Genetic variant of IL-6 and its receptor are not associated with schizophrenia in Taiwan

Other uses, including reproduction and distribution, or selling or

licensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of the

article (e.g. in Word or Tex form) to their personal website or

institutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies are

encouraged to visit:

Contents lists available atScienceDirect

Neuroscience Letters

j o u r n a l h o m e p a g e :w w w . e l s e v i e r . c o m / l o c a t e / n e u l e t

Genetic variants of IL-6 and its receptor are not associated with

schizophrenia in Taiwan

Yu-Li Liu

_{, Chih-Min Liu}

_{, Cathy Shen-Jang Fann}

_{, Wei Chih Yang}

_{, Ya-Hui Chen}

_,

Li-Jung Tseng

_{, Shih-Kai Liu}

_{, Ming H. Hsieh}

_{, Tzung-Jeng Hwang}

_{, Hung-Yu Chan}

_,

Jiann-Jyh Chen

_{, Wei J. Chen}

_{, Hai-Gwo Hwu}

a_{Division of Mental Health and Addiction Medicine, Institute of Population Health Sciences, National Health Research Institute, Miao-Li, Taiwan} b_{Department of Psychiatry, National Taiwan University Hospital and College of Medicine, National Taiwan University, Taipei, Taiwan} c_{Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan}

d_{Taoyuan Psychiatric Center, Taoyuan, Taiwan}

e_{Institute of Epidemiology, College of Public Health, National Taiwan University, Taipei, Taiwan} f_{Department of Psychology, College of Science, National Taiwan University, Taipei, Taiwan} g_{Neurobiology and Cognitive Science Center, National Taiwan University, Taipei, Taiwan}

a r t i c l e i n f o

Received 15 September 2009

Received in revised form 30 October 2009 Accepted 7 November 2009 Keywords: IL-6 IL-6 receptor Schizophrenia Tetra-primer ARMS RFLP

a b s t r a c t

The pathophysiological process of schizophrenia is still unclear. The levels of interleukine-6 (IL-6) and its receptor, soluble IL-6R, have been reported to be elevated in the plasma and cerebrospinal fluid of schizophrenic patients. In this study, we tested the association of genetic variants of IL-6 and IL-6R with schizophrenia. Genotyping of three single nucleotide polymorphisms (SNP) for each IL-6 (IL-6-1, IL-6-2, and IL-6-3) and IL-6R (rs4845617 = IL-6R1, rs4553185 = IL-6R2, and rs4379670 = IL-6R3) gene was per-formed in 100 patients with schizophrenia and 113 normal controls. The polymorphisms of IL-6R2 were genotyped using Tetra-primer ARMS PCR. IL-6R3 polymorphisms were genotyped using restriction frag-ment length polymorphism (RFLP) with Apo I enzyme as the restriction enzyme. All other polymorphisms were genotyped using the direct sequencing method. We found a di-nucleotide haplotype block and a tri-nucleotide haplotype block in the genes of IL-6 and IL-6R, respectively. All six SNPs and their hap-lotypes failed to show a significant association with schizophrenia. The IL-6-2 SNP showed a nominally significant association with the positive symptoms of schizophrenia (p = 0.0472). We conclude that the genetic variants of IL-6 and IL-6R are not associated with schizophrenia. In order to verify this result, further study using a larger sample size and exploring the association between the genotype of IL-6-2 and plasma level of IL-6 is recommended.

© 2009 Elsevier Ireland Ltd. All rights reserved.

Schizophrenia is a complex mental disorder affecting 1% of all pop-ulations. The disease primarily affects the central nervous system, but immune alterations have been actively proposed to play a role in the pathogenesis of schizophrenia[10,16,18]. An autoimmune involvement in schizophrenia has been suggested by several cel-lular and humoral cytokine changes in patients[22]. Among these altered cytokines, interleukine-6 (IL-6; online Mendelian Inheri-tance in Man (MIM) number *147620) has been most consistently found to be related to schizophrenia[6,9,14–15,26].

