Copyright CLINICALAND

EXPERIMENTAL RHEUMATOLOGY 2010.

Competing interests: none declared.

Introduction

Systemic lupus erythematosus (SLE),

is a systemic autoimmune disorder,

characterised by distinct clinical

mani-festations (1-4). Although the exact

eti-ology and pathogenesis of SLE are

un-known, it is believed that the disease is

genetic in origin (2). Cytokines are

po-tent immunomodulatory molecules that

mediate immune response and

inflam-mation. Investigators have explored

the role of several cytokines involved

in pathogenesis of SLE (5-7).

Interleukin-10 (IL-10), produced by

monocytes and lymphocytes, is a

po-tent cytokine that has pleiotropic

ef-fects in immunoregulation and

inflam-mation (8, 9). It has been reported that

the serum levels of IL-10 are elevated

in the case of SLE patients (5, 10).

IL-10 production appears to be influenced

by the polymorphisms in the IL-10

promoter region (11, 12). In addition,

the three IL-10 promoter SNPs are

strongly associated with the

pathogen-esis of SLE (13-18). Tumour necrosis

factor-α (TNF-α), an important

proin-flammatory cytokine, exerts a variety

of physiologic and pathogenic effects,

including the activation of a cascade of

inflammatory events, which lead to

tis-sue destruction in autoimmune

diseas-es (19-21). Levels of TNF-α have been

reported in SLE patients and have been

shown to correlate with SLE disease

activity (22-24). Nevertheless, studies

on TNF-α genetic polymorphisms in

SLE patients have yielded

inconclu-sive results (25-31). The production of

these two regulators of the

inflammato-ry reactions-IL-10 and TNF-α has been

found to be deeply deregulated in SLE,

suggesting that these regulators may be

involved in the pathogenesis of SLE.

The genetic control of IL-10 and TNF-α

production and the possible interaction

between the two cytokines in

influenc-ing SLE susceptibility as well as

clini-cal features has not been completely

evaluated in the Taiwanese population.

Our aim in the present study was to

in-vestigate the influence of cytokine

ge-netic variants and their interactions in

Taiwanese SLE population.

Patients and methods

Study population

The study subjects including a total of

172 patients with SLE and 215 healthy

subjects were recruited from China

Medical University Hospital in Taiwan.

However, the total numbers for SLE

patients or controls illustrated in Table

I do not agree with each other for the

IL-10 and TNF-α may due to the poor

quality of the genomic DNA of SLE

patients or controls. The poor quality

of the genomic DNA may lead to PCR

failure. Therefore, the total numbers

for SLE patients or controls in Table I

mean the success in PCR reaction

num-bers. Furthermore, due to insufficient

information of SLE clinical features,

some patients may only have

genotyp-ing results without clinical features; the

numbers of SLE patients with various

clinical features regarding genetic

hap-lotypes may be inconsistent. All of the

patients met American Rheumatism

As-sociation criteria for SLE classification

(32). The healthy individuals from the

general population were also enrolled.

Informed consent was obtained from

each patient and control subjects

in-volved. DNA collection was approved

by China Medical University

Hospi-tal’s Ethics Board.

IL-10 and TNF-α promoter

polymorphisms genotyping

Genomic DNA was extracted from

pe-ripheral blood leukocytes according to

standard protocols (Roche Genomic

DNA kit). The 3 biallelic IL-10

pro-moter polymorphisms were detected by

TaqMan(R) Genotyping Assays

(Ap-plied Biosystems) (Supplemental Table

I). The TNF-α genetic polymorphism

(-308) were detected by PCR using

primers that amplified a short fragment

of DNA containing the polymorphism

(Supplemental Table II). Polymorphic

site identification was performed by

incubating the PCR products with a

re-striction enzyme chosen to cut 1 of the

2 alleles, followed by electrophoresis

on 3% agarose gels. All samples were

amplified and digested in parallel with

3 samples of a known genotype.

