Role of lipid rafts in Japanese encephalitis virus assembly and release

National Taitung University Department of Life Science

Master Thesis

Role of lipid rafts in Japanese

encephalitis virus assembly and release

Author Chun-Wei Liao

1.

2.

3.

4.

5.

Dr. Chiou

( : )

( )

( )

kaspar ( )

” ”

P.S

@@\~/ ~

( )

I

RNA

BHK-21 24 --

30 60

--

-- NS3

NS3

-- NS3

RNA

-- --

II

Abstract

Japanese encephalitis virus (JEV), a member of flaviviruses, is a single-positive stranded RNA virus. Lipid rafts are specified microdomains that are rich in

cholesterol and sphingolipids in the plasma membrane and are critical for many cell activities including protein sorting, cell polarization and signal transduction.

Accumulating evidences suggest that lipid rafts may involve in the infection of JEV.

The aim of this study is to figure out the role of lipid rafts in Japanese encephalitis virus assembly and release. Baby hamster kidney (BHK-21) cells were infected with JEV for 24 hrs, and then cells were treated with methyl--cyclodextrin (MCD) to destroy lipid rafts by depletion cholesterol for 30 min or 60 min. The plaque assay showed that MCD reduced the extracellular JEV titer time-dependently and dose-dependently, but hardly altered the intracellular JEV titer. The membrane flotation assay revealed that the lipid raft marker caveolin-1 and virus protein NS3 were coexisted from raft fractions to non-raft fractions after MCD treatment. The immunofluorescence assay confirmed the alternations of viral protein distribution and showed that JEV NS3 protein and E protein were located in cholesterol rich area after increase MCD concentration. In Real-time PCR, extracellular JEV RNA were slightly decrease after MCD treatment, but the reduction was not much smaller than that of JEV titer. These results suggest that disruption of lipid rafts may alter the distribution of viral proteins and, as a result, hamper the JEV assembly and maturation.

Keywords: Flavivirus, Lipid raft, Cholesterol

III

……… I

……… II

……… VI

……… VII

………..

……….. 1

……….. 6

……….. 8

……….. 11

……….. ……….. 12

……….. 13

………. 13

………. 13

………. 13

………... 14

………... 15

IV

……….. 15

(Membrane flotation)……… 16

……….. 17

………...……… 18

RNA ……… 19

………. -- ……….... 20

………. 20

-- BHK-21 ………. 21

-- ……… 21

-- 22

-- ……… 23

-- ……… 23

-- …………. 24

-- RNA …….. 24

………... 26

………... 30

V

……….. 31

VI

-- ……….. 37

……….. 38

-- BHK-21 ……….. 39

-- ……… 40

-- ………… 41

-- … 42 -- ……… 43

-- ………… 44

-- ……… 46

VII

(Abbreviations)

CM Convoluted membrane CPE Cytopathic effect

DIG Detergent-insolublegly-glycolipid-rich domain

DMSO Dimethyl sulfoxide

DRM Dtergent-resistant membrane ECL Enhanced chemiluminescence EDTA Ethylenediaminetetraacetic acid ELISA Enzyme-linked immunosorbent assay FBS Fetal bovine serum

HRP Horseradish peroxidase IFA Immunofluorescence assay JEV Japanese encephalitis virus

MCD Methyl-β-cyclodextrin --

MVS Membrane vesicle structure, PAGE Polyacrylamide gel electrophoresis SDS Sodium dodecyl sulfate

SMS Smooth membrane structure

VIII

SRB Sulforhodamine B B

TCA Trichloroacetic acid

TEMED N,N,N,N’-trtramethylethylenediamine TGN trans-Golgi network

1

(Japanese Encephalitis Virus, JEV )

1924 1933

(Rosen 1986) 1938

(Culex tritaeniorhynchus) (Aedes albopictus) (kobayashi

1940) 1956 1962

(Culex annulus) (Culex pipiens)

(Aedes togoi) (Culex fusocephalus) (Culex vishnui) (Culex annulirostris) 5 26

(Wang, et al.

1962)

: (amplifying

host) (Umenai, et al.

1985)

2

(Rosen 1986)

5 10 7

3-5 (Solomon and Vaughn 2002) 1968

99%

5-25% 30-70%

(Vaughn and Hoke 1992; Solomon, et al. 2002)

:

(Gould, et al. 2008) 5 (Uchil

and Satchidanandam 2001) 4 (Mackenzie, et al.

