• 沒有找到結果。

Characterizing the functional role of WWOX in thymocyte development

N/A
N/A
Protected

Academic year: 2021

Share "Characterizing the functional role of WWOX in thymocyte development"

Copied!
19
0
0

加載中.... (立即查看全文)

全文

(1)

Characterizing the functional role of WWOX in thymocyte

development

Tsung-Hao Chang1 and Li-Jin Hsu2,3,4,*

1

Institute of Basic Medical Sciences, 2Department of Medical Laboratory Science and Biotechnology, 3Center of Infectious Disease and Signaling Research, and 4Research Center for Medical Laboratory Biotechnology, College of Medicine, National Cheng Kung University, Tainan 70101, Taiwan

*Address correspondence to: L.-J. Hsu, Department of Laboratory Science and Biotechnology, College of Medicine, National Cheng Kung University, 1 University Road, Tainan 70101, Taiwan. Fax: +886-6-236-3956; Email: [email protected]

Running title: WWOX regulates Notch signaling during thymocyte development Keywords: tumor suppressor; apoptosis; gene knockout mice

(2)

1

ABSTRACT

WW domain-containing oxidoreductase (designated WWOX, FOR or murine WOX1) has been shown to promote stress-induced cancer cell death and function as a tumor suppressor. Previous studies have reported that Wwox-/-mice exhibit preweaning lethality, abnormal bone

formation, growth retardation, and thymic and splenic atrophy. However, the mechanism by which WWOX regulates developmental processes is unknown. To understand the role of WWOX in thymocyte development, we generated Wwox-/- mice by gene targeting.

Surprisingly, severe thymocyte developmental defect was observed in Wwox-/- mice. By

cleaved caspase-3 staining and TUNEL assay, we determined significantly increased levels of thymocyte apoptosis in Wwox-/- mice. After ex vivo culture for 24 h, Wwox-/- thymocytes

showed higher percentage of cell death than the controls, suggesting that Wwox-/- thymocytes

are prone to cell death. We demonstrated that adoptively transferred Wwox-/-bone marrow

cells failed to differentiate into mature T cells in wild-type recipient mice. In addition,

Wwox-/- CD4-CD8-thymocytes failed to differentiate into double-positive and single-positive

thymocytes in an OP9-DL4 coculture system. These results clearly suggest an intrinsic defect in Wwox-/- cells during T lymphocyte development. Interestingly, NOTCH1 protein

expression was significantly decreased in Wwox-/- thymocytes. Our results revealed that

WWOX interacted with NOTCH1 and increased its stability by preventing NOTCH1 protein degradation via proteasomal pathway, thereby promoting thymocyte development. These in

vivo and in vitro findings run against the role of WWOX as a pro-apoptotic protein and

(3)

2

INTRODUCTION

WW domain-containing oxidoreductase, designated WWOX, FOR, or WWOX, was identified in year 20001. Human WWOX or mouse Wwox encodes a 46-kDa protein

containing two leading WW domains and a short-chain alcohol dehydrogenase-reductase (SDR) domain at its C-terminus. The first leading WW domain of WWOX is a canonical WW domain that contains two conserved tryptophan. In the other WW domain, the second tryptophan is replaced by a tyrosine residue1. WW domain has been reported to mediate

protein-protein interactions. WWOX interacts with various proteins via its WW domains, including AP-2γ2, p533, p53 homologues p734 and Np635, ErbB46,7, Ezrin8, SIMPLE9, c-Jun10, JNK111, and others. WWOX also binds to Tau12 and GSK3β13 through SDR domain.

Human WWOX locates at a fragile site on chromosome 16. Loss of heterozygosity and translocation of WWOX gene have been reported to be associated with tumor progression14-20.

However, Wwox knockout mice do not show high tumor incidents. Severe pre-weaning death and growth retardation are also observed in Wwox knockout mice followed with abnormal bone development and thymic and splenic atrophy. It suggests that Wwox may be important for hematopoietic cell development especially for thymocyte development, but the under mechanisms remain unclear.

