Thioredoxin和線形噬菌體f1的GeneI蛋白質交互作用之研究

全文

(1)

(2) .

(3) .

(4) . ! "#$%&'()* thioredoxin

(5) f1 ; f1 !"#$. %&'()*+ thioredoxin ,. bacteriophage f1 growth. The protein is essential for the assembly of phage f1. It has been proposed from genetic studies that thioredoxin interacts with the phage gene I protein during assembly. In this study, we employed two-hybrid system to investigate the interaction between thioredoxin and phage gene I protein. The results show that these two proteins interact with low affinity. Interaction of truncated fragments of gene I protein was also studied to locate the site of interaction. The amino-terminal fragment of gene I protein composed of residues 1 to 246 (I246) alone can interact with thioredoxin in a. -. gene I /012 ,3 4567289/:;<=> thioredoxin . gene I /01 2 ?@ABCD/01EFG .HIJK 56I2 gene I LMN 3412OP "Q 1-246 RS#T U N VLM(I246)WX thioredoxin 12E YKZ[\]^ gene I E_M`a WbcdeIfgh/012i jk g 1-125 RS#T gene I LM(I125)lJ

(6) X thioredoxin 12EABLmW

(7) nopqdeErsJg]^Etr uv/012S#T w I246 xy 9 R S#TzLM(I255){|j}~h. thioredoxin 12G.H 5w3 4W

(8) $

(9)

(10)

(11) Abstract. strength similar to the whole protein, indicating that this portion of the phage protein includes the interaction site and can fold independently. However, the N-terminal fragment (I125) of 125 residues is not capable of interacting with thioredoxin, suggesting that either the fragment either can not fold properly, or the interaction site is absent or incomplete within this sequence. 246 by nine more residues (I255) Extending I surprisingly reduces the affinity of interaction with thioredoxin. Experiments are undertaken to investigate the possible causes.. E. coli thioredoxin has diverse functions. One of its functions is to support. Keywords: Thioredoxin, Bacteriophage, Interaction, GeneI 1.

(12) .

(13) . functional restoration of eukaryotic transcriptional activators. Many eukaryotic transcriptional activators consist of two domains, the DNA-binding domain (DNA-BD) and the activation domain (AD). In the two-hybrid system, a protein is fused to DNA-BD, and another protein is expressed as a fusion to an AD. Transcription of the gene is activated when DNA-BD and AD are brought into close proximity (7, 8). This system may then be used to determine if the two proteins interact or identify proteins that interact with a bait protein in a cDNA library by analyzing the transcriptional activation of the reporter gene. In this study, we investigate whether thioredoxin interacts with gene I protein of f1 phage, the strength of interaction, and the region of interaction by using yeast two-hybrid system. . E. coli thioredoxin is an essential protein for the growth of certain bacteriophages. This function of thioredoxin does not rely on the redox property of thioredoxin. The T7 DNA polymerase holoenzyme carries out the DNA synthesis by employing the reduced thioredoxin and T7 encoded gene 5 protein in a 1 to 1 complex (1). Reduced thioredoxin is also required for the assembly of filamentous phages. Mutant thioredoxin lacking one or both active site cysteines can support f1 growth (2). Many of the isolated thioredoxin mutants (2) that failed to support f1 growth were mapped to a region implicated in protein-protein interaction (3). An active site mutant P34S has a normal efficiency of plating (E. O. P) at 37o C (4). However, the E. O. P. decreases to 10-7 at 42o C (2). Spontaneous f1 revertant capable of growing at nonpermissive temperature was found to have an amino acid substitution in phage gene I (4). Phage f1 with mutations in gene I are unusually sensitive to the P34S mutation (4). These observations lead Russel and Model (1984) to propose that gene I protein interacts with thioredoxin to facilitate phage assembly. In vitro assembly experiment also demonstrates that thioredoxin is required for filamentous phage assembly (5). However, gene I protein has not been successfully purified. Therefore, the interaction has never been shown directly.. Construction of pLexA/trxA A LexA yeast two-hybrid system (Clontech) was used to study the interaction of thioredoxin with gene I protein of phage f1. To generate the DNA-binding domain (BD) fused with thioredoxin (trxA) as the target protein, trxA sequence was obtained by PCR using pKs#5trxA as a template. pKs#5trxA is a plasmid derived from pBluescript II KS(-) with trxA cloned between EcoRI and BamHI sites. A NdeI site has also been introduced to the start codon of trxA. A 5‘ primer of sequence of 5’GGAATTCCATATGAGCGATAAAAT TATTCACCTG3‘ (The underline refers to the EcoRI site) and a 3’ primer of sequence. Yeast two-hybrid system (6) is a genetic assay of protein-protein interaction based on 2.

