Results - 血管收縮素對心臟細胞的第二型血管收縮素轉化酶表現調節與第二型基質金屬蛋白酶表現之影響

4-1. Ang II up-regulates ACE2 expression in HCF cells via the AT1R and the ERK-MAPK pathway

In HCF cells treated with Ang II, the amount of ACE2 mRNA was markedly increased (p

< 0.01) in a concentration-dependent manner (Fig. 4-1A). When the HCF cells treated with 1 μM of Ang II, the relative ACE2 mRNA expression was approximately three fold higher than that of control (p < 0.01). Moreover, the increase in ACE2 mRNA was dependent on the duration of treatment (Fig. 4-1B).

The effect of Ang II on ACE2 expression in HCF cells was further demonstrated by blocking the downstream signaling pathway of Ang II by AT1R and ERK–MAPK cascades.

HCF cells were treated with the AT1R inhibitor Val (1 μM) or MEK inhibitor PD98059 (10 μM) prior to treatment with Ang II. The cells pretreated with Val were used to confirm the receptor-specific effect of Ang II. The result shows that ACE2 mRNA increased by an AT1R-dependent effect that was abolished by Val pretreatment (Fig. 4-2A). Ang II-induced ACE2 expression was also abolished when HCF cells were treated with PD98059 prior to treatment with Ang II (Fig. 4-2A). The expression of signaling molecules in the ERK–MAPK pathway were explored by western blot (Fig. 4-2B). Following Ang II treatment in HCF cells, the results confirmed the up-regulation of ACE2, p-MEK1/2, and p-ERK1/2 protein

expression (Fig. 4-2C, D, E). When HCF cells were pretreated with AT1R inhibitor Val or MEK inhibitor PD98059, the increases in ACE2, p-MEK1/2, and p-ERK1/2 expression were abolished (Fig. 4-2C, D, E). Control experiments confirmed that Val or PD98059 alone did not alter cardiac ACE2 mRNA or protein expression (data not shown).

ACE2 distribution and expression in Ang II-treated HCF cells were visualized and analyzed using immunocytofluorescence (Fig. 4-3A). ACE2 expression was significantly increased by Ang II treatment and was restored to the untreated control value by pretreatment

with the AT1R inhibitor Val (Fig. 4-3B). These immunocytofluorescent results were consistent with the changes in ACE2 expression detected by RT-PCR and western blotting (Fig. 4-2).

Fig. 4-1. Expression of ACE2 mRNA in Ang II-treated human cardiac fibroblast (HCF) cells. Treatment with Ang II produced a dose-dependent (A) and time-dependent (B) effect on ACE2 mRNA expression. ACE2 expression was normalized against GAPDH, and relative mRNA expression of ACE2 was calculated using the control group as 100%. Values are expressed as mean ± SD (n = 3). *, p < 0.05 vs. control; **, p < 0.01 vs. control.

Fig. 4-2. Role of the ERK–MAPK signaling pathway of AT1R in Ang II-mediated ACE2 up-regulation. The effect of Ang II on ACE2 mRNA expression was determined in HCF cells pretreated with the AT1R blocker Val and the MEK1/2 inhibitor PD98059 to confirm the ACE2 expression being associated with Ang II treatment (A). The protein expression of phosphorylated MEK1/2 (p-MEK1/2), phosphorylated ERK1/2 (p-ERK1/2) and ACE2 was examined by western blotting (B). p-MEK1/2 (C), p-ERK1/2 (D) and ACE2 (E) expression was normalized using GAPDH expression, and the relative expression of p-MEK1/2,

p-ERK1/2 and ACE2 was calculated using the control group as 100%. Values are expressed as mean ± SD (n = 3). *, p < 0.05 vs. control; **, p < 0.01 vs. control; †, p < 0.05 vs. Ang II treatment; ‡, p < 0.01 vs. Ang II treatment.