T lymphocytes are key effecter cells in adoptive immunity. Precursor T cells arise from bone marrow and migrate into thymus for maturation. These precursor cells that do not express CD4 and CD8 molecules (double negative; DN) differentiate into CD4+CD8+ (double

positive; DP) thymocytes in thymus. DP thymocytes further differentiate into CD4+CD8- or

CD4-CD8+ (single positive; SP) thymocytes. The evolutionarily conserved Notch signaling

pathway has been reported to be involved in the thymocyte developmental21. NOTCH1

signaling induces the expression of essential genes for thymocyte development, such as anti-apoptotic molecule Bcl-2, cytokine receptors Il-2rα and Il-7rα, and transcription factors

(4)

3

Hes1and Gata322. NOTCH1 knockout or ectopic expression of dominant negative NOTCH1

impairs thymocyte development23. Mammalian Notch family contains four paralogs,

NOTCH1, 2, 3 and 4. Multiple Delta-like and Jagged ligands for Notch receptors have been identified. The extracellular domain of Notch is composed of 29-36 tandem epidermal growth factor (EGF)-like repeats. These EGF-like repeats mediate ligand binding to Notch and require calcium to maintain their structure and binding affinity. Full-length Notch protein is first cleaved at Golgi by furin-like convertases to form a heterodimer linked by non-covalent binding. Notch is further glycosylated at Golgi and transferred to cell membrane as a membrane-bound receptor. After ligand-receptor binding, the membrane-bound Notch is cleaved by metalloproteinase ADAM and γ-secretase, and the intracellular domain of Notch (ICN) is released into cytosol. Free ICN can translocate into nucleus and interact with transcription factors to regulate gene expression21.

Glycosylation24 and ubiquitination25 are two important processes in regulation of

NOTCH1 expression and activation. Glycosylation is critical for NOTCH1 protein folding, transferring to cell membrane, binding with ligands, and stability, but the molecular mechanism is unclear. Numb binds to NOTCH1 and promotes its endocytosis and degradation for antagonizing NOTCH1 signaling during embryonic development26. ITCH is

an important E3 ligase that mediates NOTCH1 ubiquitination and degradation. ITCH contains a C2 domain, a prolin-rich region, four WW domains, and a catalytic HECT domain27. ITCH is activated through phosphorylation at Ser199, Ser232 and Thr222 by

JNK128. ATM kinase also phosphorylates ITCH at Ser161 for activation29. ITCH

phosphorylation leads to its conformational change to become fully activated28. Moreover,

ITCH performs auto-ubiquitination activity through Lys63-linked polyubiquitin chain30; the

roles of Lys63-linked ubiquitination remain more clarified. The protein stability of ITCH is relatively high30; the degradation mechanisms of ITCH remain unclear. FAM/USP9X, a

(5)

4

deubiquitylating enzyme, deubiquitinates ITCH to protect ITCH from proteasome degradation31. However, the E3 ligases and mechanisms by which mediate ITCH degradation

are still unknown.

The relationship between ITCH and WWOX has been proposed recently. Salah and colleagues suggest that WWOX competes ITCH binding site through WW domains to suppress ITCH-mediated Δ Np63α ubiquitination5. Moreover, Mohammad and colleagues

report that ITCH mediates WWOX Lys-63-linked poly-ubiquitination to promote WWOX nucleus translocation and induce cell death32. In this study, we found a novel regulatory role

of WWOX in regulating ITCH stability; WWOX was required for NOTCH1 protein stability to promote thymocyte development through regulating ITCH expression.

We generated Wwox-/- mice to evaluate the regulatory roles of WWOX in immune

system. Growth retardation, pre-weaning lethality and severe thymic and splenic atrophy were observed in Wwox-/- mice. Significant down-regulation of NOTCH1 protein expression

and drastic apoptosis were detected in Wwox-/- thymocytes. Surprisingly, we found that

WWOX inhibited ITCH-mediated ubiquitination and donw-regulated ITCH expression through promoting ubiquitination and proteasome degradation of ITCH. The interaction of WWOX and NOTCH1 in both mouse thymocytes and HEK293T cells was detected. The WW domain region of WWOX and the N-terminus of NOTCH1 were critical for their interaction. In conclusion, we showed here a novel role of WWOX in regulating NOTCH1 signaling through promoting ITCH ubiquitination and degradation during thymocyte development.

(6)

5

RESULTS

Deletion of Wwox gene results in severe thymocyte apoptosis and thymic atrophy in mice.

To explore the physiologic functions of WWOX, we have generated Wwox knockout mice by gene targeting. Wwox-/- mice showed growth retardation and preweaning lethality. The thymic

and splenic organ size, weight and cell numbers were dramatically reduced in Wwox-/- mice

(Fig. 1A, 1C and 1D). To check whether thymocyte development defect resulted in thymic and splenic atrophy, we detected the four thymocyte populations, double negative (DN), double positive (DP), and CD4 or CD8 single positive (SP) thymocytes in thymocytes. A drastic reduction in the percentages of DP thymocytes was detected in Wwox-/-thymus (Fig.