(14) 5‘ACGGATCCGCGACGGGGCACC3’ (The underline is BamHI site.) were used for the PCR reaction. The trxA gene was then ligated to the EcoRI and BamHI sites of pLexA to generate pLexA/trxA. The fusion protein is controlled by the strong yeast ADH1 promoter. Yeast transformants were selected by Ampicillin resistant and His marker. The insert from the plasmid was purified and ligated to EcoRI and BamHI sites of pET32a. Dideoxy DNA sequencing confirmed the correctness of the trxA sequence.. and XhoI sites of pB42AD to form the pB42AD/Iw, pB42A/I255, pB42AD/I126, pB42AD/I246, respectively. The expression of activation domain(AD)-geneI fusion protein is under the controlled of Gal1 inducible promoter. The yeast EGY48 transformants were selected by ampicillin resistant and Trp marker. The four inserts were isolated from the plasmids and ligated to the EcoRI and XhoI sites of pET32a. Then, the DNA sequences were confirmed by dideoxy sequencing.. Whole Plate in vivo Assay of Interaction Construction of pB42AD/geneI The LexA System uses two different GeneI was obtained from the RF form of reporter genes (LEU2 and lacZ) under the phage f1 by PCR method. The entire geneI control of multiple LexA operators. The w sequence, designated I , was obtained using a lacZ reporter gene is on an autonomously replicating, high copy number plasmid 5‘ primer sequence p8op-lacZ. The yeast strain EGY48 5’GGAATTCATGGCTGTTTATTTTGA ACTGGC3‘ (primer 1, EcoRI site underlined) (p8op-lacZ) was transformed with pLexA/trxA and one of the pB42AD/geneI and a 3’ primer sequence 5‘GGCGCTCGAGTCATTTCAATTACTT plasmids. β-Galactosidase activity was then assayed directly on the GAGC3’ (primer 3, XhoI site underlined). Gene I has been reported as being toxic to the SD/-His/-Trp/-Ura/Gal/Raf (SD medium without histidine, tryptophan, and uracil, but bacterial growth. Therefore, a fragment of with galactose and raffinose), culture plate by gene I containing nucleotide sequences 1 to 255 including X-gal in the medium. Blue 767 (amino acid 1 to 255), designated I , was also cloned by PCR using primer 1 and a colonies were obtained from the EGY48 (p8op-lacZ) strains carrying pLexA/trxA and 3‘ sequence of w 255 246 5’GCCGCTCGAGTCAAAGAACGCGAG pB42AD/I , pB42AD/I , or pB42AD/I AAAACTT3‘ (primer2, XhoI site (Table 1). The blue color formed was not as underlined). Two shorter fragments of geneI, strong as that of the positive control one fragment containing amino acids 1 to 126 pLexA-pos, and the color appeared one to (I126) and the other containing amino acids 1 two days later than the positive control. 246 to 247 (I ), were obtained as amber However, EGY48 (p8op-lacZ) strains mutants during PCR reactions. These four carrying pLexA/trxA and pB42AD/I126 as fragments were cloned between the EcoRI well as the negative control pLexA/Lam and 3.

(15) pB42AD/T gave white colonies when the other experimental strains turned blue. EGY48 (p8op-lacZ) transformed with the individual pB42AD/gene I plasmids or pLexA/trxA also did not give rise to the blue colonies. Therefore, the whole plate assay indicates that except the shorter I126 fragment, I246 and I255 fragments as well as the entire geneI protein do interact with thioredoxin. The interaction appears to be weak as judged by the color of the colonies compared to that of the positive control.. also interacts with thioredoxin, the latter being stronger than the former fragment. Further truncation to residue 125 produces a fragment that does not interact with thioredoxin.. LEU2 Repoter Assay The integrated nutritional reporter gene LEU2 is under absolute control of the LexA operators. EGY48 (p8op-lacZ) strains 246 carrying pLexA/trxA and pB42AD/I , or pLexA/trxA and pB42AD/Iw did not grow on the SD/Gal/Raf/-His/-Trp/-Ura/-Leu plates, 0-nitrophenyl β -D-galactopyranoside (ONPG) suggesting that the interaction between test thioredoxin and gene I protein is a To obtain quantitative β-galactosidase low-affinity interaction. results, liquid culture with appropriate SD/Gal/Raf induction medium were assayed for the enzymatic activity using ONPG as Yeast two-hybrid system has been used the substrate. The results (Tables 2) show to screen for proteins that interacts with a that the β-galactosidase unit was higher in target protein or test for interaction between EGY48 (p8op-lacZ) strains carrying two proteins (9-11). As isolation of gene I pLexA/trxA and pB42AD/I246, or protein has been a difficult task and so far pLexA/trxA and pB42AD/Iw (Table 2). unsuccessful, in vivo study of the protein 255 Strain with pLexA/trxA and pB42AD/I seems to be valuable for obtaining more gave an intermediate activity unit, while stain information about this protein. In this with pLexA/trxA and pLexA/I126 or the study, we employ yeast two-hybrid system negative control strain gave the lowest to investigate the interaction between β-galactosidase activity. The positive thioredoxin and gene I protein. control pLexA-pos gave much larger In vivo whole plate assay and ONPG β-galactosidase activity than any of the quantitative assay for β-galactosidase activity tested strains, and values were not recorded. show that gene I protein does interact with This assay permits comparison of the relative thioredoxin. However, this interaction was strength of the two-hybrid interactions not strong, as verified by the failure of the observed among the positive clones. It pLexA/trxA and pB42AD/geneI demonstrates that gene I protein interacts cotransformant to grow on SD/-Leu with thioredoxin in a weak manner. induction/selection medium. Truncated gene I with residue 1-255 or 1-246 EGY48 (p8op-lacZ) strains carrying 4.