IL-6 is a pleiotropic cytokine released both from peripheral immune cells and from neurons and microglia of the central

∗ Corresponding author at: Department of Psychiatry, National Taiwan University Hospital, No. 7, Chung San South Road, Taipei, 100, Taiwan.

Tel.: +886 2 2312 3456x6785; fax: +886 2 2375 3663. E-mail address:[email protected](H.-G. Hwu).

nervous system (CNS) [24,27]. In the CNS, soluble IL-6 receptor (sIL-6R; MIM number *147880) levels in the CSF have increased in schizophrenic patients with a marked paranoid-hallucinatory syndrome[17]. In the periphery, IL-6 has been found to be persis-tently elevated in the plasma of patients in different ethnic groups [1,11,19,26]. High IL-6 levels have been found to be related to duration and treatment resistance in schizophrenia[11,19]. These results suggested that an elevated plasma level of IL-6 was asso-ciated with an unfavorable course of schizophrenia with a longer duration of illness, greater treatment resistance, and more marked paranoid-hallucinatory symptoms.

We selected single nucleotide polymorphisms (SNPs) located within these two genes and genotyped them in 113 normal controls and 100 schizophrenic patients to decipher the potential genetic association of IL-6 and IL-6 receptor in schizophrenia. Endophe-notypes are recommended to define the role of the gene in the complex traits of schizophrenia[5]. In this study, we used the sus-0304-3940/$ – see front matter © 2009 Elsevier Ireland Ltd. All rights reserved.

tained attention endophenotype of schizophrenia as measured by the continuous performance test (CPT) and the severity of the pos-itive and negative symptom dimensions to assess the potential association of these endophenotype indicators with IL-6 and its receptor in the disease.

We collected the DNA of schizophrenic patients, fulfilling cri-teria defined by the Diagnostic and Statistical Manual 4th edition (DSM-VI)[2]from the Department of Psychiatry of the National Taiwan University Hospital and normal controls without a history of any psychotic symptoms or family history of psychotic disorder from hospital staff and community subjects. All individuals were screened for the presence of acute infectious disease. The average age was 33.3± 10.6 years for normal controls and 34.5 ± 11.3 years for patients. The male to female ratios were 50:62 in normal con-trols and 48:52 in patients. Clinical symptoms were rated using the schedule for assessment of negative symptoms (SANS)[4]and the schedule for assessment of positive symptoms (SAPS)[3]. The sum score of negative symptoms (SUMN) was the sum of the global scores of four negative symptom dimensions, including affective blunting, alogia, avolition-apathy, and anhedonia-asociality. The sum score of positive symptoms (SUMP) was the sum of the global scores of hallucinations and delusions. The sum score of disorganiz-ing symptoms (SUMDIS) was the sum of the global scores of Bizarre behavior and positive formal thought disorder. The patients were recruited from the outpatient clinics and their psychiatric status was stable as they received maintenance neuroleptic treatment due to the potential fluctuations in positive symptoms. Their mean posi-tive symptom score was 1.44± 1.18, mean disorganizing symptom score 1.27± 0.97, and mean negative symptom score 1.80 ± 0.96 using the SAPS and SANS scales (rating range 0–5).

After signing informed consent, the study subjects took the con-tinuous performance task (CPT) in the morning and 10 cc of blood was drawn from the antecubital vein in the morning after overnight fasting.

A CPT machine from Sunrise System, v. 2.20 (Pembroke, MA, USA), was used to assess sustained attention. The procedure has been described in detail elsewhere[7]. Briefly, numbers from 0 to 9 were randomly presented for 50 ms each, at a rate of one number per second. Each subject undertook two CPT sessions: the unde-graded 1–9 task and the 25% deunde-graded 1–9 task. Subjects were asked to respond whenever the number “9” preceded by the num-ber “1” appeared on the screen. A total of 331 trials, 34 (10%) of which were target stimuli, were presented over five minutes for each session. During the 25% degraded session, a pattern of snow was used to toggle the background and foreground so that the image was visually distorted. Each test session began with 2 min of practice (repeated if subjects required). One signal-detection index of performance on the test, sensitivity (d), was derived from the hit rate (probability of response to target trials) and false-alarm rate (probability of response to nontarget trials)[20]. Sensitivity is an individual’s ability to discriminate target stimuli from nontar-get stimuli. In a 1-week test–retest reliability study[7]of the CPT versions used in this study, the intraclass correlation coefficients or reliability of dwere 0.83 and 0.82 for the undegraded and the 25% degraded 1–9 task, respectively.