Statistical analysis

Polymorphism genotype frequencies

and allelic frequency distributions in

SLE patients and control individuals

were analysed with chi-square tests

(SPSS Version 10.0). Statistical

signifi-cance was assumed at p<0.05. Allelic

frequencies were expressed as

percent-ages of total allele numbers. Odds ratios

(OR) were calculated from genotype

frequencies and allelic frequencies at

a 95% confidence interval (CI).

Hap-lotypes were inferred from unphased

genotype data with Bayesian statistics

(Phase 2.1 software) (33, 34).

Adher-ence to the Hardy-Weinberg

equilib-rium constant was examined using a χ

test with one degree of freedom. The

corrected P (Pc) values were adjusted

by using Bonferroni’s correction for

multiple comparisons. Statistical

sig-nificance was considered as Pc-value

<0.0045 (0.05/11 clinical features).

Results

IL-10 and TNF-α promoter

polymorphisms

The promoter genotype frequencies of

IL-10 and TNF-α promoter

polymor-phisms are shown in Table I. Nine

IL-10 promoter haplotypes were present

in both SLE patients and controls. No

statistically significant differences were

observed in IL-10 promoter haplotypes

between these two groups with two

ex-ceptions: A/T/A-A/T/A and A/T/C-A/C/

C. In SLE patients, A/T/A-A/T/A

geno-type frequency was significantly higher

(p<0.001; OR=2.22, 95%

CI=1.47-3.34) and A/T/C-A/C/C frequency was

significantly lower (p=0.004; OR=0.15,

95% CI=0.03-0.65). Observed

frequen-cies for individuals carrying the A/T/

A haplotype were 97.1% in SLE

pa-tients and 79.1% in controls (p<0.001;

OR=8.83, 95% CI=3.42-22.76). No

sig-nificant difference in the allele and

gen-otype frequencies of the -308 position

of TNF-α promoter gene was observed

between SLE patients and controls.

IL-10, TNF-α promoter polymorphisms

and clinical features of SLE

The association between the clinical

feature profile of SLE patients with

and controls.

Promoter genotypes SLE Controls p-value Odds ratio (95% CI) IL-10 (-1082/-819/-592) Number (%) Number (%)

A/C/C-A/C/C 1 (0.6) 7 (3.3) 0.066 0.17 (0.02–1.43) A/C/C-G/C/C 0 (0.0) 3 (1.4) 0.120 ND A/T/A-A/C/C 56 (32.6) 84 (39.1) 0.185 0.75 (0.49–1.15) A/T/A-A/T/A 96 (55.8) 78 (36.3) <0.001* 2.22 (1.47–3.34) A/T/A-A/T/C 2 (1.2) 8 (3.7) 0.115 0.30 (0.06–1.45) A/T/A-G/C/C 13 (7.6) 13 (6.0) 0.555 1.27 (0.57–2.82) A/T/C-A/C/C 2 (1.2) 16 (7.4) 0.004* 0.15 (0.03–0.65) A/T/C-A/T/C 1 (0.6) 1 (0.5) 0.874 1.25 (0.08–20.15) A/T/C-G/C/C 1 (0.6) 5 (2.3) 0.168 0.25 (0.03–2.12) A/T/A 167 (97.1) 174 (80.9) <0.001* 7.87 (3.04–12.00) Non A/T/A 5 (2.9) 41 (19.1) 1.00 TNF-α (-308) A-A 3 (1.9) 2 (0.9) 0.747 1.98 (0.33–12.00) G-A 26 (16.1) 35 (16.6) 0.98 (0.56-1.71) G-G 132 (82.0) 174 (82.5) 1.00 -308 A allele 32 (9.9) 39 (9.2) 0.749 1.08 (0.66–1.77) -308 G allele 290 (90.1) 383 (90.8) 1.00 G-G 132 (82.0) 174 (82.5) 0.905 1.03 (0.60–1.77) Non G-G 29 (18.0) 37 (17.5) 1.00

The significance was evaluated by χ2 _{test or two-tailed Fisher’s exact test.}

IL-10: interleukin-10; TNF-α: tumour necrosis factor-α; SLE: systemic lupus erythematosus; 95% CI: 95% confidence intervals; ND: not determined.

Table II. IL-10 haplotype frequencies of Taiwanese SLE patients with various clinical features.