Fig. 4-3. Distribution and expression of ACE2 in Ang II-treated HCF cells. HCF cells grown on a coverslip were treated with Ang II with and without prior treatment with the AT1R inhibitor Val for 24 h. Treated cells were washed, fixed, and immunostained for ACE2 (green), and nuclei were counterstained with DAPI (blue). The localization of ACE2 protein was visualized by confocal microscopy (A) and the relative ACE2 fluorescence intensity was calculated using the control group as 100% (B). Values are expressed as mean ± SD (n = 3).

**, p < 0.01 vs. control; ‡, p < 0.01 vs. Ang II treatment. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

4-2. Ang 1-7 up-regulates ACE2 expression via the Mas receptor

The effect of Ang 1-7 on cardiac ACE2 expression was also evaluated in HCF cells. Ang 1-7 treatment (1 μM) significantly increased ACE2 mRNA and protein expression (Fig. 4-4A, B). To test the involvement of the Ang 1-7 Mas receptor, HCF cells were treated with the Mas receptor blocker A779 (1 μM) prior to Ang 1-7 treatment. The cells pretreated with A779 were used to confirm the receptor-specific effect of Ang 1-7. The up-regulation of ACE2 mRNA and protein expression by Ang 1-7 was depressed by A779 pretreatment. These results suggest that Ang 1-7 up-regulation of ACE2 expression is mediated via the Mas receptor. Treatment of HCF cells with A779 alone did not change ACE2 mRNA or protein levels (data not shown).

The effects of Ang 1-7 on ACE2 expression were confirmed by immunocytofluorescence (Fig.

4-5A). ACE2 protein was markedly increased when HCF cells were treated with Ang 1-7, and cells pretreated with A779 showed significantly reduced ACE2 expression (Fig. 4-5B).

The regulation of p-ERK1/2 protein expression was analyzed in HCF cells treated with Ang 1-7 (Fig. 4-6A). Ang 1-7 caused an up-regulation of p-ERK1/2 that was abolished by the inhibitors A779 and PD98059 pretreatment. However, pretreatment with the AT1R blocker did not influence the Ang 1-7-mediated effect on ACE2 expression (Fig. 4-6B).

Fig. 4-4. Expression of ACE2 in HCF cells following Ang 1-7 treatment. The effect of Ang 1-7 on ACE2 mRNA and protein expression was examined by RT-PCR (A) and western blotting (B), respectively. Up-regulation of ACE2 was further confirmed using cells pretreated with the Ang 1-7 Mas receptor blocker A779. ACE2 expression was normalized using

GAPDH expression, and the relative expression of ACE2 mRNA was calculated using the control group as 100%. Values are expressed as mean ± SD (n = 3). *, p < 0.05 vs. control; **, p < 0.01 vs. control; †, p < 0.05 vs. Ang 1-7 treatment; ‡, p < 0.01 vs. Ang 1-7 treatment.

Fig. 4-5. Distribution and expression of ACE2 in HCF cells treated with Ang 1-7. HCF cells grown on a coverslip were treated with Ang 1-7 with or without prior treatment with the Mas receptor blocker A779 for 24 h. Treated cells were washed, fixed, and immunostained for ACE2 (green), and nuclei were counterstained with DAPI (blue). The localization of the ACE2 protein was visualized by confocal microscopy (A) and the relative ACE2 fluorescence intensity was calculated using the control group as 100% (B). Values are expressed as mean ± SD (n = 3). *, p < 0.05 vs. control; †, p < 0.05 vs. Ang 1-7 treatment. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the

article.)

Fig. 4-6. Effect of blocking the AT1R-mediated signaling pathway on Ang 1-7-affected p-ERK1/2 and ACE2 protein expression in HCF cells. (A) Relative p-ERK1/2 protein expression was determined by western blotting in HCF cells treated with Ang 1-7 alone or following pretreatment with the Ang 1-7 Mas receptor blocker A779 or the MEK1/2 inhibitor PD98059. Expression of p-ERK1/2 was normalized using GAPDH expression, and the relative expression of p-ERK1/2 was calculated using the control group as 100%. (B) HCF cells were treated with Ang 1-7 with or without prior treatment with the AT1R blocker Val for 24 h. The extracted protein of the cells was analyzed by western blotting. ACE2 expression was normalized using GAPDH expression, and the relative expression of ACE2 was

calculated using the control group as 100%. Values are expressed as mean ± SD (n = 3). *, p <

0.05 vs. control; †, p < 0.05 vs. Ang 1-7 treatment.