The SNP markers were selected according to the potential proteomic function alterations which include the exon and the pro-moter regions of the loci with average distance of 31 kb for IL-6R (IL-6R1, IL-6R2, and IL-6R3) and 6 kb for IL-6. We initially selected 3 SNPs (rs1800797, rs3087236, and rs3087236) of IL-6 and 3 SNPs (rs4845617, rs4553185, and rs4379670) of IL-6R from the NCBI SNP database (dbSNP). However, no polymorphisms were found at the originally selected SNP ID in IL-6 and we found three novel SNPs (IL-6-1, IL-6-2, IL-6-3) in the region near the originally selected three SNPs, respectively, using direct sequencing. The chromosome position of each SNP marker on each gene was genotyped with the

primer pairs as shown inTable 1. The SNP of IL-6R2 was geno-typed by Tetra-primer ARMS PCR[25], the IL-6R3 was genotyped by RFLP with Apo I enzyme, and the others were genotyped by direct sequencing. All polymerase chain reactions (PCRs) were carried out according to the protocol of the Pro Taq (Protech Technology, Taiwan) on a DNA Thermal Cycler ABI 9700. The PCR for IL-6R2 Tetra-primer was performed with an initial denaturation step at 95◦C for 2 min, followed by two rounds; 16 cycles of denaturing at 95◦C for 1 min, annealing at 71◦C for 1 min and extension at 72◦C for 1 min, and 20 cycles with initial 95◦C for 1 min, annealing at 57◦C for 1 min and extension at 72◦C for 2 min. The PCR prod-ucts of direct sequencing were purified to remove reaction buffer and remaining primers with PCR DNA Fragments Extraction Kit (Geneaid, Taiwan). The sequences of PCR products were directly determined by BigDye Terminator Cycle Sequencing kit (Applied Biosystems, CA, USA).

The Hardy–Weinberg equilibrium was assessed using the ALLELE procedure in SAS/GENETICS release 8.2[8]for each SNP. We used Haploview software to construct haplotype blocks con-stituted by “strong LD” markers[12]. The genotype and allele-type association analyses were performed by using the CASECONTROL procedure in SAS/GENETICS release 8.2 with 10000 permutation resamples between the normal controls and the schizophrenic patients. The phenotype and genotype association analyses were performed by the Kruskal–Wallis non-parametric one-way analysis of variance.

Three SNPs of both 6 receptor (at chromosome 1q21) and IL-6 (at chromosome 7p21) were designed with specific primer pairs for genotyping and were validated in this study (Table 1). The SNPs at the IL-6 region (IL-6-1, IL-6-2 and IL-6-3) are novel compared to the IL-6R. The polymorphism of IL-6-1 is 25 bps at the 3-end on the rs1800797 locus, IL-6-2 is 38 bps at the 3-end on the rs3087236 and IL-6-3 is 63 bps at the 3-end on the rs3087236.

No polymorphisms were found at the rs1800797 and the rs3087236 in these subjects.

The genotype frequency and minor allele frequency of each SNP in both control and schizophrenia groups are presented in Table 2. All SNPs were compatible with Hardy–Weinberg’s equilib-rium distribution, except IL-6R2 (p = 0.022 in control, and p = 0.0171 in schizophrenia). However, considering multiple testing, the SNP IL-6R2 was still compatible with Hardy–Weinberg’s equilibrium. We found no significant associations of these SNP genotypes with schizophrenia.