1B). Although the percentages of SP and DN thymocytes were increased in Wwox-/-mice, the

absolute numbers of these cell populations were also reduced (data not shown). During thymocyte development, thymocytes overcome massive apoptotic stress to mature. We then check if abnormal cell death in Wwox-/- thymus resulted in dramatic reduction of cell numbers.

Massive cell apoptosis occurred in Wwox-/-thymus, as determined by TUNEL assay and

active caspase-3 staining (Fig. 1E and 1F). After ex vivo culture for 6 h, higher levels of cell death were detected in Wwox-/-thymocytes, indicating that Wwox-/-thymocytes are prone to

death (Fig. 1G). zVAD-fmk, a pan-caspase inhibitor, partially blocked cell death in Wwox

-/-thymocytes (Fig. 1H). These results indicate that thymocyte development is defective in

Wwox-/-mice.

WWOX deficiency causes an intrinsic defect in thymocytes during development.

Since we had observed severe developmental defects in Wwox-/- thymocytes, we further

checked the DN thymocytes differentiation by staining with CD25 and CD44. A significant blockade in DN3 stage was observed (Fig. 2A). Thymocyte development required thymocyte intrinsic signaling and thymic epithelial cells or stromal cells extrinsic factors. To evaluate

(7)

6

how WWOX deficiency resulted in thymocyte development defects, we performed adoptive transfer experiments. CD45.2+ bone marrow cells isolated from Wwox+/+ or Wwox-/- mice

were transferred into NOD.SCID mice that express cell surface marker CD45.1. As compared with Wwox+/+control cells, our results showed that CD45.2+Wwox-/- bone marrow cells failed

to differentiate into DP thymocytes after 6 weeks in a normal extrinsic microenvironment (Fig. 2B). Moreover, using an OP9-DL4 stromal co-culture system to support thymocyte development in vitro, our results revealed that Wwox+/+ and Wwox+/- DN thymocytes

differentiated into DP stage after co-culture with OP9-DL4 cells for 4 days (Fig. 2b). However, Wwox-/-DN thymocytes co-cultured with OP9-DL4 cells could not differentiate

into DP thymocytes (Fig. 2C). Compared with Wwox+/+ and Wwox+/-thymocytes, the numbers

of both DN and DP Wwox-/- thymocytes were not increased after co-culture with OP9-DL4

cells, indicating that Wwox-/-thymocytes fail to proliferate and differentiate into DP stage in

vitro with normal extrinsic microenvironment (Fig. 2D and 2E). Together, these results

suggest that WWOX is intrinsically required for thymocyte development. NOTCH1 expression and ubiquitination are regulated by WWOX.

Notch signaling has been shown to be an essential signaling pathway that regulates thymocyte development. NOTCH1 signaling induces the expression of many genes, such as Hes1, Gata3, IL-7 receptor, IL-2 receptor and TCF-1, to promote thymocyte commitment, survival and maturation. To identify the intrinsic defect in the developmental process of

Wwox-/- thymocytes, we found that expression of membrane NOTCH1 receptors and ICN

were down-regulated in Wwox-/-thymocytes by flow cytometry and western blotting (Fig. 3A

and 3B). Our results showed that NOTCH1 protein down-regulation was not due to reduced

NOTCH1 mRNA levels in Wwox-/-thymocytes, as determined by reverse-transcription and

real-time PCR (Fig. 3C and 3D). Here we found a reduction of NOTCH1 protein expression in Wwox-/- thymocytes and the reduction of NOTCH1 is due to a post-transcriptional

(8)

7

regulation.

ITCH, an E3 ubiquitin ligase, mediates NOTCH1 ubiquitination to promote NOTCH1 endocytosis and degradation. To explore if down-regulation of NOTCH1 protein expression in Wwox-/- thymocytes was due to exacerbated ITCH-mediated ubiquitination and

degradation, we over-expressed ITCH in HEK293T cells in the presence of WWOX over-expression or not. A strong inhibition of ITCH-mediated universal and NOTCH1-specific ubiquitination was observed in the presence of WWOX overexpression (Fig. 4A and 4C). While knockdown of WWOX in HEK293T cells with shRNA; ITCH-mediated ubiquitination and ITCH expression were significantly up-regulated in WWOX knockdown HEK293T cells (Fig. 4B). In addition, we perform co-immunoprecipitation (co-IP) experiment to check the ubiquitination of NOTCH1 in WWOX knockdown cells; NOTCH1-specific ubiquitination was up-regulated in WWOX knockdown cells in the presence of ITCH over-expression (Fig. 4D). ITCH-mediated NOTCH1 degradation was partially reversed by proteasome inhibitor MG132 or lysosome inhibitor CQ (Fig.4E). Collectively, above results showed that WWOX regulates NOTCH1 expression through regulating ITCH-mediated ubiquitination and degradation.