Clinical features Allele (n=264) Genotype (n=132)

Ht1, Non-Ht1, Pc value Ht1/Ht1, Ht1/Non-Ht1, Non-Ht1/Non-Ht1, Pc-value

n=196 n=68 n=69 n=58 n=5

Number (%) Number (%) Number (%) Number (%) Number (%)

ANA 192 (98.0) 66 (97.1) 0.668 68 (98.6) 56 (96.6) 5 (100.0) 0.709 Immunologic disorder 150 (76.5) 56 (82.4) 0.318 50 (72.5) 50 (86.2) 3 (60.0) 0.108 Hematological disorder 99 (50.5) 33 (48.5) 0.778 35 (50.7) 29 (50.0) 2 (40.0) 0.898 CNS disorder 23 (11.7) 11 (16.2) 0.346 8 (11.6) 7 (12.1) 2 (40.0) 0.181 Renal disorder 81 (41.3) 29 (42.6) 0.849 29 (42.0) 23 (39.7) 3 (60.0) 0.673 Serositis 40 (20.4) 14 (20.6) 0.975 14 (20.3) 12 (20.7) 1 (20.0) 0.998 Arthritis 105 (53.6) 41 (60.3) 0.337 35 (50.7) 35 (60.3) 3 (60.0) 0.542 Oral ulcers 50 (25.5) 26 (38.2) 0.046 20 (34.5) 20 (34.5) 3 (60.0) 0.083 Photoseneitivity 87 (44.4) 35 (51.5) 0.313 27 (46.6) 27 (46.6) 4 (80.0) 0.286 Discoid rash 27 (13.8) 13 (19.1) 0.290 9 (15.5) 9 (15.5) 2 (40.0) 0.266 Malar rash 99 (50.5) 39 (57.4) 0.330 31 (53.4) 31 (53.4) 4 (80.0) 0.402 Ht1: A/T/A; N: number of SLE patients in genotype analysis; NS: not signifificant; ANA: anti-nuclear antibodies.

The chi-square test (2x2 table for haplotype; 2x3 table for genotype) was performed to obtain the p-value. SLE patients with ht1 were compared with SLE patients without ht1 after stratification by clinical features. The corrected P (Pc) values were adjusted by using Bonferroni’s correction for multiple compari-sons. Statistical significance was considered as Pc-value <0.0045 (0.05/11 clinical features).

various alleles and genotypes of IL-10

promoter haplotypes was analysed, and

the results are shown in Table II. No

significant differences in the clinical

features between patients with various

genotypes/haplotypes could be

dem-onstrated. The association between the

clinical manifestations of SLE patients

with TNF-α genetic polymorphism was

also investigated. The allele and

geno-type frequencies of the polymorphisms

at -308 were significantly different in

patients with serositis, oral ulcers,

pho-tosensitivity, discoid rash and malar

rash (Table III). The G allele frequency

was significantly decreased in patients

with oral ulcers (Pc=0.002).

IL-10 and TNF-α genotypes in

Taiwanese SLE susceptibility and

clinical features

SLE patients were also classified into

the four possible combined genotypes

to investigate potential IL-10 and

TNF-α

interaction in SLE susceptibility

(Table IV). Analysis of the combined

IL-10 and TNF-α genotypes yielded

a significant different distribution in

patients and controls (p<0.001, 4x2

contingency table). The combined

frequencies of IL-10 A/T/A haplotype

and TNF-α G-G genotype were

sig-nificantly increased in SLE patients

(79.5% in SLE patients and 68.1% in

controls; p=0.012), whereas the

Clinical features Allele frequency* Genotype frequency*

A allele (n=32) G allele (n=290) Pc value A-A (n=3) A-G (n=26) G-G (n=132) Pc-value

Number (%) Number (%) Number (%) Number (%) Number (%)