4-3. Expression levels of deletion constructs in the ace2 promoter

To examine the transcriptional activity of ace2, a 2.1 kb fragment of the upstream region of human ace2 was cloned into the upstream of the luciferase coding gene in the pGL3-Basic vector to generate the –2069/+20 construct. This construct was transiently transfected into HCFs, and the resulting expression of luciferase was monitored by measuring luciferase activity. Luciferase activities from HCFs transfected with the pGL3-Basic vector were compared with those transfected with the pGL3-Control vector, which was used to monitor DNA transfection efficiency. Transfection of the HCFs with the –2069/+20 construct showed a significant increase (8.9 ± 2.0 fold increase) in luciferase expression compared to the baseline levels for pGL3-Basic vector transfection.

Based on these results, we obtained eleven serially deleted constructs (starting at –1493, –1110, –916, –786, –664, –627, –516, –481, –355, –253, and –161) using the designed primer pairs (Table 3-1) and the plasmid DNA of the –2069/+20 construct as the template by PCR (Fig. 4-7A). These serial deletion fragments of the ace2 promoter were used to drive the downstream gene expression of the reporter gene, luciferase, in order to determine which region contained critical regulatory activity of ace2 expression. The results showed luciferase expression of the serial deletion constructs was essentially unchanged from position –2069 to position –627 within the ace2 promoter. Deletion of the construct to position –516, however, resulted in a significant increase in promoter activity; a further 5′ deletion construct to position –481 resulted in markedly decreased promoter activity (Fig. 4-7B). These results indicate the presence of a significantly activating domain between position –516 and –481.

Fig. 4-7. Composition and promoter activity of the constructs on the expression of the reporter enzyme, luciferase, in HCFs. (A) The constructs were comprised of serially deleted portions of the upstream region of ace2, fused to firefly luciferase cDNA in the vector

pGL3-Basic. The position of the promoter fragments relative to transcription start site (+1) is indicated. (B) The constructs were transfected into HCFs. Cells were lysed 24 h later and luciferase activities were measured. Relative luciferase activity of each construct (i.e., compared to that of the control, pGL3-Basic vector) is shown. All values are expressed as the mean ± SD from three independent experiments; ** indicates p < 0.01 compared to the – 2069/+20 construct.

4-4. Identification of the regulatory domain within the ace2 promoter To further identify the regulatory sequences within the –516/–481 region that enhance ace2 expression, two constructs were created from the –2069/+20 construct: one in which the

–516/–481 domain was internally deleted and the other in which it was reversed (Fig. 4-8A).

The –516/–481 deleted construct (–2069~–516/–481~+20) and the reversed construct (–

2069~–481/–516~+20) were then transiently transfected into HCFs and the promoter activity

of ace2 was assessed. The results showed both the deleted and the reversed sequence domain significantly reduced downstream luciferase expression (Fig. 4-8B).

Fig. 4-8. Analyses of the promoter activity of the deleted and reversed domain within the upstream region of ace2. (A) Schematic representation of the deleted (–2069~–516/–481

~+20) and reversed (–2069~-481/–516~+20) domain in the –2069/+20 construct. (B) The constructs were transfected into HCFs. Cells were lysed 24 h later and luciferase activities were measured. Relative luciferase activity of each construct (i.e., compared to that of the control –2069/+20 construct) is shown. All values are expressed as the mean ± SD from three independent experiments; ** indicates p < 0.01 compared to the –2069/+20 construct.

