3-2.1 Isolation and Culture of Chondrocytes 3-2.1.1 Specimen Isolation
The articular cartilage used in the experiment was obtained aseptically from adult porcine knee joints which had no macroscopic signs of osteoarthritis. Within 4 h of slaughter, the integral part of adult porcine knee joint was cleaned by 75% ethanol (E7148, Sigma Co., St. Louis, MO, U.S.A.), iodine solution (35089, Sigma Co.) and phosphate-buffered saline (PBS, pH 7.2) in sequence. After trimming the undesired connective tissue with sterile scalpels, the cartilage tissue was sliced into 5mm×5mm×0.5mm pieces, and the action of slicing was avoided cutting deep into the subchondral bone [146]. Then the thin slices were washed three times in sterile PBS and were further sterilized by soaking in 5-fold antibiotics-added (50 units/mL penicillin, 50 μg/mL streptomycin, 100 μg/mL neomycin, P4083, Sigma Co.) PBS for 15 min.
3-2.1.2 Matrix Digestion
Enzymatic digestion of articular cartilage has been a feasible and useful technique for isolating chondrocytes based on degrading the extracellular matrix between cells [147, 148]. In this experiment, the thin slices of cartilage were subjected to 0.2% collagenase (C0130, Sigma Co.) digestion in order to degrade the native collagen between animal cells and get the sufficient amount of cells after digestion [149-151]. The collagenase was dissolved in DMEM (31600-026, Gibco Invitrogen Co., Burlington, Ontario, Canada) which was supplemented with 3.7 mg/ml sodium bicarbonate (S5761, Sigma Co.), 50 μg/ml ascorbic acid (A5960, Sigma Co.) [152], 50 units/50 μg/100 μg/mL penicillin/ streptomycin/ neomycin (P4083, Sigma Co.),
and 10% fetal bovine serum (100-106 Gemini Bio-Products, Woodland, CA) and filter-sterilized by passing through a 0.22 μm filter (SCGPT05RE, Millipore Co., Bedford, MA, U.S.A.). After incubating the sliced cartilage in a humidified incubator at 37°C, 5% carbon dioxide for 16 hours, the resulting chondrocytes/collagenase solution suspension was collected and centrifuged at 1500 rpm for 5 min (KUBOTA 5101, Canada). The supernatant was discarded and the pelleted cells were gently washed once in PBS to neutralize remaining collagenase. Cells were centrifuged at 1500 rpm for 5 min again and resuspended in 10 ml of the same medium mentioned above. Cell number and viability was assessed by hemocytometer and trypan blue dye (T8154, Sigma Co.) exclusion.
3-2.1.3 Cell Culture
The chondrocytes were plated out to sterile 10cm tissue culture petri dishes (Cellstar, Greiner Bio-One, Longwood, Florida, United States) at 1×106 cells per dish as monolayer culture in the same DMEM mentioned above and maintained in a humidified incubator at 37°C, with 5% carbon dioxide [153]. Usually, the healthy chondrocytes would begin to adhere within the first two days, so in the 3rd day the culture medium was refreshed to discard the dead cells [154]. Moreover, often in the 7th day the cultured chondrocytes reached confluence and were detached by 0.05%
trypsin with EDTA•4Na (15400-054, Invitrogen Co.) for passage. Because most of the in vitro cultured chondrocytes lost their phenotype after the third passage [155], the cells used in the experiment were all in the beginning of the second passage.
3-2.2 Preparation of Modified Tri-copolymer Scaffolds
Modified tri-co-polymer scaffolds were made up by gelatin (G2500, Sigma Co., St. Louise, USA), chondroitin-6-sulfate (C6S) (C4384, Sigma Co.), hyaluronic acid (H7630, Sigma Co.), and a newly added component: chondroitin-4-sulfate (C4S) (27042, Fluka, St. Gallen, Switzerland) in order to mimic the real extracellular matrix of cartilage [178]. 1 g gelatin, 0.12 g C6S, 0.08 g C4S, and 10 mg HA were sequentially dissolved into 13.8 ml ddH2O at the temperature of 40°C, and the mixture was then well mixed by stir for 20 min. After the solution became yellow colored colloid, it was further cross-linked by the crosslinking agents. 0.1 g 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (E1769, Sigma Co.) and 12 mg N-hydroxysuccinimide (NHS) (56480, Fluka) were dissolved into 10 ml ddH2O as the crosslinking agents. At room temperature, 4 ml of the crosslinking agents were slowly dropped into the previous yellow colored colloid, and the newly formed solution was well mixed and stirred for two to three minutes. After the solution was cooled at 4°C for 1 h for gelation, gel was frozen at 20°C for 2 h followed 80°C overnight to form a sponge and then lyophilized for 72 h. After drying, the modified tri-co-polymer scaffold sponge was cut into 0.5x0.5x0.5 cm cubes and soaked in 100 mL of 5-fold dilution of the crosslinking agents at 4°C for 24 h for re-crosslinking.