3

2007)

(Twiddy and Holmes 2003)

(Flaviviridae)

(flavivirus) (yellow fever

virus) (Dengue virus, DENV) (West Nile

virus) RNA

50 RNA 11

(capsid) (prM) (envelope)

(Non-structural protein) (NS1, NS2A, NS2B, NS, NS4A, NS4B, NS5) (Lindenbach, et al. 2001)

(Gollins and Porterfield 1985)

RNA RNA

mRNA

RNA (Mukhopadhyay, et al.

4

2005) RNA

RNA (Replication Complex) RNA RNA

RNA RNA RNA

RNA RNA RNA RNA

(Cleaves, et al. 1981)

(Hase, et al. 1987) (reticular rER)

(Hase 1993; Hase 1993)

(smooth membrane structure, SMS) (convoluted membrane, CM) (Leary and Blair 1980) (membrane vesicle structure, MVS) (Hase 1993)

NS3 NS5 RNA

RNA

5

(Mukhopadhyay, et al. 2005)

(Exocytosis) (Mackenzie and Westaway 2001)

(Stadler, et al. 1997; Elshuber, et al. 2003)

(Elshuber and Mandl 2005)

6

(Lipid rafts)

sphingolipid

(Brown and London 1998)

(Simons and Ikonen

1997) (Ikonen

2001)

7

(Kurzchalia and Parton 1999) (caveolae)

(caveolin) (glycosphingolipids)

50-100 (Kurzchalia, et al. 1999)

(Empig and Goldsmith 2002)

--

lovastatin

(gangliosides) (Simons and Toomre 2000)

(detergent-resistant membrane, DRM)

(detergent-insoluble glycolipid-rich domain, DIG)

(Brown and London 1998)

(cyclodextrin)





8

-- (Kilsdonk, et al.

1995) --

(Keller and Simons 1998; Orlandi and Fishman 1998)

C (Hepatitis C virus, HCV)

(Human immunodeficiency virus, HIV) A (Influenza A virus)

C

caveolin-2 (Shi, et al. 2003) C (Aizakia, et al. 2004)

(Gao, et al. 2004; Hamamoto, et al. 2005) C

C (Okamoto, et al. 2005)

9

(Mañes, et al. 2000)

(Viard, et al. 2002) T

(Popik, et al. 2002)

(Graham, et al. 2003)

(Ono and Freed 2001)

(Simons and Ehehalt 2002)

(Bhattacharya, et al. 2003)

A 8 RNA

(ribonucleoprotein, RNP)

10

A

(Jin, et al. 1997; Nayak, et al. 2004) A

(Jin, et al. 1997)

(Barman

and Nayal 2007) hemagglutinin

neuraminidase (Scheiffele, et al. 1999) (Severe acute respiratory

syndrome-coronavirus, SARS) (Li, et al. 2007) (Murine coronavirus) (Choi, et al. 2005) (Poliovirus) (Danthi and Chow 2004) (Human herpesvirus) (Huang, et al.

2006) (Vaccinia virus) (Chung, et al. 2005) (foot-and-mouse disease virus) (Martín-Acebes, et al. 2007)

NS1

NS1 NS1

(Noisakran, et al. 2008)

-- 100

11

--

(Medigeshi, et al. 2008)

(Lee, et al. 2008)

12

Sucrose Magnesium chloride hexahydrate Potassium chloride Potassium dihydrogen phosphate di-Sodium hydrogen phosphate dodecahydrate (KH2PO4) MERCK

36.5 % Formaldehyde solution TWEEN 20, for electrophoresis Sodium bicarbonate Glycine, for electrophoresis Sodium dodecyl sulfate, for electrophoresis Triton X-100, for electrophoresis Sulforhodamine B sodium salt Trichloroacetic acid SIGMA

Fetal Bovine Serum (FBS) GIBCO 40% Acrylamide BIO-RAD RPMI 1640 Medium HyClone

Albumin, Bovine Serum Tris base CALBIOCHEM SeaPlaque Agarose Lonza

Acetic acid Fluka

Amplex Red^® Cholesterol Assay Kit Invitrogen QIAamp^® Viral RNA Mini Kit QIAGEN

AccuScript Hight Fidelity 1^st Strand cDNA Synthesis Kit

13

STRATAGENE

(BHK-21 10% (FBS)