ANA 26 (81.3) 244 (84.1) 0.674 2 (66.7) 22 (84.6) 111 (84.1) 0.715 Immunologic disorder 23 (71.9) 197 (67.9) 0.649 2 (66.7) 19 (73.1) 89 (67.4) 0.850 Hematological disorder 9 (28.1) 131 (45.2) 0.065 0 (0.0) 9 (34.6) 61 (46.2) 0.170 CNS disorder 5 (15.6) 29 (10.0) 0.326 1 (33.3) 3 (11.5) 13 (9.8) 0.418 Renal disorder 15 (46.9) 103 (35.5) 0.206 1 (33.3) 13 (50.0) 45 (34.1) 0.304 Serositis 10 (31.3) 46 (15.9) 0.029 1 (33.3) 8 (30.8) 19 (14.4) 0.101 Arthritis 17 (53.1) 133 (45.9) 0.434 2 (66.7) 13 (50.0) 60 (45.5) 0.713 Oral ulcers 15 (46.9) 65 (22.4) 0.002* 2 (66.7) 11 (42.3) 27 (20.5) 0.015 Photoseneitivity 18 (56.3) 108 (37.2) 0.037 1 (33.3) 16 (61.5) 46 (34.8) 0.038 Discoid rash 8 (25.0) 32 (11.0) 0.023 1 (33.3) 6 (3.8) 13 (9.8) 0.094 Malar rash 20 (62.5) 124 (42.8) 0.033 1 (33.3) 18 (69.2) 53 (40.2) 0.023 n: number of SLE patients in genotype analysis; NS: not significant; ANA: antinuclear antibodies.

χ2 _{test (2x2 table for allele frequency; 2x3 table for genotype frequency) were performed to obtain the p-value. The corrected P (Pc) values were adjusted by}

using Bonferroni’s correction for multiple comparisons. Statistical significance was considered as Pc-value <0.0045 (0.05/11 clinical features).

*Pc-value was <0.0045.

Table IV. IL-10 and TNF-α genotypes in Taiwanese SLE susceptibility. SLE patients

Controls, n. (%) n. (%) p-value Odds ratio (95% CI)

Combined IL-10 and TNF-α n=211 n=161

A/T/A vs. G-G 143 (68.1) 128 (79.5) 0.012* 1.84 (1.14-2.98) A/T/A vs. non G-G 25 (11.9) 29 (18.0) 0.094 0.61 (0.34-1.09) Non A/T/A vs. G-G 30 (14.3) 4 (2.5) <0.001* 0.15 (0.05-0.45) Non A/T/A vs. non G-G 12 (5.7) 0 (0.0) 0.002* ND

Trend test <0.001*

IL-10: interleukin-10; TNF-α: tumour necrosis factor-α; SLE: systemic lupus erythematosus; 95% CI: 95% confidence intervals; ND: not determined. *p value was <0.05.

Table V. Influence of TNF-α-308 genotype on the clinical features of Taiwanese SLE pa-tients with IL-10 ATA genotype.

Clinical features TNF-α G-Gq TNF-α non G-G Pc-value

(total n=107) (total n=25) Number (%) Number (%) ANA 104 (97.2) 24 (96) 0.753 Immunologic disorder 86 (80.37) 20 (80) 0.966 Haematological disorder 58 (54.21) 8 (32) 0.046 CNS disorder 11 (10.28) 4 (16) 0.417 Renal disorder 43 (40.19) 14 (56) 0.151 Serositis 19 (17.76) 9 (36) 0.045 Arthritis 56 (52.34 14 (46) 0.741 Oral ulcers 25 (23.36) 13 (52) 0.004# Photoseneitivity 43 (40.19) 16 (64) 0.031 Discoid rash 12 (11.21) 7 (28) 0.031 Malar rash 50 (46.73) 18 (72) 0.023

χ2 _{test (2x2 table for allele frequency; 2x3 table for genotype frequency) were performed to obtain the} p-value. The corrected P (Pc) values were adjusted by using Bonferroni’s correction for multiple

com-parisons. Statistical significance was considered as Pc-value <0.0045 (0.05/11 clinical features).

quencies of IL-10 non A/T/A haplotype

and TNF-α G-G genotype were

signifi-cantly decreased in SLE patients (2.5%

in SLE patients and 14.3% in controls;

p<0.001). The association between the

clinical manifestations of SLE patients

with the combined genotypes was also

investigated (Table V). The combined

frequencies of IL-10 A/T/A haplotype

and TNF-α G-G genotype were

sig-nificantly different in patients with

oral ulcers (Table V). The combined

frequencies of IL-10 A/T/A haplotype

and TNF-α G-G genotype were

signifi-cantly decreased in patients with oral

ulcers (Pc=0.004).