Again, the cubes were frozen at 20°C for 2 h followed 80°C overnight and then lyophilized for 72 h to get the dry sponge scaffolds. Finally, the modified tri-co-polymer scaffolds were sterilized by soaking in 70% ethanol (E7148, Sigma Co.) overnight and were washed five times by PBS and then pre-wetted by soaking in culture medium at 37°C for 30 min before cell seeding.
3-2.3 Seeding and Culturing Porcine Chondrocytes in the Modified Tri-Copolymer Scaffolds
Porcine chondrocytes were expanded by two-dimensional monolayer culture for one week in DMEM medium (31600-026, Gibco Invitrogen Co., Burlington, Ontario, Canada) containing 3.7 mg/ml sodium bicarbonate (S5761, Sigma Co.), 50 μg/ml ascorbic acid (A5960, Sigma Co.) [152], 50 units/50 μg/100 μg/mL penicillin/
streptomycin/ neomycin (P4083, Sigma Co.), and 10% fetal bovine serum (100-106 Gemini Bio-Products, Woodland, CA). At the 7th day, monolayer-cultured porcine chondrocytes were trypsinized and re-suspended in the culture medium, where the final concentration was about 1×106 chondrocytes/10 uL culture medium. A volume of 10 uL of cell suspension containing 1 x 106 cells was then injected into each scaffold. After this, cell-scaffold hybrids were cultured in 48-well plates for the first three days for cell attachment and then transfer to 6-well plates for further culture.
Culture medium was changed twice a week during the first three days and two times a week during the subsequent culture period. Here, experimental groups were cell-scaffold hybrids treated with betulin-added culture medium, and positive control group was cell-scaffold hybrids treated with normal culture medium and was incubated under the same conditions as the experimental group. Furthermore, negative control groups were scaffolds which were not seeded with chondrocytes and incubated under the same conditions as the experimental groups and the positive control group. At the end of 1, 2, and 4-week in vitro cultivation, Duplicate samples from each experimental group were removed at the end of a 6-week cultivation for immunohistochemical study on Type II collagen and measurement of DNA content.
The other quadruplicate samples from each group were removed at the end of 12 weeks for measurement of DNA and sulfated GAG content, WST-1 assays and immunohistochemical study on Type II collagen.
3-2.4 Preparation of scaffold for scanning electron microscopy (SEM)
SEM was performed for morphological observation of the gelatin/C6S/C4S/hyaluronan modified tri-copolymer scaffold. The modified tri-copolymer scaffold was dehydrated by treatment with a series of graded ethanol solutions (50% for 12 h, then 75%, 85%, and 95%, each for 2 h), and then placed overnight in a vacuum oven at 50∞C before coating with gold for SEM examination.
The scaffold was then examined using a JEOL JXA-804 A scanning electron microscope (JEOL-USA, Inc., Peabody, MA, U.S.A.).
3-2.5 WST-1 Assay for Cell Proliferation in Cell-Scaffold Hybrids
Water soluble tetrazolium salt, 4-[3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5- tetrazolio]-1, 3-benzen disulfonate (WST-1), had been demonstrated to be a simple and rapid measurement of cell proliferation with extremely low cytotoxicity. A 10%
working solution was made by mixing 1 volume of cell proliferation reagent WST-1 (Roche Molecular Biochemicals, Mannheim, Germany) with 9 volumes of DMEM/F-12 medium. Cell viability and proliferation in cell–scaffold hybrids were tested at the end of the second and fourth weeks of cultivation. Tricopolymer scaffolds with no cell seeded served as controls, and were regulated in the same culture condition as the cell–scaffold hybrids. Each scaffold, including cell–scaffold hybrids and control scaffolds, was incubated with 1 mL of WST-1 working solution in a 12-well plate at 37∞C for 2 h. Then 100 mL of reacted solution was transferred to a 96-well microplate. OD450 was measured using a VERSAmax microplate absorbance reader (Molecular Devices Corp., Sunnyvale, CA, U.S.A.).