RPMI-1640 37 5% CO2 C6/36,

10% RPMI-1640 37 5% CO2

RP9 NS1 NS3 BHK-21

- -

6

(Multiple of infection, M.O.I) 37

37

2 10⁵

BHK-21 37 24 1

14

800 RPMI-1640

RPMI-1640 10¹ 10² 10³

10⁴ 10⁵ 10⁶ 200 6

37 1

2% 4%

RPMI-1640 1:1 3

37 4

10% (37% 10 ) 1

30

(crystal violet 12.24 mM , formaldehyde 0.85M , NaCl

145.2mM 50% EtOH ) 10

5 = (Plaque

formation Unit, PFU / )

(10 mM Na2HPO4

1.76 mM KH2PO4 137 mM NaCl 2.7 mM KCL pH=7.4 PBS)

=1

15

PRMI 1640 28

RPMI 1640 10% 28

(cytopathic effect ,CPE)

28

5 1

-80

1

C6 / 36 28

16

10%

1 10

1% 10-30

3 1%

100-200

80-100 1

3 10 cy3 filipin

1% 100-200 filipin

0.05 1

3

(Zeiss Axiovert 200M)

(Membrane flotation)

250 1% Triton X-100 (10 mM

Tris-HCl [pH 7.4] 10 mM KCl 5 mM MgCl2)

30 25-gauge 20 4 13500 g

10 (HERMLE Z323K) 200

3 72% (low-salt buffer : 50mM Tris-HCl [pH 7.4] 25 mM

KCl 5 mM MgCl2) 4 55% 1.5 10%

17

4 100000 g 18 (Beckman coulter optima

L-90K ultracentrifuge) 1

SDS-PAGE

sample buffer 5:1 95 10

60 30

100 2

(25 mM Tris-Base 192 mM Glycine 20% Methanol) 150 2

(Western blot)

18

5% 1 PBST

3 10 1 4

PBST 10

10000-15000 1 PBST

10 5

1-5

BHK-21 5000 96

10% RPMI-1640 37 5%

24 10% 10

3

10% 10

SRB (0.4% SRB 1% )

10 1% 3 100 mM

Tris-base SRB 515

19

RNA

QIAamp® Virak RNA Mini Kit RNA

AccuScript Hight Fidelity 1^st Strand cDNA Synthesis Kit

RNA cDNA cDNA (JEV-F

5’-³¹²⁶tttggagaggttaaatcttgcactt³¹⁵⁰-3’ JEV-R

5’-⁵⁷⁸tgacactggcaaaacaatgca⁵⁹⁸-3’) SYBR Green LightCycler® 480II (Roche) Real-time PCR

10 Real-time PCR

20

--

--

(1 mM 2 mM 5 mM 10 mM 40 mM) (30

60 )

--

(1 mM 2 mM 5 mM 10 mM)

(40 mM) 30

-- 40 mM

BHK-21

36

21

-- BHK-21

-- Sulforhodamine B

(SRB) 96 BHK-21

-- 10 mM 90

40 mM 30

--

--

-- Amplex® Red Cholesterol Assay Kit --

--

22

--

--

(0 mM 1 mM 2 mM 5 mM 10 mM) 30

60 200

-- --

-20 10 10

200

1 mM

2 mM -- 5 mM

Student T 0.05 2 mM

60 5 mM 30

Student T

23

--

--

--

caveolin-1 0 mM

caveolin-1 5 mM

caveolin-1

NS3 5 mM

caveolin-1 NS1

--

--

1 filipin

24

--

--

--

NS3 cy3

filipin (A)

--

(B) NS3

-- RNA

--

--

25

RNA RNA cDNA

Real time PCR RNA --

1mM

RNA 10 RNA

26

--

50 (Hansen, et al. 2000) BHK-21

(Keller, et al. 1998) -- 10

mM 50

SRB --

10 mM --

-- 10 mM 1

-- caveolin-1

--

--

1 mM

2 mM --

5 mM

A

-- (Barman,

et al. 2007) (Lee, et

27

al. 2008)

caveolin-1 NS3

NS1 NS3

NS1 NS3 NS5

RNA (Chen, et al. 1997)

NS3 NS5 (Uchil and

Satchidanandam 2003) NS1

(Chiou 2003) NS1 C

caveolin-2 (Shi, et al. 2003) C (Gosert, et al.