WWOX down-regulates the expression of ITCH through promoting ITCH K48-ubiquitination and proteasome degradation.

To explore how WWOX regulates ITCH-mediated ubiquitination, we over-expressed ITCH and WWOX simultaneously in HEK293T cells. Surprisingly, ectopic and endogenous ITCH both down-regulated in the presence of WWOX over-expression (Fig. 5A). The down-regulation of ITCH was not due to mRNA down-regulation which was detected by RT-PCR and real-time PCR (Fig. 5B and 5C). We further used CHX, a protein synthesis inhibitor, to block universal protein synthesis to check if WWOX regulated ITCH protein stability. After treating CHX, ITCH protein expression decreased spontaneously, however,

(9)

8

over-expression of WWOX accelerated endogenous and ectopic ITCH degradation (Fig. 5D and 5E). MG132 and lactacystin, two proteasome inhibitors, significantly reversed WWOX-mediated ITCH down-regulation, however lysosome inhibitors, E64d, Pepstatin A and CQ, failed to reverse ITCH expression (Fig. 5F and 5G). To identify the degradation mechanism of ITCH which was mediated by WWOX, we confirm the ubiquitination of ITCH by co-IP. Higher ubiquitination (Fig. 5H) and K48-linked ubiquitination but not K63-linked ubiquitination (Fig. 5I and J) of ITCH were observed in the presence of over-expression of WWOX. While K48-linked ubiquitination is thought as a ubiquitination form for promoting protein degradation, our results consistently showed that WWOX regulates ITCH protein stability and promotes ITCH proteasome degradation through promoting K48-linked ubiquitination,.

N-terminal WW domain region of WWOX and N-terminus of ICN are required for the

interaction of WWOX with NOTCH1.

From above results, we found that WWOX regulated NOTCH1 expression through regulating ITCH protein stability. In addition, we found that WWOX interacted with NOTCH1 in thymocytes (Fig. 6A) and HEK293T (Fig 6D) To determine the interacting regions between WWOX and NOTCH1, fragments of WWOX and ICN tagged with GFP and HA, respectively, were expressed in HEK293T cells for co-immunoprecipitation experiments (Fig. 6B and C). Our data showed that the N-terminal WW domain region of WWOX interacted with endogenous NOTCH1 (Fig. 6E). Moreover, we further demonstrated that WWOX interacted with the N-terminal region of ICN, but not with its C-terminus (Fig. 6F). However, deletion of N-terminal WW domain region of WWOX do not interrupt the interaction of WWOX with NOTCH1 (data not shown). Ectopic HA-tagged ICN and N-terminal region of ICN showed consistent results with endogenous NOTCH1 (data not shown). Moreover, in

(10)

9

results that endogenous NOTCH1 or ectopic HA-tagged ICN were pull-down with GST-fusion WWOX (Fig. 6G and H).

WWOX interacts with NOTCH1 to suppress interaction between NOTCH1 and ITCH. To further explore the molecular mechanism, we over-expressed ITCH in the presence of WWOX over-expression or not in HEK293T cells. The results showed that WWOX interacted with endogenous NOTCH1 (Fig. 7A) and ectopic ICN region of NOTCH1 (Fig. 7B) to suppress interaction of ITCH to NOTCH1. Since WWOX down-regulated ITCH in

vivo, we performed GST pull-down with recombinant ITCH protein to prevent

WWOX-mediated ITCH down-regulation from affecting interaction of ITCH to NOTCH1. We found that GST-ITCH pull down less endogenous and ectopic NOTCH1 protein in the presence of WWOX over-expression in HEK293T cells (Fig. 7C and D).

Taken together, these data suggest that WWOX regulates E3 ligase ITCH protein stability through promoting K48-linked ubiquitination of ITCH. In the absence of WWOX, ITCH binds to NOTCH1 and promotes its ubiquitination and degradation. In Wwox-/- thymocytes,

down-regulation of NOTCH1 protein expression in thymocytes leads to intrinsic developmental defects and severe cell death (Fig. 8).

(11)

10

DISCUSSION

While the reason of severe thymic and splenic atrophy in Wwox-/- mice remains unknown we

propose a novel intrinsic role of WWOX in thymocyte development which has not been mentioned before. In addition, WWOX is required for NOTCH1 expression which is controlled by ITCH during thymocyte development. We propose a new novel mechanism which WWOX regulates E3 ligase, ITCH, K48-linked poly-ubiquitination and proteasome degradation. Moreover, we identify interaction between WWOX and NOTCH1. Although the molecular model by which WWOX interacts with NOTCH1 remains more verified, we have identified that WWOX is able to interact with NOTCH1 N-terminus through WW domains and SDR domain. Since NOTCH1 is an evolutionarily conserved and important signaling pathway for regulating developmental processes of embryo, central nervous system, cardiovascular system and endocrine21, we suggest a novel role of WWOX in regulating

NOTCH1 signaling.