4-5. Identification of the regulatory element for ace2

We showed the –516/–481 domain of ace2 contains major regulatory sequences, but the main regulatory element needed to be clarified. The nucleotide sequence of –516/–481 region was therefore analyzed using the database TFSEARCH (Vares et al., 2011) to find possible transcription factor binding elements. The results show a potential Ikaros binding site 5′-ATTTGGA–3′ with 95% calculated score. PCR site-directed mutagenesis was used to generate seven mutant sequences of ATTTGGA to further identify the regulatory element of ace2 (Fig. 4-9A). The designed primer pairs used to PCR amplify and construct a series of

site-directed mutant constructs are shown in Table 4-1. Compared to the original –516/+20 construct, luciferase expression was significantly decreased in all mutant constructs (Fig.

4-9B). This indicates that the sequence ATTTGGA is indeed a main regulatory element in the

–516/–481 domain of the ace2 promoter.

To determine whether cellular regulatory factors are produced in HCFs that are capable of interacting with the –516/–481 domain, we used the synthetic and biotin-labeled

double-stranded oligonucleotides of the –516/–481 sequences to react with the nuclear extracts prepared from HCFs by EMSA. As shown in Fig. 4-10A, one distinctive DNA-protein complex was observed when the –516/–481 double-stranded DNA was

incubated with nuclear extracts of HCFs. This DNA-protein complex is specific to the –516/–

481 sequences because it was readily eliminated by an excess of unlabeled competitor and was partially abolished when an Ikaros antibody was used to pretreat the nuclear extracts of HCFs.

For further confirmation that the sequence ATTTGGA within the –516/–481 domain of the ace2 promoter was a significant binding element, seven mutant double-stranded

oligonucleotides, M1 through M7, were synthesized and used for EMSA (Fig. 4-10B). The results show unlike the –516/–481 double-stranded oligonucleotides, the M1 through M7 double-stranded oligonucleotides could not form a DNA-protein complex with the nuclear extracts of HCFs (Fig. 4-10B). This result is consistent with the other results from the promoter activity.

Table 4-1. Sequences of the primer pairs used for generating the mutant constructs of -516/+20 construct

Constructs Forward/Reverse primers (5’→3’)

M1 (-516/+20) F- TAAAGACTCGAGCAAAGTCATGTACTCGAAAGG R- GAGCTAAGCTTCGTCCCCTGTG

M2 (-516/+20) F-TAAAGACTCGAGCAAAGTCATGTACTCGGAAGG R- GAGCTAAGCTTCGTCCCCTGTG

M3 (-516/+20) F- TAAAGACTCGAGCAAAGTCATGTATTCGAAAGG R- GAGCTAAGCTTCGTCCCCTGTG

M4 (-516/+20) F- TAAAGACTCGAGCAAAGTCATGTACTTGAAAGG R- GAGCTAAGCTTCGTCCCCTGTG

M5 (-516/+20) F-TAAAGACTCGAGCAAAGTCATGTACTTGGAAGG R- GAGCTAAGCTTCGTCCCCTGTG

M6 (-516/+20) F-TAAAGACTCGAGCAAAGTCATGTATTTGAAAGG R- GAGCTAAGCTTCGTCCCCTGTG

M7 (-516/+20) F-TAAAGACTCGAGCAAAGTCATGTATTCGGAAGG R- GAGCTAAGCTTCGTCCCCTGTG

The method of PCR site-directed mutagenesis was used to generate seven mutant

sequences of 5’-ATTTGGA-3’ to clarify the regulatory element of ace2. According to the 5’-ATTTGGA-3 sequences, the constructs with mutant sequences were made by PCR site-directed mutagenesis and mutant sequences were shown in underline and red.

The recognition sequences of restriction enzymes, CTCGAG for Xho I in the forward primers and AAGCTT for Hind III in the reverse primers were shown in blue letters.