The intermarker linkage disequilibrium analyses for haplotype block revealed a three-SNP block of IL-6 with Dof 0.81 and a two-SNP block of IL-6R with Dof 0.95 (Fig. 1). The haplotype frequencies

Fig. 1. Haploview linkage disequilibrium (D_{) displays the haplotype structures of}

Table 1

SNP genotyping on three IL-6 and three IL-6 receptor markers.

Genetic SNP (SNP ID) Gene position (allele type) (exon/intron) Primer Sequence (from 5- to 3-end) F: forward R: reverse IL-6R1 (rs4845617) −208 (A = 1/G = 2) (5_{-UTR,exon 1) F: CGCCGCTCTGAGTCATGTG}

R: CCATGGAGTGGTAGCCGAG

IL-6R2 (rs4553185) 32850 (C = 1/T = 2) (intron 6) F: (inner primer for T allele): TTCTAGCCCTGTGGCGTAGTTGACCT R: (inner primer for C allele): CTGCCAAGTATTTAAGAATGATTAATGTG F: (outer primer (5_–3_{)): AGATCTAGAATGCAAGAATCTCCCTGAC}

R: (outer primer (5–3)): CCCATAGATAAAAGCCTTCTCTCCCT IL-6R3 (rs4379670) 61760 (A = 1/T = 2) (3-UTR,exon 10) F: CTGCAAGAATTGAAGCAGGA

R:GTGATTTTCATTGCTGGGCT

IL-6-1 (rs1800797 + 25) −636 (C = 1/G = 2) (promoter) F: CTGGCACAGAGAGCAAAGTCCTCACTGG R: TGCGATGGAGTCAGAGGAAACTCAGTTCA IL-6-2 (rs3087236 + 38) 5379 (A = 1/G = 2) (3_{-UTR) F: TGCCAGGCATCATTAAATGTGTTGC}

R: CCCAGATTTGAAATCCAAGTCTACC IL-6-3 (rs3087236 + 63) 5404 (G = 1/T = 2) (3-UTR) F: TGCCAGGCATCATTAAATGTGTTGC R: CCCAGATTTGAAATCCAAGTCTACC SNP ID + number: the SNP is located at the number of nucleotides after the SNP ID locus.

Table 2

Minor allele frequency (MAF) and association analyses of the SNPs of IL-6R and IL-6.

SNP Control Schizophrenia Association Test (p-value)

11 12 22 MAF 11 12 22 MAF Genota _Alleleb

IL-6R1 0.16 0.59 0.25 (A) 0.46 0.14 0.62 0.24 0.45 0.90 0.90 IL-6R2 0.21 0.62 0.17 (T) 0.48 0.19 0.64 0.17 0.49 0.89 0.74 IL-6R3 0.67 0.30 0.028 (T) 0.18 0.63 0.31 0.068 0.22 0.38 0.29 IL-6-1 0.61 0.35 0.045 (G) 0.22 0.58 0.35 0.070 0.25 0.72 0.52 IL-6-2 0.47 0.42 0.11 (G) 0.32 0.43 0.43 0.14 0.36 0.76 0.46 IL-6-3 0 0.021 0.98 (G) 0.011 0 0.010 0.99 0.0051 0.54 0.54

a_{Genot: genotype frequency association test.} b _{Allele: allele type frequency association test.}

of all compositions in either IL-6 or IL-6R showed no significant association with schizophrenia (p = 0.3495 for IL-6 and p = 0.158 for IL-6R).

Table 3shows the results of association of all SNP genotypes and the phenotypes of the severity of positive symptom dimension (SUMP), the severity of negative symptom dimension (SUMN), the severity of disorganization (SUMDIS) and endophenotype of the sustained attention indicators (the dof degraded CPT and the d of undegraded CPT). Only the IL-6-2 showed a borderline signifi-cant association with the positive symptom dimension phenotype (p = 0.0472), where the positive symptom dimension phenotype is more severe in the recessive model of patients carrying A allele.

