3-1. Chemicals and reagents
The goat polyclonal IgG, glyceraldehyde-3-phosphate-dehydrogenase antibody (V-18;
#sc20357), horseradish peroxidase (HRP) labeled secondary antibodies (donkey anti-goat IgG and goat anti-rabbit IgG; #sc2020 and #sc2004), and the rabbit polyclonal IgG, Ikaros
antibody (H-100; #sc13039), were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Anti-phospho-MEK1/2 (#9121) and anti-phospho-ERK1/2 (#4370)
antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA). Anti-ACE2 (#ab59351) and anti-AT1R (#ab9391) antibodies were purchased from Abcam (Cambridge, MA, USA). Alexa FluorTM 488-conjugated secondary antibody was obtained from
Invitrogen (#A11034; Eugene, OR, USA). Ang II (#H1705), Ang 1-7 (#H1715) and Ang 1-7 Mas receptor blocker A779 (#H2888) were purchased from Bachem (Merseyside, United Kingdom). The Ang II type-1 receptor (AT1R) antagonist, valsartan (Val; #1708762), was obtained from U.S. Pharmacopeia (Rockville, MD, USA), and the mitogen-activated protein kinase kinase (MEK) inhibitor (PD98059; #P215), and poly-L-lysine (0.01% solution; #P4832) were obtained from Sigma-Aldrich (St. Louis, MO, USA). A commercial medium (#2301) was obtained from (ScienCell Research Laboratories, SanDiego, CA, USA) for cell culture.
The luciferase reporter vectors, pGL3-Control Vector (#E1741) and pGL3-Basic Vector (which lacks a promoter; #E1751), and the Luciferase Assay System (#E1500) were purchased from Promega (Madison, WI, USA). The ACE2 overexpression lentivirus, TLC-hACE2, and ACE2 shRNA, TRCN-46697, were purchased from Vectorite Biomedica Inc. (Vectorite Biomedica, Taipei, Taiwan) and National RNAi Core Facility Platform
(Institute of Molecular Biology/Genomic Research Center, Academia Sinica, Taipei, Taiwan), respectively. The ACE2 inhibitor, DX600 and ACE2 fluorescence substrate, Mca-APK(Dnp), were purchased from Ana Spec (Fremont, CA, USA). All other reagents were obtained from
21
Sigma-Aldrich.
3-2. Cell culture and treatments
Primary human cardiac fibroblasts (HCFs; #6300; ScienCell Research Laboratories, San Diego, CA, USA) were cultured according to our published protocol (Lin et al., 2010). In brief, the HCFs were seeded in 100-mm Petri dishes (2 x 106 cells/dish) or 12-well plates (1 x 105 cells/well) that had been pre-coated with 0.01% poly-L-lysine (Sigma), and were cultured in Fibroblast Medium (#2301; ScienCell Research Laboratories), which included 2% fetal bovine serum (#0010; ScienCell Research Laboratories). The cells were incubated at 37°C in a humidified 5% CO2 atmosphere and the culture medium as exchanged with fresh medium every 2 days. The cells at passages 3 or 4 were used in all experiments and were placed in serum-free medium for 24 h prior to their use in further experiments.
3-3. Human ace2 constructs
Human genomic DNA was used as the template to obtain the upstream of ace2 via polymerase chain reaction (PCR) and DNA cloning. A 2.1-kb DNA fragment was obtained by PCR with primers based on the sequence for human ace2 (GenBank ID: AY217547). The sequences for the forward (Hace2-proF) and reverse (Hace2-proR) primers were
5′-AACCCTCGAGTTTCATTTAGGA-3′ and 5′-GAGCTAAGCTTCGTCCCCTGTG-3′, respectively; Xho I and Hind III sites are indicated by underlined nucleic acids in the forward and reverse primers, respectively.
The DNA fragment was then cloned into the pGL3-Basic luciferase reporter vector at the Xho I and Hind III sites to generate the –2069/+20 construct. A series of deleted DNA
22
fragments of the upstream region of ace2 were obtained by PCR using the plasmid DNA of the –2069/+20 construct as template with the specific recognition primer pairs (Table 3-1).
These deleted DNA fragments were also cloned into the pGL3-Basic vector at the Xho I and Hind III sites to generate a series of deletion constructs to test the promoter activity of ace2.