A previous study suggests that WWOX might compete with ITCH for binding to Np635

; ITCH mediates WWOX K63-linked ubiquitination to drive WWOX translocalization to nucleus and to promote cell death32. In our results, we find that

over-expression of WWOX significantly down-regulates ITCH expression instead. While we also find an interaction between WWOX and ITCH by GST pull-down (data not shown) we observe no obvious band shift in western blotting with ubiquitinated WWOX. Moreover, we observe no significant cell death after over-expression of WWOX and ITCH simultaneously in HEK293T cells. Our recent data supports that WWOX regulates ITCH rather than that ITCH promotes WWOX ubiquitination.

ITCH mediates auto-ubiquitination to promote degradation31; K63-linked

poly-ubiquitination also be proposed while the results of K63-linked ubiquitination in ITCH remain unclear30. We find here that WWOX specifically promote ITCH K48-linked

(12)

11

poly-ubiquitination and proteasome degradation. While WWOX lacks E3 ligase activity and canonical RING domain or HECT domain, the E3 ligases which WWOX recruits to ubiquitinate ITCH remains more investigation.

While recent studies suggest ITCH is involved in immune regulation33 and

development34 Edwina and colleagues proposed that FAM/USP9X regulates T cell activation

through affecting phosphorylation of TCR downstream molecules35. These studies suggested

critical roles of ubiquitination and deubiquitination in regulating T cell activation and maintaining T cell tolerance. WWOX has been reported to be involved in the regulation of JNK111, c-Jun10 and MEK36 which have been shown to be important for T cell activation and

proliferation. Although we provide data to point out that WWOX is essential for thymocyte development intrinsically, whether WWOX is critical for peripheral T cell functions need more direct evidence. Otherwise, our results suggest a significant inhibition of ITCH expression through WWOX; if WWOX regulates T cell functions through affecting ITCH expression remain more investigation.

(13)

12

MATERIALS AND METHODS

Cell lines and chemicals. HEK293T cells were obtained from American Type Culture Collection. Cells were cultured at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium (Invitrogen, Carlsbad, CA) supplemented with 5% fetal bovine serum (FBS). zVAD-fmk was purchased from Bachem (Bachem AG, Bubendorf, Switzerland). MG132 and CHX were obtained from Calbiochem.

Flow cytometry. Thymocytes were isolated from Wwox+/+, Wwox+/- and Wwox-/- mice and single cell suspensions in RPMI-1640 containing 2% FBS and 0.1% NaN3 were prepared.

Red blood cells were removed by hypotonic shock. Cells were incubated with antibodies for 30 min on ice in the dark, washed twice with RPMI-1640, and analyzed by a flow cytometer. Antibodies used were FITC-conjugated anti-CD4, PE-conjugated anti-CD8, PerCP-conjugated anti-CD45.1, and APC-conjugated anti-CD45.2 (eBioscience).

TUNEL assay and active caspase-3 staining. Thymic tissue sections were deparaffinized by washing the specimen three times with xylene for 5 min. The samples were washed three times with a series of 100%, 95%, 80%, and 70% ethanol for 3 min. The specimen were washed three times with PBS for 5 min, and treated with freshly prepared proteinase K (20 μg/ml) for 15 min at room temperature. After three washes with PBS for 5 min, endogenous peroxidase was quenched in Peroxidase Block for 5 min. After three washes with PBS for 5 min, the samples were incubated with equilibration buffer for 10 min at room temperature, washed three times with PBS for 5 min, and treated with Working Strength TdT Enzyme in a humidified chamber at 37℃ for 1h. After immersing with Working Strength Stop/Wash buffer for 10 min at room temperature, the samples were washed three times with PBS for 5 min, incubated with horseradish peroxidase-conjugated anti-digoxigenin antibody (Chemicon), and further washed three times with PBS for 5 min. The peroxidase activity was developed with the addition of AEC substrate. The samples were counterstained with

(14)

13

hematoxylin. TUNEL-positive cells were visualized using the chromogen diaminobenzidine as substrate under an Olympus light microscope. For active caspase-3 staining, deparaffinized tissue sections were incubated with 10 mM citric acid buffer (pH 6.0) in a microwave set at 750 W for 25 min for antigen retrieval. After three washes with PBS for 5 min, endogenous peroxidase of the sepcimen was quenched using Peroxidase Block for 5 min. After three washes with PBS for 5 min, the specimen were incubated with Protein Block for 5 min, washed three times with PBS for 5 min, and incubated with anti-cleaved caspase-3 antibody (Cell Signaling) in DAKO diluents overnight at 4°C. After three washes with PBS for 5 min, the samples were incubated with horseradish peroxidase-conjugated secondary antibody in DAKO diluents for 1 h at room temperature. After three Washes with PBS for 5 min, peroxidase activity was developed using AEC substrate. After washes, the tissue sections were counterstained with hematoxylin.