In this study, there was a statistically marginally significant association between the SNP of IL-6-2 genotype and the sever-ity of the positive symptom dimension of schizophrenia. It has been reported that high IL-6 levels were related to the duration and the treatment resistance of schizophrenia[11,19]. The patients in this study were stable schizophrenics followed in the outpa-tient department and receiving regular maintenance neuroleptic treatment. As the IL-6-2 is located within the 3-UTR, it is possi-ble that the SNP was responsipossi-ble for the elevation of IL-6 during the active pathological process of schizophrenia with prominent positive symptoms[19,24]. However, we have no plasma level of IL-6 to demonstrate the association between the genotype of IL-6-2

Table 3

Association analyses of quantitative phenotype indicators of schizophrenia and SNPs genotypes of IL-6R and IL-6 using Kruskal–Wallis Test.

Phenotype SNPs (p-value)

Case

IL-6R1 IL-6R2 IL-6R3 IL-6-1 IL-6-2 IL-6-3 IL6-H6 _IL6R-H7

SUMNa _{0.49 0.88 0.76 0.053 0.61 0.31 0.17 0.74} SUMPb _{0.97 0.68 0.17 0.15 0.047 0.72 0.34 0.56} SUMDISc _{0.060 0.97 0.97 0.38 0.84 0.75 0.63 0.65} Undegradedd_{CPT d} _{0.36 0.49 0.26 0.54 0.77 0.58 0.56 0.72} Degradede_{CPT d} _{0.49 0.94 0.61 0.38 0.15 0.14 0.13 0.48} Control

IL-6R1 IL-6R2 IL-6R3 IL-6-1 IL-6-2 IL-6-3 IL6-Hf _IL6R-Hg

Undegraded CPT d _{0.28 0.24 0.86 0.36 0.57 0.58 0.73 0.85}

Degraded CPT d _{0.40 0.080 0.26 0.22 0.35 0.35 0.40 0.29}

a_{SUMN: the severity of negative symptom dimension.} b _{SUMP: the severity of positive symptom dimension.} c _{SUMDIS: the severity of disorganization dimension.}

d _{Undegraded CPT: the sustained attention indicator tested by unmasked CPT.} e_{Degraded CPT: the sustained attention indicator tested by masked CPT.} f _{IL-H: IL6 haplotype;}

and plasma level of IL-6. Hence, it is worth exploring the associa-tion between the genotype of IL-6-2 and plasma level of IL-6 in the future.

Although our results failed to find an association between the genotype of IL-6 or IL-6R and schizophrenia, two results from Asian populations have shown that the significant genetic region is pri-marily located at IL-6R of exon 9 and promoter region[13,23]. One study even showed an association between the genotype and the serum soluble IL-6R level in schizophrenia[13]. In a large meta-analysis, IL-6 was found to be increased in schizophrenia[21]. In comparison to these results, our IL-6R SNPs were not located in exon 9 or its promoter region. This may be one of the reasons for this difference. Another reason may be a different sample compo-sition resulting from the heterogeneity of schizophrenia. Further study should consider the genetic region and factors related to cytokine alterations such as stress, weight gain and different kinds as well as different dosages of antipsychotic medication in order to verify the potential etiological relations between the cytokine and schizophrenia.

In summary, SNP markers of IL-6 (rs1800797 + 25 at promoter, rs3087236 + 38 at the 3-UTR, and rs3087236 + 63 at the 3-UTR) and IL-6R (rs4845617 at exon 1 of 5-UTR, rs4553185 at intron 6, and rs4379670 at exon 10 of 3-UTR) showed no significant asso-ciations with schizophrenia in both single locus and haplotype analyses. Verifying this result using a larger sample size and explor-ing the association between the genotype of IL-6-2 and plasma level of IL-6 is recommended. This study suggested that genes of IL-6 or IL-6 receptor are likely to be environmental mediators rather than genes that predispose susceptibility to schizophre-nia.