2003) ( NS3, NS4A, NS4B, NS5A, NS5B)

RNA (El-Hage and Luo 2003) --

NS3

Filipin

(McGookey and Anderson 1983) Filipin

--

28

--

filipin NS3

filipin

(Hase, et al. 1987) --

--

Real-time RT-PCR

RNA RNA

furin furin

(Stadler, et al. 1997; Elshuber, et al. 2003) furin (Tick

Borne Encephalitis, TBE) furin furin

furin (Stadler, et al. 1997) furin

furin (Elshuber,

et al. 2003)

29

(Zybert, et al. 2008) furin

1 (Zybert, et al. 2008)

furin (Wengler and Wengler 1989; Stadler, et al. 1997)

(Tellier, et al. 2006)

N RNA

20 (Kim, et al.

2008)

30

NS3 NS3

31

Aizakia, H., Leea, K.-J., Sunga, V. M.-H., Ishikoc, H. and Lai, M. M. C.

(2004). Characterization of the hepatitis C virus RNA replication complex associated with lipid rafts. Virology 324: 450-461 Barman, S. and Nayal, D. P. (2007). Lipid raft disruption by cholesterol

depletion enhances influenza A virus budding from MDCK cells. J.

Virol 81: 12169-12178.

Bhattacharya, J., Peters, P. J. and Clapham, P. R. (2003). Human

immunodeficiency virus type 1 envelope glycoproteins that lack cytoplasmic domain cysteines: impact on association with

membrane lipid rafts and incorporation onto budding virus particles J. Virol 78: 5500-5506.

Brown, D. A. and London, E. (1998). Functions of lipid rafts in biological membranes. Annu. Rev. Cell Dev. Biol 14: 111-136.

Brown, D. A. and London, E. (1998). Structure and origin of ordered lipid domains in biological membranes. J. Membr Biol 164: 103-114.

Chen, C., Kuo, M., Chien, L., Hsu, S., Wang, Y. and Lin, J. (1997).

RNA-protein interactions: involvement of NS3, NS5, and 3'

noncoding regions of Japanese encephalitis virus genomic RNA. J.

Virol 71: 3266-3471.

Chiou, C.-T. (2003). Investigation of the association between cytoskleton and JEV component in JEV replication. PhD thesis: 31-32.

Choi, K. S., Aizaki, H. and Lai, M. M. (2005). Murine coronavirus requires lipid rafts for virus entry and cell-cell fusion but not for virus release. J. Virol 79: 9862-9871.

Chung, P., Huang, C. Y. and Chang, W. (2005). Vaccinia virus penetration requires cholesterol and results in specific viral envelope protein associated with lipid rafts. J. Virol 79: 1623-1634.

Cleaves, G. R., Ryan, T. E. and Schlesinger, R. W. (1981). Identification and characterization of type 2 dengue virus replicative intermediate and replicative form RNAs Virology 111: 73-83

Danthi, P. and Chow, M. (2004). Cholesterol removal by

methyl-beta-cyclodextrin inhibits poliovirus entry. J. Virol 78:

33-41.

El-Hage, N. and Luo, G. (2003). Replication of hepatitis C virus RNA

32

occurs in a membrane-bound replication complex containing

nonstructural viral proteins and RNA. J. Gen. Virol 84: 2761-2769.

Elshuber, S., Allison, S. L., Heinz, F. X. and Mandl, C. W. (2003).

Cleavage of protein prM is necessary for infection of BHK-21 cells by tick-borne encephalitis virus. J. Gen. Virol 84: 183-191.

Elshuber, S. and Mandl, C. W. (2005). Resuscitating mutations in a furin cleavage-deficient mutant of the flavivirus tick-borne encephalitis virus. J. Virol 76: 11813-11823.

Empig, C. J. and Goldsmith, M. A. (2002). Association of the caveola vesicular system with cellular entry by filoviruses. J. Virol 76:

5266-5270.

Gao, L., Aizaki, H., He, J.-W. and Lai, a. M. M. C. (2004). Interactions between viral nonstructural proteins and host protein hVAP-33 mediate the formation of hepatitis C virus RNA replication complex on lipid raft. J. Virol 78: 3480-3488.