Discussion

We have found a relation between

pol-ymorphisms at the promoter region of

IL-10 and TNF-α genes and the SLE

susceptibility and a significant

correla-tion of the combined IL-10 and TNF-α

genetic polymorphisms contribute to

clinical features was also observed in

the Taiwanese population.

Our results showed that IL-10

A/T/A-A/T/A genotype was associated with

Taiwanese SLE, whereas, no

signifi-cant differences in the clinical

fea-tures between patients with various

genotypes/haplotypes could be

dem-onstrated. Many studies have shown

conflicting evidence for and against

association of SLE with various IL-10

genetic polymorphisms (13-17, 35-40).

Rood et al. reported that the ATA

hap-lotype is associated with

neuropsychi-atric manifestations of SLE among the

Dutch population,(15) while Mok et

al. indicated that this haplotype is not

associated with SLE susceptibility, but

is associated with renal involvement in

the SLE patients (16). However, Chong

et al. identified that the non-ATA

hap-lotype is associated with SLE patients

with serositis (17). These results

sug-gest that SLE is a complicated disease.

And the involvements of genetic

fac-tors as well as certain environmental

factors might also be essential in

dis-ease predisposition and progression.

The allele and genotype frequencies of

the polymorphism at -308 were not

sig-nificantly different in Taiwanese SLE

patients and controls. Many studies

have also shown conflicting evidence

for and against association of SLE with

various TNF locus polymorphisms

(25-31). A recent meta-analysis of the

TNF-α

-308G/A promoter polymorphism in

SLE revealed a significant association

found in European population, but not

in Asian or African populations (27).

Our results are in agreement with this

conclusion that there is no significant

association at the -308 position of

TNF-α promoter gene in our

Taiwan-ese population. However, the G allele

of the polymorphism at -308 was

sig-nificantly decreased in patients with

oral ulcers. The functional analysis of

polymorphism in the promoter region

of TNF-α -308 position yielded

con-flicting observations. Some studies

have suggested that the TNF-α -308 A

allele has higher transcriptional

activ-ity, while other studies showed that this

polymorphism appeared not to

influ-ence TNF-α production (41-44). The

association between the genetic

poly-morphism at -308 and TNF-α

produc-tion remains to be characterised.

Since the two regulators of the

inflam-matory response- IL-10 and TNF-α

have been suggested for the

involve-ment of SLE pathogenesis, we have

also investigated the interaction

be-tween IL-10 and TNF-α in Taiwanese

SLE susceptibility as well as clinical

features. Our results showed that the

combined frequencies of IL-10 A/T/A

haplotype and TNF-α G-G genotype

were significantly increased in SLE

patients. In addition, the combined

frequencies of IL-10 A/T/A haplotype

and TNF-α G-G genotype were

signifi-cantly decreased in patients with oral

ulcers. The effects of cytokines may be

greatly conditioned by the presence of

other cytokines, particularly in the case

of IL-10 and TNF-α, which have

com-plex and predominantly opposing roles

in the systemic inflammatory

respons-es. Suarez et al. reported that in

Span-ish SLE patients, there was a strong

as-sociation between susceptibility to SLE

and the high TNF-α producer genotype,

Gene name Primers PCR PCR conditions Restriction Alleles DNA Position

(Nucleotide change) product size (annealing enzyme site fragment

(SNP database ID) (bp) temperature) size (bp)

TNF-α-308 (A/G) Forward:5’-AGGCAATAGGTTTTGAGGGCCAT-3’ 117 ouchdown Nco I A 117 chr6:31,651,010

(rs1800629) Reverse:5’-ACACTCCCCATCCTCCCGGCT-3’ 60-50℃ G 97.20

Supplemental Table I. IL-10 promoter polymorphisms evaluated in Taiwanese SLE patients and controls. Gene name Report 1 Allele Report 1 Report 2 Allele Report 2 Context Sequence