All of the constructs generated in this study were checked by restriction-mapping and sequencing to confirm their authenticity.
23
Table 3-1. Sequences of the primer pairs used for human ace2 promoter constructs Constructs Forward/Reverse primers (5’→3’) Promoter
region
Ampliconleng th (bp) (-2069/+20) F- AACCCTCGAGTTTCATTTAGGA
R- GAGCTAAGCTTCGTCCCCTGTG -2069 ~ +20 2089 (-1493/+20) F- GTTTCTCGAGATGCTCAAATGA
R- GAGCTAAGCTTCGTCCCCTGTG -1493 ~ +20 1513 (-1110/+20) F- TGACCTCGAGTGAGTTTTGAAT
R- GAGCTAAGCTTCGTCCCCTGTG -1110 ~ +20 1130 (-916/+20) F- TAAAGACTCGAGCAAAGTCATG
R- GAGCTAAGCTTCGTCCCCTGTG -916 ~ +20 936 (-786/+20) F- AACCCTCGAGTTTCATTTAGGA
R- GAGCTAAGCTTCGTCCCCTGTG -786~ +20 806 (-664/+20) F- GTTTCTCGAGATGCTCAAATGA
R- GAGCTAAGCTTCGTCCCCTGTG -664 ~ +20 684 (-627/+20) F- CTTGCAGTGACTCGAGATCG
R- GAGCTAAGCTTCGTCCCCTGTG -627 ~ +20 647 (-516/+20) F- TAAAGACTCGAGCAAAGTCATG
R- GAGCTAAGCTTCGTCCCCTGTG -516 ~ +20 536 (-481/+20) F- GTTGCCCAACTCGAGAGTTTC
R- GAGCTAAGCTTCGTCCCCTGTG -481~ +20 501
(-355/+20) F- AGTTCTAGACCTCGAGGGTCAC
R- GAGCTAAGCTTCGTCCCCTGTG -355~ +20 375 (-253/+20) F- AAGTGACTCGAGAGGTAAGG
R- GAGCTAAGCTTCGTCCCCTGTG -253~ +20 273 (-161/+20) F-CTGTCCTCGAGAGGATGAAC
R- GAGCTAAGCTTCGTCCCCTGTG -161 ~ +20 181 The recognition sequences of restriction enzymes, CTCGAG for Xho I in the forward primers
and AAGCTT for Hind III in the reverse primers, were shown in blue letters.
The promoter region was defined according to the position relative to the transcription start site (+1) in ACE2 mRNA sequence (GenBankno. AF_291820).
24
3-4. Transient transfection
Transient transfection was carried out according to our published protocol (Sun et al., 2005) with some minor modifications. Briefly, 2 x 105 HCFs were seeded in a 6-well culture plate one day before DNA transfection, and grown to approximately 70% confluence. The cells were washed with GIBCO Dulbecco’s phosphate-buffered saline (D-PBS) (Invitrogen, Carlsbad, CA, USA) to remove the remaining medium, then 400 μl of cell growth medium containing 4 μg of plasmid DNA mixed with 6 μl of TurboFect Transfection Reagent (Thermo Fisher Scientific, Waltham, MA, USA) was added gently. The DNA-transfected cells were then incubated at 37°C and under 5% CO2 in an incubator. After 24 h the cells were collected and lysed, and assayed for luciferase activity.
3-5. Lentivirus infection
The cloning of human ACE2 in lentiviral vector and production of lenti-hACE2 viral particles was according to Huentelman et al. with slight modifications (Huentelman et al., 2005). Homo sapiens angiotensin I converting enzyme (peptidyl-dipeptidase A) 2, mRNA (cDNA clone MGC:57146 IMAGE:5297380) was used as a template with primer pairs:
Spe-ACE2-F, 5’ - GAACCCACTGCTTACTGGCTTATCG - 3’; and Spe-ACE2-R, 5’ - GCTGGCAACTAGAAGGCACAGTCG - 3’ to carry out PCR amplification, the PCR production was cloned into pCR II-TOPO vector (Invitrogen, Carlsbad, CA) to obtain pACE2-TOPO. The complementary DNA encoding human ACE2 in pACE2-TOPO was subcloned into VBI-TLC vector using the SpeI sites to obtain TLC-ACE2 clone and produced lenti-hACE2 viral particles by Vectorite Biomedica Inc.