Gollins, S. W. and Porterfield, J. S. (1985). Flavivirus infection

enhancement in macrophages: an electron microscopic study of viral cellular entry. J. Gen. Virol 66: 1969-1982.

Gosert, R., Egger, D., Lohmann, V., Bartenschlager, R., Blum, H. E., Bienz, K. and Moradpour, D. (2003). Identification of the hepatitis C virus RNA replication complex in Huh-7 cells harboring

subgenomic replicons. J. Virol 77: 5487-5492.

Gould, E. A., Solomon, T. and Mackenzie, J. S. (2008). Does antiviral therapy have a role in the control of Japanese encephalitis?

Antiviral Res 78: 140-149.

Graham, D. R. M., Chertova, E., Hilburn, J. M., Arthur, L. O. and Hildreth, J. E. K. (2003). Cholesterol depletion of human

immunodeficiency virus type 1 and simian immunodeficiency virus with ß-cyclodextrin inactivates and permeabilizes the virions:

evidence for virion-associated lipid rafts J. Virol 77: 8237-8248.

Hamamoto, I., Nishimura, Y., Okamoto, T., Aizaki, H., Liu, M., Mori, Y., Abe, T., Suzuki, T., Lai, M. M. C., Miyamura, T., Moriishi, K. and Matsuura, Y. (2005). Human VAP-B is involved in hepatitis C virus replication through Interaction with NS5A and NS5B. J. Virol 79:

13473-13482.

Hansen, G. H., Niels-Christiansen, L.-L., Thorsen, E., Immerdal, L. and Danielsen, E. M. (2000). Cholesterol depletion of enterocytes effect on the Golgi complex and apical membrane trafficking. J

33

Biol Chem 275: 5136-5142.

Hase, T. (1993). Morphogenesis of the protein secretory system in PC12 cells infected with Japanese encephalitis virus. Virchows Arch B Cell Pathol Zell-pathologie 64: 229-239.

Hase, T. (1993). Virus-neuron interactions in the mouse brain infected with Japanese encephalitis virus. Virchows Arch B Cell Pathol Incl Mol Pathol 64: 161-170.

Hase, T., Summers, P. L., Eckels, K. H. and Baze, W. B. (1987).

Maturation process of Japanese encephalitis virus in cultured mosquito cells in vitro and mouse brain cells in vivo. Arch. Virol 96: 135-151.

Huang, H., Li, Y., Sadaoka, T., Tang, H., Yamamoto, T., Yamanishi, K.

and mori, Y. (2006). Human herpesvirus 6 envelope cholesterol is required for virus entry. J. Gen. Virol 87: 277-285.

Ikonen, E. (2001). Roles of lipid rafts in membrane transport. Curr. Opin.

Cell Biol 13: 470-477

Jin, H., P.Leser, G., Zhang, J. and Lamb, R. A. (1997). Influenza virus hemagglutinin and neuraminidase cytoplasmic tails control particle shape. EMBO J 16: 1236-1247.

Keller, P. and Simons, K. (1998). Cholesterol is required for surface transport of influenza virus hemagglutinin J. Cell Biol 140:

1357-1367

Kilsdonk, E. P. C., Yancey, P. G., Stoudt, G. W., Bangerter, F. W., Johnson, W. J., Phillips, M. C. and Rothblat, G. H. (1995). Cellular

cholesterol efflux mediated by cyclodextrins. Journal of Biological Chemistry 270(29): 17250-17256.

Kim, J.-M., Yun, S.-I., Song, B.-H., Hahn, Y.-S., Lee, C.-H., Oh, H.-W.

and Lee, Y.-M. (2008). A single N-linked glycosylation site in the Japanese encephalitis virus prM rrotein is critical for cell

type-specific prM protein biogenesis, virus particle release, and pathogenicity in mice. J. Virol 82: 7846-7862.

kobayashi, H. (1940). On the virus of encephalitis epidemica isolated in Taihoku and Sintiku provinces in the summer. Acta Jap Med Trop 2:

55-62.

Kurzchalia, T. V. and Parton, R. G. (1999). Membrane microdomains and caveolae. Curr. Opin. Cell Biol 11: 424-431.