(Nucleotide change) Dye Quencher Dye Quencher (SNP database ID)

IL-10 -1082 (A/G) VIC T NFQ FAM C NFQ TCCTCTTACCTATCCCTACTTCCCC[T/C]TCCCAAAGAAGCCTTAGTAGTGTTG

(rs1800896)

IL-10 -819 (C/T) VIC A NFQ FAM G NFQ AGTGAGCAAACTGAGGCACAGAGAT[A/G]TTACATCACCTGTACAAGGGTACAC

(rs1800871)

IL-10 -592 (C/A) VIC T NFQ FAM G NFQ CTTTCCAGAGACTGGCTTCCTACAG[T/G]ACAGGCGGGGTCACAGGATGTGTTC

(rs1800872)

independently of IL-10 production and

individuals harbouring high IL-10/low

TNF-α producer genotype tend to

de-velop DLE. These results suggest there

may be ethnic difference, genetic

fac-tors as well as certain environmental

factors involved in SLE disease

predis-position and progression.

In conclusion, our observations suggest

that the combined genotypes showed an

association with IL-10/ TNF-α genotype

in Taiwanese SLE patients and could

influence different SLE phenotypes.

References

1. KOTZIN BL: Systemic lupus erythematosus.

Cell 1996; 85: 303-6.

2. NATH SK, KILPATRICK J, HARLEY JB: Genet-ics of human systemic lupus erythematosus: the emerging picture. Curr Opin Immunol 2004; 16: 794-800.

3. ROBAK E, SYSA-JEDRZEJOWSKA A, ROBAK T, SMOLEWSKI P: Peripheral blood lym-phocyte apoptosis and circulating dendritic cells in patients with systemic lupus ery-thematosus: correlation with immunological status and disease-related symptoms. Clin

Rheumatol 2006; 25: 225-33.

4. KYTTARIS VC, KATSIARI CG, JUANG YT, TSOKOS GC: New insights into the pathogen-esis of systemic lupus erythematosus. Curr

Rheumatol Rep 2005; 7: 469-75.

5. GRONDAL G, GUNNARSSON I, RONNELID J, ROGBERG S, KLARESKOG L, LUNDBERG I: Cytokine production, serum levels and dis-ease activity in systemic lupus erythemato-sus. Clin Exp Rheumatol 2000; 18: 565-70. 6. AL-JANADI M, AL-BALLA S, AL-DALAAN A,

RAZIUDDIN S: Cytokine profile in systemic lupus erythematosus, rheumatoid arthritis, and other rheumatic diseases. J Clin

Immu-nol 1993; 13: 58-67.

7. CHUNG EY, LIU J, ZHANG Y, MA X: Differ-ential expression in lupus-associated IL-10 promoter single-nucleotide polymorphisms is mediated by poly(ADP-ribose) polymer-ase-1. Genes Immun 2007; 8: 577-89. 8. LALANI I, BHOL K, AHMED AR:

Interleukin-10: biology, role in inflammation and autoim-munity. Ann Allergy Asthma Immunol 1997; 79: 469-83.

9. ROUSSET F, GARCIA E, DEFRANCE T et al.: Interleukin 10 is a potent growth and differ-entiation factor for activated human B lym-phocytes. Proc Natl Acad Sci USA 1992; 89: 1890-3.

10. PARK YB, LEE SK, KIM DS, LEE J, LEE CH, SONG CH: Elevated interleukin-10 levels correlated with disease activity in systemic lupus erythematosus. Clin Exp Rheumatol 1998; 16: 283-8.

11. TURNER DM, WILLIAMS DM, SANKARAN D, LAZARUS M, SINNOTT PJ, HUTCHINSON IV: An investigation of polymorphism in the interleukin-10 gene promoter. Eur J

Immu-nogenet 1997; 24: 1-8.

12. EDWARDS-SMITH CJ, JONSSON JR, PURDIE DM, BANSAL A, SHORTHOUSE C, POWELL

EE: Interleukin-10 promoter polymorphism predicts initial response of chronic hepatitis C to interferon alfa. Hepatology 1999; 30: 526-30.