3-2.6 Total DNA for Cell Proliferation Quantification
The Wizard® Genomic DNA Purification Kit (A2360, Promega Co., Madison, WI, U.S.A.) was chosen for DNA extraction. Both betulin-treated experimental group and control group were performed in quadruplicate. At the end of 1, 2, and 4-week cultivation, each cell-scaffold hybrid were places into 1.5 mL microcentrifuge tubes and digested by 275 uL of digestion solution for 18 h at 55°C. The digestion solution was composed of 200 uL of Nuclei Lysis Solution, 50 uL of 0.5M EDTA (pH 8.0), 20 uL of proteinase K (20 mg/mL), and 5 uL of RNase A solution (4 mg/mL). After this, 250 uL Lysis Buffer was added into microcentrifuge tubes, and each lysate was transferred to a separate Wizard® SV minicolumn assembly. The assembly was centrifuged at 13,000 × g for 3 min to bind genomic DNA to the membrane, and liquid in the collection tube of assembly was discarded. 650 mL of Wizard® SV Wash Solution was then added to wash the membrane of each assembly followed by centrifuging at 13,000 × g for 1 min, and this step was repeated four times. Finally, extracted total DNA were dissolved in 65°C 250 uL nuclease-free water, and the absorbance at 230 nm, 260 nm, 280 nm, and 320 nm were measured by UV spectrophotometer (Beckman Instrument Inc., Fullerton, CA, U.S.A.). DNA quality was determined at the ratio of 260 nm and 280 nm absorption which should be in the range of 1.8 to 2.0 demonstrating good deproteinization [167], and the ratio of 260 nm to 230 nm help evaluate the level of salt carryover in the purified DNA [168]. DNA concentration was calculated by assuming 1 O.D. at 260 nm was equivalent to 50 ug of DNA per mL. Therefore, total DNA concentration was estimated with formula O.D.
260 - O.D. 320 × dilute factor × 50ug/ml, where the subtraction of A320 was for adjusting the A260 measurement for turbidity [169].
3-2.7 DMMB Assay for Quantitative Measurement of Sulfated GAGs Content
The 1,9-Dimethyl-Methylene Blue (DMMB) was used to determine the content of sulphate-glycosaminoglycans (sGAG), such as chondroitin sulphate and keratan sulphate, in the media to estimate the amount of cell-secreted proteoglycan [170, 171].
Positive charge of DMMB and the negative charge of sulfate of sGAG interact to form DMMB-GAG complexes which alter light absorbance at 595 nm and can thus be measured by spectrophotometer [172]. Briefly, the DMMB solution was prepared by dissolving 21 mg of DMMB (341088, Aldrich-Chemie GmbH, Steinheim, Germany) in 5 mL of 95% ethanol (E7148, Sigma Co.), and the dissolved dye was further added with 2 g sodium formate (107603, Sigma Co.) and 800 ml of ddH2O.
The solution was adjusted to a pH of 1.5 by drop-by-drop addition of 0.1 M formic acid, and ddH2O was added to reach a final volume of 1 L. The stock DMMB solution was stored at 4°C in an aluminum foil-wrapped glass bottle. A standard curve was made using serial dilutions of chondroitin-6-sulfate with HBSS to final concentrations of 0.1, 1, 10, and 100 μg C6S/mL, and the absorbance at 595 nm of the DMMB-C6S complexes were measured triplicate and plotted against known concentrations. At the end of 1, 2, and 4-week cultivation, positive and negative control group and quadruplicate betulin-treated experimental group were digested with 0.1% papain (#CAT, Sigma Co.) in HBSS solution (Sigma Co.) at 60°C for 16 h. Then 40 ml of sample digests and 250 ml of DMMB solution were mixed in a 96-well microplate at room temperature, and absorbance at 595 nm was recorded using a MicroElisa reader (Emax Science Corp., CA, U.S.A.). Sulfated GAGs concentration of each sample was then calculated with use of the regression equation obtained from the linear standard curve.