Leary, K. and Blair, C. D. (1980). Sequential events in the morphogenesis of Japanese encephalitis virus. J Ultrast Res 72: 123-129

34

Lee, C.-J., Lin, H.-R., Liao, C.-L. and Lin, Y.-L. (2008). Cholesterol effectively blocks entry of flavivirus. J. Virol 82: 6470-6480.

Li, G.-M., Li, Y.-G., Yamatea, M., Lia, S.-M. and Ikuta, K. (2007). Lipid rafts play an important role in the early stage of severe acute respiratory syndrome-coronavirus life cycle. Microbes Infect 9:

96-102.

Lindenbach, B. D., Thiel, H.-J. and Rice, C. M. (2001). Flaviviridae: the viruses and their replication. In fundamental Virology, 4th:

589-639.

Mañes, S., Real, a. G. d., Lacalle, R. A., Lucas, P., Gómez-Moutón, C., Sánchez-Palomino, S., Rafael Delgado, J. A., Mira, E. and Martínez-A, C. (2000). Membrane raft microdomains mediate lateral assemblies required for HIV-1 infection. EMBO Rep 15:

190–196.

Mackenzie, J. M. and Westaway, E. G. (2001). Assembly and maturation of the flavivirus Kunjin virus appear to occur in the rough

endoplasmic reticulum and along the secretory pathway, respectively. J. Virol 75: 10787-10799.

Mackenzie, J. S., Williams, D. T. and smith, D. W. (2007). Japanese

encephalitis virus: the geographic distribution incidence and spread of a virus with a propensity to emerge in new areas. E. Tabor, ed.

Emerging Viruses in Human Populations . Amsterdam: Elsevier 16:

201-268.

Martín-Acebes, M. A., González-Magaldi, M., Sandvig, K., Sobrino, F.

and Armas-Portela, R. (2007). Productive entry of type C foot-and-mouth disease virus into susceptible cultured cells requires clathrin and is dependent on the presence of plasma membrane cholesterol. Virology 369: 105-118.

McGookey, D. J. and Anderson, R. G. (1983). Morphological

characterization of the cholesteryl ester cycle in cultured mouse macrophage foam cells. J. Cell Biol 97: 1156-1168

Medigeshi, G. R., Hirsch, A. J., Streblow, D. N., Nikolich-Zugich, J. and Nelson, J. A. (2008). West nile virus entry requires cholesterol-rich membrane microdomains and is independent of {alpha}vβ3

integrin. J. Virol 82: 5212-5219.

Mukhopadhyay, S., Kuhn, R. J. and Rossmann, M. G. (2005). A structural perspective of the flavivirus life cycle. Nat. Rev. Microbiol 3:

13-22.

35

Nayak, D. P., Hui, E. K.-W. and Barman, S. (2004). Assembly and budding of influenza virus. Virus Res 106: 147-165.

Noisakran, S., Dechtawewat, T., Avirutnan, P., Kinoshita, T.,

Siripanyaphinyo, U., Puttikhunt, C., Kasinrerk, W., Malasit, P. and Sittisombut, N. (2008). Association of dengue virus NS1 protein with lipid rafts. J. Gen. Virol 89: 2492-2500.

Okamoto, K., Aoki, M., Kato, H., Katsume, A., Ohta, A., Tsukuda, T., Shimma, N., Aoki, Y., Arisawa, M., Kohara, M. and Sudoh, M.

(2005). Host sphingolipid biosynthesis as a target for hepatitis C virus therapy. Nat Chem Biol 1: 333-337.

Ono, A. and Freed, E. O. (2001). Plasma membrane rafts play a critical role in HIV-1 assembly and release. Proc Natl Acad Sci USA 98:

13925-13930.

Orlandi, P. A. and Fishman, P. H. (1998). Filipin-dependent inhibition of cholera toxin: evidence for toxin internalization and activation through caveolae-like domains. J. Cell Biol 141: 905-915 Popik, W., Alce, T. M. and Au, W.-C. (2002). Human immunodeficiency

virus type 1 uses lipid raft-colocalized CD4 and chemokine receptors for productive entry into CD4+ T Cells. J. Virol 76:

4709-4722.

Rosen, L. (1986). The natural history of Japanese encephalitis virus.

Annu Rev Microbiol 40: 395-414.