Acknowledgements

We acknowledge the help from the Department of Medi-cal Research in National Taiwan University Hospital. This study was supported by grants from the National Science Coun-cil, Taiwan (NSC-91-3112-B-002-011; NSC-92-3112-B-002-019; NSC-93-3112-B-002-012; NSC-94-3112-B-002-020, NSC 95-3112-B-002-011, NSC 96-3112-95-3112-B-002-011, NSC 97-3112-B-002-046), the National Health Research Institute, Taiwan (NHRI-90-8825PP; NHRI-EX91, 92, 93, 94-9113PP; IRO1 MH59624-01), National Tai-wan University (EPP-97R00066-47), and the Department of Health, Taiwan (DOH94-TD-G-111-035).

References

[1] K. Akiyama, Serum levels of soluble IL-2 receptor alpha, IL-6 and IL-1 recep-tor antagonist in schizophrenia before and during neuroleptic administration, Schizophr. Res. 37 (1999) 97–106.

[2] American Psychiatric Association, Diagnostic and Statistical Manual, American Psychiatric Press, Washington, DC, 1994.

[3] N. Andreasen, The Scale for Assessment of Positive Symptoms (SAPS), Univer-sity of Iowa, Iowa City, IA, 1984.

[4] N. Andreasen, The Scale for the Assessment of Negative Symptoms (SANS), University of Iowa, Iowa City, IA, 1983.

[5] M.F. Aukes, B.Z. Alizadeh, M.M. Sitskoorn, C. Kemner, R.A. Ophoff, R.S. Kahn, Genetic overlap among intelligence and other candidate endophenotypes for schizophrenia, Biol. Psychiatry 65 (2009) 527–534.

[6] S.L. Buka, M.T. Tsuang, E.F. Torrey, M.A. Klebanoff, R.L. Wagner, R.H. Yolken, Maternal cytokine levels during pregnancy and adult psychosis, Brain Behav. Immun. 15 (2001) 411–420.

[7] W.J. Chen, S.K. Liu, C.J. Chang, Y.J. Lien, Y.H. Chang, H.G. Hwu, Sustained atten-tion deficit and schizotypal personality features in nonpsychotic relatives of schizophrenic patients, Am. J. Psychiatry 155 (1998) 1214–1220.

[8] K.V. Chowdari, K. Mirnics, P. Semwal, J. Wood, E. Lawrence, T. Bhatia, S.N. Deshpande, K.T.B.R.E. Ferrell, F.A. Middleton, B. Devlin, P. Levitt, D.A. Lewis, V.L. Nimgaonkar, Association and linkage analyses of RGS4 polymorphisms in schizophrenia, Hum. Mol. Genet. 11 (2002) 1373–1380.

[9] A.B. Erbagci, H. Herken, O. Koyluoglu, N. Yilmaz, M. Tarakcioglu, Serum IL-1beta, sIL-2R, IL-6, IL-8 and TNF-alpha in schizophrenic patients, relation with symp-tomatology and responsiveness to risperidone treatment, Mediators Inflamm. 10 (2001) 109–115.

[10] R. Freedman, S. Leonard, A. Olincy, C.A. Kaufmann, D. Malaspina, C.R. Cloninger, D. Svrakic, S.V. Faraone, M.T. Tsuang, Evidence for the multigenic inheritance of schizophrenia, Am. J. Med. Genet. 105 (2001) 794–800.

[11] U.H. Frommberger, J. Bauer, P. Haselbauer, A. Fraulin, D. Riemann, M. Berger, Interleukin-6-(IL-6) plasma levels in depression and schizophrenia: compar-ison between the acute state and after remission, Eur. Arch. Psychiatry Clin. Neurosci. 247 (1997) 228–233.

[12] S.B. Gabriel, S.F. Schaffner, H. Nguyen, J.M. Moore, J. Roy, B. Blumenstiel, J. Higgins, M. DeFelice, A. Lochner, M. Faggart, S.N. Liu-Cordero, C. Rotimi, A. Adeyemo, R. Cooper, R. Ward, E.S. Lander, M.J. Daly, D. Altshuler, The structure of haplotype blocks in the human genome, Science 296 (2002) 2225–2229.