(16) pLexA/trxA and pB42AD/I246 achieved approximately the same β-galactosidase activity as the strain carrying pLexA/trxA and pB42AD/Iw as shown by the ONPG test, indicating that the N-terminal fragment of residues 1- 246 alone is capable of folding into a structure similar to, if not the same as, the N-terminal part of gene I protein. It also suggests that residues 1-246 encompass site of interaction with thioredoxin. Gene I protein inserts into bacterial membrane through a twenty-residue hydrophobic stretch (residues 254-273) with the carboxyl-side sequences being translocated across the membrane and amino-side sequences inside the cell (12,13). Our results suggest that the cytoplasmic domain of gene I protein can fold independently and interact with thioredoxin without the membrane spanning and the carboxyl-terminal sequences. Moreover, the fragment containing residues 1-125 can not interact with thioredoxin, indicating that some residues of amino acids 126-246 are either essential for the folding or important constituents of the interaction site. Interestingly, the fragment containing residues 1-255 interacts less well with thioredoxin than the somewhat shorter fragment containing residues 1-246. Among these nine residues, residues 241 to 253 were shown to form an thirteen residue amphiphylic helix, and amino acids 254-255 were the starting amino acids of the membrane-spanning region (12,13). One possibility is that the additional nine residues interfere with the folding of fragment 1-255 or the site of interaction with thioredoxin.. The other possibility is that the amphiphylic helix and the two hydrophobic C-terminal residues in the AD-I255 fusion protein partially hinder the translocation of the fusion protein into nucleus. The exact reason for the reduced interaction of this fragment with thioredoxin will await further study.. . 1.. Alder, S., and Modrich, P. (1983) J. Biol. Chem. 258, 6956-6962. 2. Russel, M, and Model, P. (1986) J. Biol. Chem. 261, 14997-15005. 3. Eklund, H., Cambilau, C., Sjoberg, B.-M., Holmgren, A., Jornvall, H., Hoog, J.-O., and Branden, C.-I. (1984) EMBO J. 3, 1443-1449. 4. Russel, M., and Model, P. (1983) J. Bacteriol. 154, 1064-1076. 5. Feng, J.-N., Russel, M., Model, P. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 4068-4073. 6. Fields, S., and Song, O. (1989) Nature 340, 245-247. 7. Chien, C. T., Bartel, P. L., Stemglanz, R., and Fields, S. (1991) Proc. Nat. Acad. Sci. U. S. A. 88, 9578-9582. 8. Luban, J., and Goff, S. P. (1995) Curr. Opinion Biotechnol. 6, 59-64. 9. Guarente, L. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 1639-1641. 10. Iwabuchi, K., Li, B., Bartel, P., Fields, S. (1993) Oncogene 8, 1693-1696. 11. Mendelsohn, A. R., and Brent, R. (1994) Curr. Opinion in Biotechnol. 5, 482-486. 12. Horabin, J. I., and Webster, R. E. (1988) J. 5.

(17) Biol. Chem. 263, 11575-11583. 13. Guy-Caffey, J. K., and Webster, R. E. (1993) J. Biol Chem. 268, 5496-5503. . 6.

(18) Table 1. Expression of lacZ reporter gene with various fusion proteins. Expression of β-galactosidase was assayed on plates containing X-gal. The plates were incubated at 30o C, and observed at different time intervals. Results were the average observation from three independent experiments. +, blue colonies, -, white colonies. 24h pLexA-pos + pLexA/Lam+pB42AD/T pLexA/trxA+pB42AD/Iw pLexA/trxA+pB42AD/I125 pLexA/trxA+pB42AD/I246 pLexA/trxA+pB42AD/I255. 36h. 48h. 60h. 72h. 84h. 96h. +. +. + +. + + -. + + -. + + + +. +. +. +. +. Table 2. Interaction of thioredoxin with gene I protein and its fragments determined by expression of lacZ reporter gene using ONPG method. Colonies were grown in 1 ml of induction medium until OD600 of 0.5-1.0. Cells from one ml of culture was used for measuring β-galactosidase activity using ONPG as substrate. β-Galactosidase activity of the positive control pLexA-pos was much higher than the others. β-galactosidase units pLexA/Lam+pB42AD/T pLexA/trxA+pB42AD/Iw pLexA/trxA+pB42AD/I125 pLexA/trxA+pB42AD/I246 pLexA/trxA+pB42AD/I255. 1.8±0.6 10.6±0.9 2.5±0.9 13.3±3.2 4.5±1.0. 7.

(19)