13. KHOA PD, SUGIYAMA T, YOKOCHI T: Poly-morphism of interleukin-10 promoter and tu-mor necrosis factor receptor II in Vietnamese patients with systemic lupus erythematosus.

Clin Rheumatol 2005; 24: 11-13.

14. LAZARUS M, HAJEER AH, TURNER D et al.:

Genetic variation in the interleukin 10 gene promoter and systemic lupus erythematosus.

J Rheumatol 1997; 24: 2314-7.

15. ROOD MJ, KEIJSERS V, VAN DER LINDEN MW et al.: Neuropsychiatric systemic lupus

erythematosus is associated with imbalance in interleukin 10 promoter haplotypes. Ann

Rheum Dis 1999; 58: 85-9.

16. MOK CC, LANCHBURY JS, CHAN DW, LAU CS: Interleukin-10 promoter polymorphisms in Southern Chinese patients with systemic lupus erythematosus. Arthritis Rheum 1998; 41 :1090-5.

17. CHONG WP, IP WK, WONG WH, LAU CS, CHAN TM, LAU YL: Association of inter-leukin-10 promoter polymorphisms with systemic lupus erythematosus. Genes Immun 2004; 5: 484-92.

18. LIN PW, HUANG CM, HUANG CC, TSAI CH, TSAI JJ, CHANG CP, TSAI FJ: The associa-tion of -627 interleukin-10 promoter poly-morphism in Chinese patients with systemic lupus erythematosus. Clin Rheumatol 2007; 26: 298-301.

19. SURYAPRASAD AG, PRINDIVILLE T: The biology of TNF blockade. Autoimmun Rev 2003; 2: 346-57.

20. KOLLIAS G, DOUNI E, KASSIOTIS G, KON-TOYIANNIS D: The function of tumour necro-sis factor and receptors in models of multi-organ inflammation, rheumatoid arthritis, multiple sclerosis and inflammatory bowel disease. Ann Rheum Dis 1999; 58 (Suppl. 1): I32-9.

21. SERRANO NC, MILLAN P, PAEZ MC: Non-HLA associations with autoimmune diseases.

Autoimmun Rev 2006; 5: 209-14.

22. ARINGER M, FEIERL E, STEINER G et al.:

Increased bioactive TNF in human systemic lupus erythematosus: associations with cell death. Lupus 2002; 11: 102-8.

23. MAURY CP, TEPPO AM: Tumor necrosis fac-tor in the serum of patients with systemic lupus erythematosus. Arthritis Rheum 1989; 32: 146-50.

24. GABAY C, CAKIR N, MORAL F et al.:

Circu-lating levels of tumor necrosis factor soluble receptors in systemic lupus erythematosus are significantly higher than in other rheu-matic diseases and correlate with disease activity. J Rheumatol 1997; 24: 303-8. 25. ROOD MJ, VAN KRUGTEN MV, ZANELLI E et

al.: TNF-308A and HLA-DR3 alleles

con-tribute independently to susceptibility to sys-temic lupus erythematosus. Arthritis Rheum 2000; 43: 129-34.

26. HIRANKARN N, AVIHINGSANON Y, WONGPI-YABOVORN J: Genetic susceptibility to SLE is associated with TNF-alpha gene polymor-phism -863, but not -308 and -238, in Thai population. Int J Immunogenet 2007; 34: 425-30.

27. LEE YH, HARLEY JB, NATH SK: Meta-analy-sis of TNF-alpha promoter -308 A/G poly-morphism and SLE susceptibility. Eur J

Hum Genet 2006; 14: 364-71.

28. ZUNIGA J, VARGAS-ALARCON G, HER-NANDEZ-PACHECO G, PORTAL-CELHAY C, YAMAMOTO-FURUSHO JK, GRANADOS J: Tumor necrosis factor-alpha promoter poly-morphisms in Mexican patients with system-ic lupus erythematosus (SLE). Genes Immun 2001; 2: 363-6.