[13] J.C. Galicia, H. Tai, Y. Komatsu, Y. Shimada, K. Akazawa, H. Yoshie, Polymor-phisms in the IL-6 receptor (IL-6R) gene: strong evidence that serum levels of soluble IL-6R are genetically influenced, Genes Immun. 5 (2004) 513–516. [14] D.L. Garver, R.L. Tamas, J.A. Holcomb, Elevated interleukin-6 in the

cerebrospinal fluid of a previously delineated schizophrenia subtype, Neu-ropsychopharmacology 28 (2003) 1515–1520.

[15] T. Kaminska, A. Szuster-Ciesielska, A. Wysocka, H. Marmurowska-Michalowska, H. Dubas-Slemp, M. Kandefer-Szerszen, Serum cytokine level and production of reactive oxygen species (ROS) by blood neutrophils from a schizophrenic patient with hypersensitivity to neuroleptics, Med. Sci. Monit. 9 (2003) CS71–CS75.

[16] A.W. MacDonald 3rd, M.F. Pogue-Geile, T.T. Debski, S. Manuck, Genetic and environmental influences on schizotypy: a community-based twin study, Schizophr. Bull. 27 (2001) 47–58.

[17] G. Muller-Newen, A. Kuster, U. Hemmann, R. Keul, U. Horsten, A. Martens, L. Graeve, J. Wijdenes, P.C. Heinrich, Soluble IL-6 receptor potentiates the antag-onistic activity of soluble gp130 on IL-6 responses, J. Immunol. 161 (1998) 6347–6355.

[18] N. Muller, M. Riedel, R. Gruber, M. Ackenheil, M.J. Schwarz, The immune sys-tem and schizophrenia. An integrative view, Ann. N. Y. Acad. Sci. 917 (2000) 456–467.

[19] J. Naudin, J.L. Mege, J.M. Azorin, D. Dassa, Elevated circulating levels of IL-6 in schizophrenia, Schizophr. Res. 20 (1996) 269–273.

[20] K.H. Nuechterlein, Vigilance in schizophrenia and related disorders, in: J. Zubin (Ed.), Handbook of Schizophrenia. Vol.5. Neuropsychology, Psychophysiology and Information Processing, Elsevier, Amsterdam, 1991, pp. 397–433. [21] S. Potvin, E. Stip, A.A. Sepehry, A. Gendron, R. Bah, E. Kouassi, Inflammatory

cytokine alterations in schizophrenia: a systematic quantitative review, Biol. Psychiatry 63 (2008) 801–808.

[22] R.D. Strous, Y. Shoenfeld, Schizophrenia, autoimmunity and immune system dysregulation: a comprehensive model updated and revisited, J. Autoimmun. 27 (2006) 71–80.

[23] S. Sun, F. Wang, J. Wei, L.Y. Cao, L.Y. Qi, M.H. Xiu, S. Chen, X.H. Li, T.A. Kosten, T.R. Kosten, X.Y. Zhang, Association between interleukin-6 receptor polymorphism and patients with schizophrenia, Schizophr. Res. 102 (2008) 346–347. [24] D.P. van Kammen, C.G. McAllister-Sistilli, M.E. Kelley, J.A. Gurklis, J.K. Yao,

Ele-vated interleukin-6 in schizophrenia, Psychiatry Res. 87 (1999) 129–136. [25] S. Ye, S. Dhillon, X. Ke, A.R. Collins, I.N. Day, An efficient procedure for

genotyp-ing sgenotyp-ingle nucleotide polymorphisms, Nucleic Acids Res. 29 (2001) E88–E188. [26] X.Y. Zhang, D.F. Zhou, P.Y. Zhang, G.Y. Wu, L.Y. Cao, Y.C. Shen, Elevated interleukin-2, interleukin-6 and interleukin-8 serum levels in neuroleptic-free schizophrenia: association with psychopathology, Schizophr. Res. 57 (2002) 247–258.

[27] B. Zhao, J.P. Schwartz, Involvement of cytokines in normal CNS development and neurological diseases: recent progress and perspectives, J. Neurosci. Res. 52 (1998) 7–16.