Fig. 4-9. Identification of the regulatory element within the –516/–481 domain. The full sequence, –516/–481, was analyzed for putative binding elements using TFSEARCH. The sequence, ATTTGGA, was identified as a potential binding element. (A) Using PCR site-directed mutagenesis at the ATTTGGA site, seven mutant constructs (M1 to M7) were generated. The location of the mutations is indicated in red typeface. The relative element binding score was calculated according to its TFSEARCH score, relative to a score of 100 for the full sequence, –516/–418. (B) The constructs were transfected into HCFs. Cells were lysed 24 h later and luciferase activities were measured. Relative luciferase activity of each construct (i.e., compared to that of the control –516/+20 construct) is shown. All values are expressed as the mean ± SD from three independent experiments.

Fig. 4-10. Interaction of nuclear extracts from HCFs with (–516/–481) and mutant (M1 - M7) oligonucleotides by EMSA. Binding complexes were separated using 6%

non-denaturing PAGE. (A) Unlabeled and labeled (biotinylated) double-stranded

oligonucleotides, –516/–481, were mixed with nuclear extracts from HCFs. A 66 x molar excess of the unlabeled oligonucleotide, –516/–481, was used for competitive binding. (B) Nuclear extracts from HCFs were mixed with labeled oligonucleotides, (–516/–481) and labeled mutant oligonucleotides (M1 through M7). “Probe” indicates labeled oligonucleotides (–516/–481) alone, i.e., in the absence of nuclear extract.

4-6. Effect of Ang II on the transcriptional activation of ace2

The effect of Ang II on the transcriptional activation of ace2 were investigated by transient transfection of HCFs with a –516/+20 construct, and a –481/–516/+20 construct (in which the sequence of the –516/–418 region was reversed) and treated with 0, 0.1, 1 and 10 μM of Ang II. The results show the relative luciferase expression from cells transfected with the –516/+20 construct was significantly increased by Ang II stimulation in a dose-dependent manner (Fig. 4-11A), and this increased luciferase expression could be abolished by

pretreatment with Val (AT1R inhibitor) or PD98059 (MEK inhibitor) (Fig. 4-11B). In contrast, increased luciferase expression was not observed with Ang II treatment of HCFs transfected

with the –481/–516/+20 construct (Fig. 4-11A). These results indicate that Ang II can up-regulate the transcription of ace2.

To examine the expression regulation of endogenous ACE2 in HCFs, the expression of ace2 and its protein production with and without treatment with 1 μM of Ang II was

investigated. The results showed upon Ang II stimulation, the relative levels of expressed ACE2 mRNA (Fig. 4-12A) and protein (Fig. 4-12B) increased by 2.97 and 1.80 fold, respectively.

Fig. 4-11. The effects of Ang II stimulation on ACE2 expression in HCFs. (A) HCFs were transfected with the (–516/+20) and reversed (–481/–516/+20) constructs, then treated with various concentrations of Ang II. Cells were lysed 24h later and luciferase activity was measured. Relative luciferase activity (i.e., compared to luciferase activity in the absence of added Ang II) for each sample is shown. All values are expressed as the mean ± SD from three independent experiments; * and ** indicate p < 0.05 and p < 0.01, respectively, compared to the group (control) with no added Ang II. (B) The signaling pathway of Ang II-induced ACE2 expression in HCFs was also investigated. HCFs transfected with the – 516/+20 construct were pre-treated with 1 μg/ml of valsartan (AT1R inhibitor) or PD98059 (MEK inhibitor) for 1 h, then treated with 1 μg/ml of Ang II. The cells were lysed 24 h after addition of Ang II and luciferase activity was measured. Relative luciferase activity (i.e., compared to luciferase activity in the absence of added Ang II) for each sample is shown. All values are expressed as the mean ± SD from three independent experiments; ** indicates p <

0.01 compared to the group without added Ang II; † indicates p < 0.01 compared to the group with only Ang II added.

Fig. 4-12. The effect of Ang II stimulation on endogenous ACE2 expression in HCFs.