A pLKO.1-shRNA plasmid encoding a short hairpin RNA (shRNA) with sequences targeting human ACE2 was introduced into HEK293T cells with lentiviral packaging vectors
25
pMD.G and pCMV 8.91 by National RNAi Core Facility, Taiwan. The RNAi Consortium Numbers (TRCNs) and sequences of this shACE2 are 5’-GCCCTTATTTACCTGGCTGAA-3’
(TRCN0000046693); 5’-GCCCAAATGTATCCACTACAA-3’ (TRCN0000046694);
5’-GCAAAGTTGATGAATGCCTAT-3’ (TRCN0000046695);
5’-GCTGGACAGAAACTGTTCAAT-3’ (TRCN0000046696) and 5’-GCCGAAGACCTGTTCTATCAA-3’ (TRCN0000046697).
The ACE2 overexpression and knockdown experiments were performed as previously described, with optimization (Lee et al., 2008; Lin et al., 2012), HCFs were infected with the collected viruses 24 h in the presence of polybrene (8 μg/ml) at different MOI. After virus infection, cells were cultured in fresh growth medium for 24 h prior to their use in further experiments.
3-6. ACE2 knockout mice
ACE2 knockout mice were established by Gurley et al. (2006). The ace2 gene consists of 18 exons, and the exon 1 was targeted by homologous recombination. The exon containing nucleotides +1069 to +1299 encoding the active site of the ACE2 enzyme (including the Zn-binding signature motif, HEMGH) was replaced with a NEO/URA3 cassette to obtain the targeting vector which disrupted ace2 gene (Fig. 3-1). The targeting construct was
electroporated into MPI1-12D ES cells that had been derived from 129/SvEvfBRTac mice and then injected into C57BL/6H blastocysts to generate chimeras.
The male chimeras were crossed with C57BL/6J female mice to obtain male hemizygous mutants and female heterozygous and homozygous females mutants. The ACE2 KO mice utilized in this study was named B6;129S5-Ace2tm1Lex/Mmcd (MMRRC:31665) and obtain from Mutant Mouse Regional Resource Centers (MMRRC). The first generation of ACE2 KO
26
mice we obtained from MMRRC was bred in National laboratory animal center (NLAC) and distinguished between hemizygous, heterozygous and homozygous mutants by DNA
genotyping.
Fig. 3-1. Strategy for producing targeted disruption of the ace2 gene. Strategy for producing targeted disruption of the ace2 gene. In the targeting vector, the exon containing nucleotides +1069 to +1299 encoding the active site of the ACE2 enzyme (including the Zn-binding signature motif, HEMGH) was replaced with a NEO/URA3 cassette from YCpLac22 plasmid. [Gurley et al, 2006]
3-7. Protein extraction
The protein extraction was performed as our previous report (Sun et al, 2008). HCFs washed twice by D-PBS and lysis by PRO-PREPTM Protein Extraction Solution (iNtRON Biotechnology, Inc., Kyungki-Do, Korea) on ice for 10 min incubation. After incubation, the cell lysis solution was transfer to 1.5 ml eppendrof tube and sonicated 3 times for 5 s with interval 10 s on ice by ultrasonic processor (UP950A, Hansor, Taichung, Taiwan). Finally the protein extraction was isolated by 13,000 rpm centrifugation at 4°C for 5 min (Biofuge primo
27
R, Sorvall, Osterode, Germany). The total amount of protein in homogeneous extract was measured by the Bradford dye binding assay (Bio-Rad Laboratories, Hercules, CA, USA) and bovine serum albumin as the standard.
3-8. Luciferase reporter assay
The luciferase assay was performed according to the manufacturer’s instructions of Luciferase Assay System (Promega). The DNA-transfected HCFs were rinsed twice with D-PBS (Invitrogen) and lysed with luciferase cell culture lysis reagent included in the kit (CCLR; Promega). Cell lysates were centrifuged at 4°C for 2 min, and the supernatants were removed and mixed with the luciferase assay reagent (Promega). Luciferase activity was measured using a single tube luminometer (Lumat LB9507, Brethold Technologies, Bad Wildbad, Germany).