Scheiffele, P., Rietveld, A., Wilk, T. and Simons, K. (1999). Influenza viruses select ordered lipid domains during budding from the plasma membrane. J Biol Chem 274: 2038-2044.

Shi, S. T., Lee, K.-J., Aizaki, H., Hwang, S. B. and Lai, M. M. C. (2003).

Hepatitis C virus RNA replication occurs on a detergent-resistant membrane that cofractionates with caveolin-2. J. Virol 77:

4160-4168.

Simons, K. and Ehehalt, R. (2002). Cholesterol, lipid rafts, and disease. J.

Clin Invest 110: 697-603.

Simons, K. and Ikonen, E. (1997). Functional rafts in cell membranes.

Nat Chem Biol 387: 569-572.

Simons, K. and Toomre, D. (2000). Lipid rafts and signal transduction.

Mol. Cell Biol 1: 31-39.

Solomon, T. and Vaughn, D. (2002). Pathogenesis and clinical features of Japanese encephalitis and West Nile virus infections. Curr. Top.

Microbiol Immunol 267: 171-194.

36

Stadler, K., Allison, S., Schalich, J. and Heinz, F. (1997). Proteolytic activation of tick-borne encephalitis virus by furin. J. Virol 71:

8475-8481.

Tellier, E., Canault, M., Rebsomen, L., Bonardo, B., Juhan-Vague, I., Nalbone, G. and Peiretti, F. (2006). The shedding activity of ADAM17 is sequestered in lipid rafts. Exp. cell Res 312:

3969-3980.

Twiddy, S. S. and Holmes, E. C. (2003). The extent of homologous

recombination in members of the genus Flavivirus. J. Gen. Virol 84:

429-440.

Uchil, P. and Satchidanandam, V. (2001). Phylogenetic analysis of

Japanese encephalitis virus: envelope gene based analysis reveals a fifth genotype, geographic clustering and multiple introductions of the virus into the Indian subcontinent virus into the Indian

subcontinent. Am J Trop Med Hyg 65: 242-251.

Uchil, P. D. and Satchidanandam, V. (2003). Characterization of RNA synthesis, replication mechanism, and in vitro RNA-dependent RNA polymerase activity of Japanese encephalitis virus. Virology 307: 358-371.

Umenai, T., Krzysko, R., Bektimirov, T. A. and Assaad, F. A. (1985).

Japanese encephalitis:current worldwide status. Bulletion of the World Heath Organization 63: 625-631.

Vaughn, D. W. and Hoke, C. H. (1992). The epidemiology of Japanese encephalitis: prospects for prevention. Epidemiol Rev 14: 197-221.

Viard, M., Parolini, I., Sargiacomo, M., Fecchi, K., Ramoni, C., Ablan, S., Ruscetti, F. W., Wang, J. M. and Blumenthal, R. (2002). Role of cholesterol in human immunodeficiency virus type 1 envelope protein-mediated fusion with host cells. J. Virol 76: 11584-11595.

Wang, S.-P., Grayston, J. T. and Hu, S. M. K. (1962). Encephalitis on taiwan III. virus isolations from mosquitoes. J. Trop Med Hyg 11:

141-148.

Wengler, G. and Wengler, G. (1989). Cell-associated West Nile flavivirus is covered with E+pre-M protein heterodimers which are destroyed and reorganized by roteolytic cleavage during virus release. J. Virol 63: 2621-2526.

Zybert, I. A., Ende-Metselaar, H. v. d., Wilschut, J. and Smit, J. M. (2008).

Functional importance of dengue virus maturation: infectious properties of immature virions. J. Gen. Virol 89: 3047-3051.

37

--

-- 30 60

38

( )

39

-- BHK-21 96 BHK-21

-- TCA

SRB Tris base SRB

40

-- --

(0 mM 1 mM 2 mM 5 mM 10 mM) 1

41

-- BHK-21

=1 1 24

--

* P<0.05 ** P<0.01

42

--

24 (0 mM,1 mM,5 mM) --

1

( caveolin-1, NS1, NS3, E protein) --

43

--

filipin --

--

filipin --

--

44

(A) --

filipin

-- --

45

(B) -- (B)

NS3 -- NS3

46

-- 24

BHK-21 --

30 60

RNA RNA cDNA Real-time PCR