Annexin-V and propidium iodide staining. Single cell suspensions were prepared as described above, and 2 x 105 cells were cultured in RPMI-1640 containing 10% FBS, 2 μM

2-meraptoethanol, 2 mM L-glutamine and 1X antibiotic-antimycotic in 96-well plates with or without the addition of anti-CD3 and anti-CD95. After the indicated time intervals, cells were collected, washed twice with cold PBS, and resuspended in 1X Binding Buffer at a concentration of 1 x 106 cells/ml. Cells (100 μl) were transferred to falcon tubes, incubated

with 5 μl PE-conjugated Annexin V and 5 μl 7-AAD (Calbiochem) for 15 min at room temperature in the dark, and analyzed by a flow cytometer. For propidium iodide staining, cells were fixed with 75% ethanol in PBS for 30 min. Cells were stained with a staining solution containing propidium iodide (40 μg/ml) and RNase (100 μg/ml) in PBS for 15 min at room temperature in the dark, and analyzed by a flow cytometer.

Adoptive transfer. We have established an adoptive transfer model using NOD.SCID mice that lack mature T and B lymphocytes as the recipients. Wwox+/+, Wwox+/- or Wwox-/- bone

(15)

14

marrow cells isolated from the donor mice with a mixed genetic background of C57BL/6 and 129 were injected into the recipient mice via tail vein. After 6 week, thymocytes were isolated from the recipient mice, stained with the indicated antibodies and analyzed by a flow cytometer.

OP9 co-culture system. OP9 stromal cells stably expressing a Notch ligand Delta-like 4 (OP9-DL4) were used to support thymocyte development in vitro. OP9-DL4 cells (3 x 104/well) were seeded onto 24-well plates and cultured in α-MEM containing 10% FBS for 1

day. Thymocytes (1-2 x 105 cells) isolated from Wwox+/+, Wwox+/- and Wwox-/- mice were

added to the OP9-DL4 cultures and cocultured with the presence of IL-7 (5 ng/ml; Peprotech) for 4 days. After culture, thymocytes were harvested, stained with the indicated antibodies and analyzed by a flow cytometer.

Co-immunoprecipitation and Western blotting. Whole cell lysates were prepared using a lysis buffer containing 0.1% SDS, 1% Nonidet P-40, 0.5% Tween 20, 10 mM Na3VO4, 10 mM Na4P2O7, 10 mM NaF, and 1:20 dilution of protease inhibitor cocktail (Sigma) in PBS, and the lysates were collected after centrifugation at 13,000 g for 10 min at 4°C. Total protein concentrations were determined using Bio-Rad Protein Assay Dye Reagent. Co-immunoprecipitation was performed as previously described37. Equal amounts of protein

samples were separated by SDS-PAGE and transferred to PVDF membranes. Antibodies used were against the following proteins: NOTCH1, ICN, Numb, ITCH (Cell Signaling), ITCH, myc, GFP, HA (GeneTex), HA (Covance), GFP (Abcam), and β-actin (Sigma). Horseradish peroxidase-conjugated goat anti-rabbit IgG or horse anti-mouse IgG (Cell Signaling) were used as secondary antibodies. Antibody probing and enhanced chemiluminescence (ECL, Amersham) detection were performed as previously described37.

GST pull-down. Glutathione beads were washed with PBS and then incubated with GST tagged recombinant proteins for 30 min at 4℃. Beads with GST tagged proteins were then

(16)

15

washed with 0.5mM PMSF/PBS three times. Whole cell lysates were prepared as above described. Equal amount of cell lyastes were incubated with GST tagged protein beads overnight and then washed with PMSF/PBS three times.