3-9. Nuclear extraction
Nuclear protein was extracted using a Nuclear Extraction kit (P/N 13938; Panomics, Redwood City, CA, USA) according to the manufacturer’s protocol. HCFs (1 x 107 cells) were collected and washed twice with D-PBS, then centrifuged at 500 x g for 5 min. The cells were resuspended in 1 ml of Working Reagent and the tubes were shaken at 200 rpm on ice for 10 min. The sample was centrifuged at 14,000 x g for 3 min at 4°C and the supernatant, consisting of cytoplasmic extract, was then removed. Forty μl of Buffer B Working Reagent was added to each pellet and then the sample was vortexed for 10 s. The mixture was incubated on ice for 60 min with gentle agitation by hand every 20 min. The nuclear extract was obtained as supernatant after centrifugation at 14,000 x g for 5 min at 4°C.
28
3-10. Electrophoretic mobility shift assay (EMSA)
EMSA was performed using an EMSA Gel Shift kit (P/N 13009; Panomics). The double-stranded oligonucleotides comprising the sequence –516/–481 of ace2 were labeled with biotin. Nuclear extracts of HCFs were incubated in the Reaction Buffer for 5 min, before adding the biotin-labeled DNA probe. After incubating for 30 min at 15°C, the mixture was separated by electrophoresis in a 6% polyacrylamide gel operating at 120 V, with 0.5 x TBE as the running buffer, for 1 h. In competition assays, 66-fold molar excess of unlabeled double-stranded oligonucleotide was added to the binding reaction 5 min before the labeled oligonucleotides. After electrophoresis, the DNA-protein complexes were transferred to positively charged nylon membranes (BrightStar®-Plus; Ambion, Austin, TX, USA) by semi-dry electroblotting (HoeferTM; Amersham Biosciences, Uppsala, Sweden) and immobilized using a Spectroline Spectrolinker UV Crosslinker (Spectronics Corporation, New York, NY, USA). The membrane was blocked in 1 x Blocking Buffer, incubated with streptavidin-horseradish peroxidase for 15 min and incubated in 1 x Detection Buffer for 5 min. Working Substrate Solution (200 μl Solution I, 200 μl Solution II, and 1.6 ml Solution III) was added to develop the results (All of the aforementioned solutions were included in the Panomics Gel Shift kit). The developed bands were visualized by exposing the membrane to X-Ray film (Super Rx Medical X-Ray Film; Fujifilm, Kanagawa, Japan).
3-11. RNA isolation and quantification
Total cellular RNA was extracted using TRIzol Plus RNA Purification System
(Invitrogen) following the manufacturer’s recommendations and procedures reported by Pan et al. (Pan et al., 2008). Briefly, 1 ml of TRIzol reagent was added to 5 x 106 cells. The
29
mixture was vigorously agitated for 30 s and incubated at room temperature for 5 min. Next, 200 μl chloroform was added and the solution was centrifuged at 12,000 x g for 15 min. The aqueous phase was transferred to a clean tube, precipitated with 500 μl of isopropyl alcohol, and centrifuged at 12,000 x g for 15 min. The resulting RNA pellet was washed with 1 ml of 75% cold ethanol (−20°C) and centrifuged at 12,000 x g at 4°C for 5 min. The pellet was dried at room temperature, resuspended in 25 μl of diethylpyrocarbonate (DEPC)-treated water, and stored at −80°C. RNA was quantified by measuring the absorbance at 260 nm and 280 nm, and was electrophoresed on a denaturing 1% agarose gel. The integrity and relative amounts of RNA were evaluated using ultraviolet visualization of ethidium bromide-stained RNA.