HCFs were treated with 1 μM of Ang II for 24 h, and the cells were then analyzed for ACE2 mRNA using semi-quantitative RT-PCR (A), and for protein, using western blotting (B).

Relative expression of ACE2 mRNA and protein (i.e., compared to expression without added Ang II) for each sample is shown. All values are expressed as the mean ± SD from three independent experiments; ** indicates p < 0.01 compared to the group without added Ang II.

4-7. Effect of pro-inflammatory factors on the transcriptional activation of ace2

We examined the effects of the pro-inflammatory cytokines, transforming growth factor-β1 (TGF-β1) and tumor necrosis factor-α (TNF-α) on the transcriptional activity of ace2 in HCFs. The –516/+20 construct was transiently transfected into HCFs and the cells

were treated with different dosages of TGF-β1 or TNF-α (0, 1, 5 and 10 ng/ml). Neither TGF-β1 (Fig. 4-13A) nor TNF-α (Fig. 4-13B) significantly affected luciferase expression:

compared to expression levels in the absence of added pro-inflammatory factors, at the highest concentration of added cytokine (10 ng/ml), ACE2 mRNA expression and protein

expression decreased to 88% and 95%, respectively, with TGF-β1 treatment, and increased to 121% and 113%, respectively, with TNF-α treatment. These variations were not statistically significant.

Fig. 4-13. The promoter activity of ace2 in HCFs treated with pro-inflammatory factors.

HCFs were transfected with the –516/+20 construct, and then treated with various

concentrations of TGF-β1 (A), and TNF-α (B). The transfected HCFs were lysed 24 h after treatment and the luciferase activity was measured. Relative luciferase activity for each sample (i.e., compared to luciferase activity without added TGF-β1 or TNF-α) is shown. All values are expressed as the mean ± SD from three independent experiments.

4-8. The ACE2 activity of HCFs treated with Ang II and Ang 1-7

Previous results demonstrated that Ang II and Ang 1-7 were induced ACE2 expression of mRNA and protein in HCFs, respectively. This study also utilized fluorogenic substrates Mca-APK-Dnp to evidence the ACE2 activity of HCFs treated with Ang II and Ang 1-7. The results revealed that the dose dependent induction of ACE2 activity in HCFs by Ang II, the ACE2 activity of HCFs treated with 0.1 and 1 µM Ang II were induced 1.1 and 2.4 fold compared to non-treated HCFs (Fig. 4-14A). The HCFs treated with 1 µM Ang 1-7 also appeared the induced ACE2 activity, but there was no significant difference (Fig. 4-14B).

Fig. 4-14. The ACE2 activity of HCFs treated with Ang II and Ang 1-7. HCFs treated 0, 0.1 and 1 μM Ang II and Ang 1-7, respectively. The cell lysis of Ang II (A) and Ang 1-7 (B) treated HCFs was isolated to carry out the ACE2 activity assay, respectively. ACE2 activity was the ability to cleave the fluorescent substrate at 37°C for 1 hour with a specific ACE2 inhibitor. All values are expressed as the mean ± SD from three independent experiments; **

indicate p < 0.01 compared to the non-treated HCFs.

4-9. The ACE2 and MMP-2 activity of HCFs infected with ACE2 lentivirus In this study, the association between ACE2 and MMP-2 was investigated in HCFs, especially ACE2 overexpression. ACE2 lentivirus, TLC-ACE2, was utilized to infect HCFs to create the ACE2 overexpressed HCFs, HCFs/ACE2. HCFs infected with TLC-ACE2 at different multiplicity of infection (MOI) and estimate the ACE2 and MMP-2 activity. The result showed ACE2 activity of HCFs/ACE2 was enhanced with the MOI. The ACE2 activity of HCFs/ACE2 infected at 1, 5, 10 and 20 MOI was 20, 78, 151 and 292-fold compared to

在文檔中血管收縮素對心臟細胞的第二型血管收縮素轉化酶表現調節與第二型基質金屬蛋白酶表現之影響 (頁 49-85)