29. PARKS CG, PANDEY JP, DOOLEY MA et al.:

Genetic polymorphisms in tumor necro-sis factor (TNF)-alpha and TNF-beta in a population-based study of systemic lupus erythematosus: associations and interaction with the interleukin-1alpha-889 C/T poly-morphism. Hum Immunol 2004; 65: 622-31. 30. TSUCHIYA N, KAWASAKI A, TSAO BP,

KOMA-TA T, GROSSMAN JM, TOKUNAGA K: Analy-sis of the association of HLA-DRB1, TN-Falpha promoter and TNFR2 (TNFRSF1B) polymorphisms with SLE using transmission disequilibrium test. Genes Immun 2001; 2: 317-22.

31. FERNANDO MM, STEVENS CR, SABETI PC et al.: Identification of two independent risk

factors for lupus within the MHC in United Kingdom families. PLoS Genet 2007; 3: e192.

32. HOCHBERG MC: Updating the American Col-lege of Rheumatology revised criteria for the classification of systemic lupus erythemato-sus. Arthritis Rheum 1997; 40: 1725. 33. STEPHENS M, DONNELLY P: A comparison

of bayesian methods for haplotype recon-struction from population genotype data. Am

J Hum Genet 2003; 73: 1162-9.

34. STEPHENS M, SMITH NJ, DONNELLY P: A new statistical method for haplotype recon-struction from population data. Am J Hum

Genet 2001; 68: 978-89.

35. CRAWLEY E, WOO P, ISENBERG DA: Single nucleotide polymorphic haplotypes of the interleukin-10 5’ flanking region are not as-sociated with renal disease or serology in Caucasian patients with systemic lupus ery-thematosus. Arthritis Rheum 1999; 42: 2017-8.

36. HIRANKARN N, WONGPIYABOVORN J, HAN-VIVATVONG O et al.: The synergistic effect

of FC gamma receptor IIa and interleukin-10 genes on the risk to develop systemic lupus erythematosus in Thai population. Tissue

An-tigens 2006; 68: 399-406.

37. ROSADO S, RUA-FIGUEROA I, VARGAS JA et al.: Interleukin-10 promoter polymorphisms

in patients with systemic lupus erythemato-sus from the Canary Islands. Int J

Immuno-genet 2008; 35: 235-42.

38. SOBKOWIAK A, LIANERI M, WUDARSKI M, LACKI JK, JAGODZINSKI PP: Genetic vari-ation in the interleukin-10 gene promoter in Polish patients with systemic lupus ery-thematosus. Rheumatol Int 2009; 29: 921-5. 39. SUAREZ A, LOPEZ P, MOZO L, GUTIERREZ C:

Differential effect of IL10 and TNF{alpha} genotypes on determining susceptibility to discoid and systemic lupus erythematosus.

Ann Rheum Dis 2005; 64: 1605-10.

40. VAN DER LINDEN MW, WESTENDORP RG, STURK A, BERGMAN W, HUIZINGA TW: High

interleukin-10 production in first-degree rel-atives of patients with generalized but not cu-taneous lupus erythematosus. J Investig Med 2000; 48: 327-34.

41. WILSON AG, SYMONS JA, MCDOWELL TL, MCDEVITT HO, DUFF GW: Effects of a poly-morphism in the human tumor necrosis factor alpha promoter on transcriptional activation.

Proc Natl Acad Sci USA 1997; 94: 3195-9.

42. KROEGER KM, CARVILLE KS, ABRAHAM LJ: The -308 tumor necrosis factor-alpha pro-moter polymorphism effects transcription.

Mol Immunol 1997; 34: 391-9.

43. HE B, NAVIKAS V, LUNDAHL J, SODER-STROM M, HILLERT J: Tumor necrosis factor alpha-308 alleles in multiple sclerosis and

optic neuritis. J Neuroimmunol 1995; 63: 143-7.

44. BAYLEY JP, DE ROOIJ H, VAN DEN ELSEN PJ, HUIZINGA TW, VERWEIJ CL: Functional analysis of linker-scan mutants spanning the -376, -308, -244, and -238 polymorphic sites of the TNF-alpha promoter. Cytokine 2001; 14: 316-23.