3-2.8 Real-time Reverse-Transcriptase Polymerase Chain Reaction for mRNA Expression Quantification
In three-dimensional tissue-based experiments, at the end of 1, 2, and 4-week cultivation, quadruplicate betulin-treated experimental cell-scaffold hybrids and the untreated control cell-scaffold hybrids and were immediately immersed into 1.5 mL of RNAlater RNA Stabilization Reagent (76104, QIAGEN GmbH, Hilden, Germany) in microcentrifuge tubes after removing from the culture medium. Briefly, total RNA of each sample was isolated by using RNeasy Protect Mini Kit (74124, QIAGEN GmbH), and two-step real-time RT-PCR was used to measure specific mRNA expressed by chondrocytes, where the SuperScriptTM III First-Strand Synthesis System for RT-PCR (18080-044, Invitrogen Co.) and the 2X SYBR Green Master Mix (4309155, Applied Biosystems, Foster City, CA,. USA) were used for reverse transcription and PCR, respectively. The list of target genes for real-time RT-PCR in this study is in Table 6, and the primer sequence of those target genes are listed in Table 7. The detailed procedures were described in the following paragraphs.
Table 8 List of target genes for real-time RT-PCR in three-dimensional scaffold culture.
Target gene Description
GAPDH Housekeeping gene
I collagen Absent in healthy cartilage, present when fibrously transformed II collagen Major collagen type in the cartilage
X collagen Marker of cellular hypertrophy
Aggrecan Key component of aggregated proteoglycans
Decorin Small proteoglycans
TIMP-1 Tissue inhibitor of MMPs MT1-MMP Degradative enzyme
MMP-2 Degradative enzyme
Sox9 Master chondro-regulatory gene IL-1beta Regulator of catabolism
TGF-beta1 Regulator of anabolism
BMP-7 Promote growth and expression of the chondrocytes phenotype IGF-1 Regulate normal chondrocytes matrix secretion
Table 9 Primer Sequences of three-dimensional scaffold culture.
Name Sequences
GAPDH 5’- GTCATCCATGACAACTTCGG-3’
5’- GCCACAGTTTCCCAGAGG-3’
I collagen 5’- CAGAACGGCCTCAGGTACCA -3’
5’- CAGATCACGTCATCGCACAAC -3’
II collagen 5’- GAGAGGTCTTCCTGGCAAAG -3’
5’- AAGTCCCTGGAAGCCAGAT -3’
X collagen 5’- CAGGTACCAGAGGTCCCATC -3’
5’- CATTGAGGCCCTTAGTTGCT -3’
Aggrecan 5’- CGAAACATCACCGAGGGT- 3’
5’- GCAAATGTAAAGGGCTCCTC-3’
Decorin 5’-GCATTTGCACCTTTGGTGAA-3’
5’-GACACGCAGCTCCTGAAGAG-3’
MT1-MMP 5’- GCTGTGGTGTTCCAGACAAG -3’
5’- GGATGCAGAAAGTGATCTCG -3’
MMP-2 5’- GTTCTGGAGGTACAATGA -3’
5’- ACCACGGCGTCCAGGTTA -3’
TIMP-1 5’- AACCAGACCGCCTCGTACA -3’
5’- GGCGTAGATGAACCGGATG -3’
Sox9 5’-ACCTGAAGAAGGAGAGC-3’
5’-CACCGGCATGGGTACCA-3’
IL-1beta 5’- ACCTCAGCCCTCTGGGAGA -3’
5’- CCTCCTTTGCCACAATCAC -3’
TGF-beta1 5’- GCACGTGGAGCTATACCAGA -3’
5’- ACAACTCCGGTGACATCAAA -3’
BMP-7 5’- CCATGTTCATGCTGGACCTG -3’
5’- GATCAAACCGGAACTCCCGG -3’
IGF-1 5’-CTCTTCAGTTCGTGTGCGGA-3’
5’-GAGCCTTGGGCATGTCCGTG-3’
In total RNA isolation, after immersing each cell–scaffold hybrids into 1.5 mL of RNAlater RNA Stabilization Reagent (76104, QIAGEN GmbH, Hilden, Germany), the samples were then disrupted and homogenized in 600 mL of Buffer RLT by using a rotor–stator homogenizer () to shear high-molecular-weight genomic DNA and other high-molecular-weight cellular components. Next, the lysate was centrifuged at full speed for 3 min, and the supernatant which had RNA dissolve in it was transfer to a new microcentrifuge tube followed by adding 600 mL of 70% ethanol for promoting selective binding of RNA to the RNeasy membrane. The mixture was then transfer to an RNeasy spin column placed in a 2 ml collection tube and centrifuge at 8,000 × g for 15 seconds. Subsequently, the column were washed once by 700 μl of Buffer RW1 and twice by 500 μl Buffer RPE accompanying centrifuge at 8,000 × g for 15 seconds, 8,000 × g for 15 seconds, and 8,000 × g for 2 minutes, respectively. Finally, extracted total RNA was dissolved in 50 uL nuclease-free water and was eluting by centrifuge at 8,000 × g for 1 minute. RNA content was determined at 260 nm by UV spectrophotometer (Beckman Instrument Inc., Fullerton, CA, U.S.A.), and RNA quality was evaluated at the ratio of 260 nm and 280 nm absorption which should be higher than 1.7.