3-12. Reverse transcription-polymerase chain reaction (RT-PCR) and Real time polymerase chain reaction
The cDNA was synthesized using ReverTra Ace Set (Toyobo, Osaka, Japan). For cDNA synthesis, 3 μg of RNA was reverse transcribed in a total reaction volume of 20 μl with 1 x reverse transcription buffer, 0.5 mM of dNTPs, 2.5 μM of oligo-dT (TOYOBO, Osaka, Japan), 1U/μl of RNase inhibitor (TOYOBO), and 5 U/μl of ReverTra AceTM reverse transcriptase (TOYOBO). After incubation for 60 min at 42°C, the mixture was incubated for 5 min at 95
°C to denature the products. PCR primers for RT-PCR analysis were shown in Table 3-2. The PCR reactions contained 2 μl of cDNA, 2 μl of each primer (10 μM), 5 μl of 10 x PCR buffer, 2 μl of 10 mM of dNTPs, 1 μl of 5 U/μl Taq polymerase (Promega, Madison, WI, USA), and 36 μl distilled water in a total volume of 50 μl. Thermal cycler (MiniCyclerTM; MJ Research, Waltham, MA, USA) conditions were 5 min at 94°C followed by 18-36 cycles of denaturation (94°C for 30 s), annealing (55°C for 30 s), and elongation (72°C for 45 s). The resulting PCR products were visualized on 2% agarose gels stained with ethidium bromide. The stained
30
image was recorded by an image analyzer (Kodak DC290 Digital Camera SystemTM; Eastman Kodak, Rochester, NY, USA). Band intensity was quantified using densitometric analysis by ImageJTM. The relative mRNA expression of the determined gene was normalized as a ratio to GAPDH expression.
Semi-quantitative real-time (RT) PCR was performed using SYBR Green Realtime PCR Master Mix Plus (Toyobo) with 20 pM of each primer and 5 μl cDNA, in a total volume of 25 μl and monitored using Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s recommendations. Specificity of the
real-time PCR was confirmed by routine agarose gel electrophoresis and melting-curve analysis, according to a published method (Livak and Schmittgen, 2001). Expression of the GAPDH (GenBank ID: NM_002046.3) gene was used as an internal standard. The primers for ACE2 (GenBank ID: AF291820 and NM002046.3), ADAM17 (GenBank ID:
NM_003183.4) and MAPK1 (GenBank ID: NM_002745.4) were: ACE2 forward, hACE2-F, 5′-CATTGGAGCAAGTGTTGGATCTT-3′, and, ACE2 reverse, hACE2-R,
5′-GAGCTAATGCATGCCATTCTCA-3′; ADAM17 forward, hADAM17-F,
5′-CTTTCAGCATTCTTGTCCATTGTGTG-3′, and, ADAM17 reverse, hADAM17-R, 5′-GCTCAGCATTTCGACGTTACTGGG-3′; MAPK1 forward, hMAPK1-F,
5′-CAAGTCCATTGATATTTGGTCTGTAGGC-3′, and, MAPK1 reverse, hMAPK1-R, 5′-CAAGAATACCCAAAATGAGGTTCAGC-3′; GAPDH forward, hGAPDH-F, 5′-ACAGTCAGCCGCATCTTCTT-3′, and, GAPDH reverse, hGAPDH-R, 5′-GTTAAAAGCAGCCCTGGTGA-3′.
31
Table 3-2. Information of the PCR primers and condition performed in this study
Gene GenBank
accession no.
Sequence of forward primer (5’→3’)
Sequence of reverse primer (5’→3’) PCR condition (cycle number) Size of PCR product (bp)
ACE2 NM021804 ACGACAATGAAATGTACCTGTTCCG
TCCGATCTCTGATCCCAGTGAAG 94°C, 30 s → 55°C, 30 s → 72°C, 45 s (36 cycle) 399
AT1R NM004835 CCAAAAGCCAAATCCCACTCAAACC
TCTGACATTGTTCTTCGAGCAGCC 94°C, 30 s → 55°C, 30 s → 72°C, 45 s (26 cycle) 362
GAPDH AF261085 GGTGATGCTGGTGCTGAGTA
TTCAGCTCTGGGATGACCTT 94°C, 30 s → 55°C, 30 s → 72°C, 45 s (18 cycle) 413 ACE2, angiotensin converting enzyme II; AT1R, angiotensin II type 1 receptor;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
32
3-13. Immunocytofluorescence assay
HCF cells were grown overnight on 0.01% poly-L-lysine-coated coverslips (1.2 mm diameter) and treated with Ang II or Ang 1-7 for 24 h. The cells were washed in PBS, fixed with 4% formaldehyde for 15 min, and permeabilized with 0.5% saponin (Sigma-Aldrich) for 15 min. Non-specific binding sites were blocked with 1% BSA for 30 min. The cells were then incubated with anti-ACE2 (1:100 dilu-tion) at 37°C for 1 h, followed by Alexa FluorTM 488-conjugated secondary antibody (1:200 dilution) at 37°C for 1 h in a humidified chamber.