RNA extraction and reverse transcription PCR. RNA was extracted using TRIZOL reagent (Invitrogen) according to the manufacturer’s instruction. Reverse transcription-PCR was performed as described earlier37. The PCR primer pairs and amplification protocols used

were as follows: 1) mouse NOTCH1, 5’- TCACGCTGACGGAGTACAAGT (forward) and 5’- CCACACTCGTTGACATCCTG (reverse), 30 cycles at 95°C for 1 min, 60°C for 1 min, and 72°C for 1 min, followed by 72°C for 10 min for the final extension; 2) mouse -actin,

5’-TGGAATCCTGTGGCATCCATGAAAC (forward) and

5’-TAAAACGCAGCTCAGTAACAGTCCG (reverse), 26 cycles at 95°C for 1 min, 60°C for 1 min, and 72°C for 1 min, followed by 72°C for 10 min for the final extension. The PCR fragments were subjected to electrophoresis on 1.2% agarose gels run in 1x TAE, visualized by ethidium bromide staining, and analyzed using the ImageQuant 300 imaging system (GE Healthcare Life Sciences).

Statistical analysis. Data were presented as the means ± s.d. Statistical significance was determined using Student’s t test. The differences were considered significant when the P values were less than 0.05.

(17)

16

REFERENCES

1. Bednarek, A.K., et al. WWOX, a novel WW domain-containing protein mapping to human chromosome 16q23.3-24.1, a region frequently affected in breast cancer.

Cancer Res 60, 2140-2145 (2000).

2. Aqeilan, R.I., et al. Physical and functional interactions between the Wwox tumor suppressor protein and the AP-2gamma transcription factor. Cancer Res 64, 8256-8261 (2004).

3. Chang, N.S. Hyaluronidase Induction of a WW Domain-containing Oxidoreductase That Enhances Tumor Necrosis Factor Cytotoxicity. Journal of Biological Chemistry 276, 3361-3370 (2000).

4. Aqeilan, R.I. Functional association between Wwox tumor suppressor protein and p73, a p53 homolog. Proceedings of the National Academy of Sciences 101, 4401-4406 (2004).

5. Salah, Z., et al. Tumor suppressor WWOX binds to ΔNp63α and sensitizes cancer cells to chemotherapy. Cell Death and Disease 4, e480 (2013).

6. Aqeilan, R.I., et al. Association of Wwox with ErbB4 in Breast Cancer. Cancer Research 67, 9330-9336 (2007).

7. Aqeilan, R.I., et al. WW domain-containing proteins, WWOX and YAP, compete for interaction with ErbB-4 and modulate its transcriptional function. Cancer Res 65, 6764-6772 (2005).

8. Jin, C., et al. PKA-mediated protein phosphorylation regulates ezrin–WWOX interaction. Biochemical and Biophysical Research Communications 341, 784-791 (2006).

9. Ludes-Meyers, J.H., et al. WWOX binds the specific proline-rich ligand PPXY: identification of candidate interacting proteins. Oncogene 23, 5049-5055 (2004). 10. Gaudio, E., et al. Physical Association with WWOX Suppresses c-Jun Transcriptional

Activity. Cancer Research 66, 11585-11589 (2006).

11. Chang, N.S. JNK1 Physically Interacts with WW Domain-containing Oxidoreductase (WOX1) and Inhibits WOX1-mediated Apoptosis. Journal of Biological Chemistry 278, 9195-9202 (2003).

12. Sze, C.I. Down-regulation of WW Domain-containing Oxidoreductase Induces Tau Phosphorylation in Vitro: A POTENTIAL ROLE IN ALZHEIMER'S DISEASE. Journal of

Biological Chemistry 279, 30498-30506 (2004).

13. Wang, H.Y., et al. WW domain-containing oxidoreductase promotes neuronal differentiation via negative regulation of glycogen synthase kinase 3β. Cell Death and

Differentiation 19, 1049-1059 (2011).

14. Donati, V., et al. WWOX expression in different histologic types and subtypes of non-small cell lung cancer. Clin Cancer Res 13, 884-891 (2007).

(18)

17

15. Aqeilan, R.I., et al. Loss of WWOX expression in gastric carcinoma. Clin Cancer Res 10, 3053-3058 (2004).

16. Kuroki, T., et al. The tumor suppressor gene WWOX at FRA16D is involved in pancreatic carcinogenesis. Clin Cancer Res 10, 2459-2465 (2004).

17. Guler, G., et al. The fragile genes FHIT and WWOX are inactivated coordinately in invasive breast carcinoma. Cancer 100, 1605-1614 (2004).

18. Kosla, K., et al. Molecular analysis of WWOX expression correlation with proliferation and apoptosis in glioblastoma multiforme. J Neurooncol 101, 207-213 (2011).

19. Guo, W., et al. Decreased expression of WWOX in the development of esophageal squamous cell carcinoma. Molecular Carcinogenesis 52, 265-274 (2013).