In complement DNA synthesis, 8 μL of extracted RNA, 1 μL of 50 μM oligo(dT)20, and 1 μL of 10mM dNTP were mixed and incubated at 65°C for 5 minutes, then placed on ice for 5 minutes. Next, 2 μL of 10× RT buffer, 4 μL of 25 mM MgCl2, 2 μL of 0.1M DTT, 1 μL of RNaseOUTTM, and 1 μL of SuperScriptTM III RT (200 U/ μL) were added into the mixture. After this, the mixture was incubated at 50°C for 50 minutes and followed by terminating the reaction at 85°C for 5mins.
Finally, the synthesized cDNA was chilled on ice, and 1 μL of RNase H was added to each tube for 20 minutes at 37°C.
In real-time PCR, each reaction was performed with 10 mL of cDNA with 100 ng of cDNA in content, 12.5 μL of 2X SYBR Green Master Mix (4309155, Applied Biosystems Co.), 0.75 μL of 1 μM forward primer solution, 0.75 μL of 1 μM reverse primer solution, and 6 μL of nuclease-free water (P1193, Promega Co.). In order to avoid pipetting errors, three replicates of each sample were amplified. PCR cycles were performed on an ABI PRISM 7900 Sequence Detection System with ABI PRISM 7900 Sequence Detection Software 2.2.2 (Applied Biosystems, Foster City, CA, USA). Briefly, real-time PCR reaction was divided into three stages. In the first initiation stage, after the SYBR® Green I dye was activated at 50°C for 2 minutes, samples were then heated to 95°C for double-strand cDNA denaturation for 10 minutes. Next, in the second cycling stage, the samples were undergone melting at 95°C for 15 seconds followed by annealing/extension at 60°C for 1 minute for 40 cycles to produce the amplicons. Finally, in the last termination stage, the samples were hold at 37°C for 10 minutes for the SYBR® Green I dye inactivation.
Real-time PCR was amplified for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), type I collagen (COL1), type II collagen (COL2), type X collagen (COL10), aggrecan, decorin, tissue inhibitor of metalloproteinase-1 (TIMP-1), matrix metalloproteinase-2 (MMP-2), membrane-type matrix metalloproteinases-1 MMP (MT1-MMP), sex determining region Y-box 9 (Sox9), interleukin-1β (IL-1β), transforming growth factor-β1 (TGF-β1), bone morphogenic protein-7 (BMP-7), and insulin-like growth factor-1 (IGF-1). The mRNA expressions were analyzed by numbers of threshold cycles (Ct), where the Ct value of each target gene were normalized by the Ct value of endogenous control: GAPDH, and the results were shown as -ΔCt in means ± SD. The mRNA expression between betulin-treated experimental group and the untreated control group was analyzed statistically by Student’s t-test with a level of significance of α= 0.01.
3-2.9 Statistical analysis
A Student’s t-test was employed for determining the statistical significance of sulfated GAG content and OD values detected in the WST-1 assay between the cell–scaffold hybrids and the control scaffolds. The differences in mRNA expression in the cell-scaffold hybrids control groups and cell-scaffold hybrids experimental groups were also analyzed by using a Student’s t-test matched-pairs signed rank test.
A p value of less than 0.05 was considered to be statistically significant.