The cells were also counterstained with DAPI (1:10,000 dilution) at 37°C for 5 min in a humidified chamber. After washing in PBS, the coverslips were mounted in DakoCytomation Fluorescent Mounting Medium (DakoCytomation, Denmark A/S, Denmark), and fluorescent signals were observed using the FluoViewTM FV500 Confocal Microscope (Olympus, Tokyo, Japan).
3-14. Western blotting
The western blot for ACE2, ERK1/2 and GAPDH was carried out as our previous report (Kuan et al., 2011). Aliquots containing 30 μg protein were electrophoresed on 8%
SDS-PAGE gels and then transferred electrophoretically to polyvinylidene fluoride
membranes (Immobilon-PTM; Millipore, Bedford, MA, USA) by semi-dry electro-blotting (HoeferTM). Briefly, nonspecific binding sites were blocked by incubating the membranes in 5% non-fat milk in Tris-buffered saline. Primary antibodies against proteins were diluted 1:1,000 for ACE2, ERK1/2 and for GAPDH. The secondary antibodies were applied using a dilution of 1:2,000. Substrates were visualized using enhanced chemiluminescence detection (Western Lightning Plus-ECL, Enhanced Chemiluminescence Substrate; PerkinElmer, Boston, MA, USA) and exposing the membranes to X-ray film (Fujifilm). The bands on the film were
33
detected at the anticipated location, based on size. Band intensity was quantified by
densitometric analysis using Scion Image software (Scion, Frederick, MD, USA). The amount of ACE2 and ERK1/2 were expressed relative to the amount of GAPDH (as the internal standard) in each sample.
3-15. ACE2 activity assay
ACE2 activities was assayed with the fluorogenic substrates Mca-APK-Dnp (AnaSpec, San Jose, CA, USA), according to Vickers et al. with slight modifications (Vickers et al., 2002). The assay was performed in a micro-quartz cuvette with 20 μl cell protein, 50 μM fluorogenic substrate and protease inhibitor cocktail (1:200; Sigma-Aldrich) in a final volume of 100 μl in ACE2 assay buffer (75 mM Tris-HCl, 1 M NaCl, 5 mM ZnCl2, pH 6.5). The reaction was followed kinetically for 1 hour using a fluorescence reader at an excitation wavelength of 330 nm and an emission wavelength of 390 nm. All samples were presence of 1 μM captopril (Sigma-Aldrich), a specific ACE inhibitor, to avoid the effect of ACE in ACE2 activity assay. Parallel samples were incubated with the above-mentioned reaction mixture in the presence of 1 μM DX600 (AnaSpec), a specific ACE2 inhibitor for
determining specific ACE2 activity.
3-16. Gelatin zymography
The MMP-2 and -9 activities were detected by gelatin zymography utilized
gelatin-containing gels as our previous report (Chang et al., 2011). Briefly, 30 μg of cell homogenate was mixed with 6x zymography sample buffer (0.125 M Tris-HCl, pH = 6.8, 50% [v/v] glycerol, 4% [w/v] SDS, 0.005% bromophenol blue) and incubated for 10 min at room temperature, and then loaded into each lane of an 8% sodium dodecyl sulfate
34
polyacrylamide gel (SDS-PAGE) containing 1 mg/ml gelatin (Sigma). Following
electrophoresis, the gel was washed twice for 30 min in zymogram renaturing buffer (2.5%
Triton X-100) with gentle agitation at room temperature to remove SDS, then incubated overnight at 37°C in reaction buffer (50 mM Tris-HCl, pH 7.4, 200 mM NaCl, 5 mM CaCl2 and 0.02% Brij35). After Coomassie brilliant blue staining, gelatinase activities were identified as clear zones against a blue background.
3-17. Statistics
All values were expressed as mean ± standard deviation (SD). Data were compared with one-way analysis of variance (ANOVA) test to evaluate differences among multiple groups.
The Student’s t-test was used for comparisons involving two groups. All results are expressed as the mean ± standard deviation (SD). Differences were considered statistically significant when p < 0.05. Statistical analysis was performed using statistical soft-ware (SPSS, Chicago, IL, USA).
35