20. Winardi, W., et al. Reduced WWOX protein expression in human astrocytoma.

Neuropathology (2013).

21. Kopan, R. & Ilagan, M.X.G. The Canonical Notch Signaling Pathway: Unfolding the Activation Mechanism. Cell 137, 216-233 (2009).

22. Borggrefe, T. & Oswald, F. The Notch signaling pathway: Transcriptional regulation at Notch target genes. Cellular and Molecular Life Sciences 66, 1631-1646 (2009).

23. Radtke, F., et al. Deficient T cell fate specification in mice with an induced inactivation of NOTCH1. Immunity 10, 547-558 (1999).

24. Takeuchi, H. & Haltiwanger, R.S. Role of glycosylation of Notch in development.

Seminars in Cell & Developmental Biology 21, 638-645 (2010).

25. Lai, E.C. Protein degradation: four E3s for the notch pathway. Curr Biol 12, R74-78 (2002).

26. McGill, M.A. Mammalian Numb Proteins Promote NOTCH1 Receptor Ubiquitination and Degradation of the NOTCH1 Intracellular Domain. Journal of Biological Chemistry 278, 23196-23203 (2003).

27. Qiu, L. Recognition and Ubiquitination of Notch by ITCH, a Hect-type E3 Ubiquitin Ligase. Journal of Biological Chemistry 275, 35734-35737 (2000).

28. Gallagher, E. Activation of the E3 ubiquitin ligase ITCH through a phosphorylation-induced conformational change. Proceedings of the National

Academy of Sciences 103, 1717-1722 (2006).

29. Santini, S., et al. ATM kinase activity modulates ITCH E3-ubiquitin ligase activity.

Oncogene (2013).

30. Scialpi, F., et al. ITCH self-polyubiquitylation occurs through lysine-63 linkages.

Biochem Pharmacol 76, 1515-1521 (2008).

31. Mouchantaf, R., et al. The Ubiquitin Ligase ITCH Is Auto-ubiquitylated in Vivo and in Vitro but Is Protected from Degradation by Interacting with the Deubiquitylating Enzyme FAM/USP9X. Journal of Biological Chemistry 281, 38738-38747 (2006). 32. Abu-Odeh, M., et al. Characterizing WW domain interactions of tumor suppressor

(19)

18

WWOX reveals its association with multiprotein networks. J Biol Chem 289, 8865-8880 (2014).

33. Liu, Y.-C. The E3 ubiquitin ligase ITCH in T cell activation, differentiation, and tolerance. Seminars in Immunology 19, 197-205 (2007).

34. Xiao, N., et al. The E3 ubiquitin ligase ITCH is required for the differentiation of follicular helper T cells. Nat Immunol 15, 657-666 (2014).

35. Dupont, S., et al. FAM/USP9x, a deubiquitinating enzyme essential for TGFbeta signaling, controls Smad4 monoubiquitination. Cell 136, 123-135 (2009).

36. Lin, H.P., et al. Identification of an In Vivo MEK/WOX1 Complex as a Master SwITCH for Apoptosis in T Cell Leukemia. Genes Cancer 2, 550-562 (2011).

37. Hsu, L.J., et al. Transforming Growth Factor 1 Signaling via Interaction with Cell Surface Hyal-2 and Recruitment of WWOX/WOX1. Journal of Biological Chemistry 284, 16049-16059 (2009).

參考文獻

相關文件

• Enhancing Students’ Literacy Skills Development through Promoting Language across the Curriculum in the Junior Secondary English Classroom. • Enhancing the Learning and Teaching

To stimulate creativity, smart learning, critical thinking and logical reasoning in students, drama and arts play a pivotal role in the..

 The teacher explains to learners their duties: to present their ideas and findings on the questions on their role sheet, and lead the other group members to discuss the

S3: And the products were the lipase fatty acid…no, no, fatty acid and glycerol and the enzyme remained unchanged. S1: Our enzyme was amylase and our substrate

104 As shown in Figure 5, spin-restricted TAO- B3LYP and TAO-B3LYP-D3 (with a θ between 50 and 70 mhartree), TAO-PBE0 (with a θ between 60 and 80 mhartree), and TAO-BHHLYP (with a

* Anomaly is intrinsically QUANTUM effect Chiral anomaly is a fundamental aspect of QFT with chiral fermions.

Due to the important role played by σ -term in the analysis of second-order cone, before developing the sufficient conditions for the existence of local saddle points, we shall

Calligraphy plays an integral role in the development of Buddhism, including the transcription of scriptures or the distribution of Buddhist words and phrases in writing,