Polymorphism for Transforming Growth Factor
Beta 1-509 (TGF-B1-509): Association
with Endometriosis
Yao-Yuan Hsieh,1,4Chi-Chen Chang,1Fuu-Jen Tsai,2,5
Ching-Tien Peng,2Lian-Shun Yeh,1and Cheng-Chieh Lin3
Received 24 September 2003—Final 30 June 2004
Transforming growth factor beta (TGF-B) family members are multi-functional cytokines that play a key role in cellular growth, proliferation, and differentiation. The aim of the study was to investigate whether the TGF-B1-509 gene poly-morphism could be used as a marker of susceptibility in endometriosis. Women
were divided into two groups: endometriosis (n= 150) and non-endometriosis
(n= 159). Polymorphisms for TGF-B1-509 genes were amplified by polymerase chain reaction and detected after restriction enzyme digestion. Genotypes and allelic frequencies in both groups were compared. Genotype proportions and al-lele frequencies of TGF-B1 gene polymorphisms differed significantly in both groups. Proportions of C homozygote, heterozygote, and T homozygote for TGF-B1 gene polymorphisms were 9.3/61.3/29.4% in the endometriosis group and 41.3/58.5/0% in the non-endometriosis group. Alleles C and T for TGF-B1 gene polymorphism were 40/60% (endometriosis) and 70.8/29.2% (non-endometriosis). Association of endometriosis with TGF-B1-509 gene polymorphism exists. T ho-mozygote and T allele for TGF-B1 are associated with higher susceptibility to endometriosis.
KEY WORDS: cytokine; endometriosis; polymorphism; transforming growth factor.
1Department of Obstetrics and Gynecology, China Medical University Hospital, Taichung, Taiwan. 2Department of Pediatrics and Medical Genetics, China Medical University Hospital, No. 2 Yuh-Der
Road, Taichung, Taiwan.
3Department of Family Medicine, China Medical University Hospital, Taichung, Taiwan.
4Department of Biological Science and Technology, National Chiao Tung University, Hsinchu, Taiwan. 5To whom correspondence should be addressed; e-mail: [email protected].
203
trial stromal cells (Loverro et al., 2001).
TGF-B is a multifunctional cytokine involved in pro- and anti-inflammatory pathways and is expressed in several cell types. TGF-B and its related genes play an important role in many diseases. The functional impact of the TGF-B1 gene polymorphism as well as the TGF-B1 level might contribute to pathogenesis of inflammatory disease, such as endometriosis. Genetic identification is essential for early diagnosis and genetic therapy of some genetic-associated diseases. Genetic studies of multifactorial diseases such as endometriosis are difficult to approach due to the uncertainty of a polygenic trait.
The role of TGF gene polymorphism in the development of endometriosis remains unclear. Scanty reports about the role of TGF in endometriosis have ap-peared. In our previous reports, we observed a positive correlation of endometriosis with IL-1 (IL-1β-511 promoter, IL-1β exon 5) and p53 polymorphisms (Hsieh et al., 2001a,b; Chang et al., 2002). We also noted the non-correlation of en-dometriosis with the insulin growth factor (Hsieh et al., 2003), IL-4, TNF, and p21 (Hsieh et al., 2002). In this series, using the DdeI restriction enzyme polymorphism in exon 509 of TGF, we tried to evaluate whether this TGF-B1 polymorphism is a useful marker for predicting susceptibility to endometriosis. This is the first survey in this respect.
PATIENTS AND METHODS
Premenopausal Taiwan Chinese women with surgically diagnosed endometriosis and non-endometriosis were included. All patients were divided into two groups: (1) moderate/severe endometriosis (n= 150); (2) non-endometriosis (n = 159). The non-endometriosis status was confirmed during cesarean section or diag-nostic laparoscopy. The stages of endometriosis were evaluated according to the revised American Fertility Society classification (1985). All surgeries were performed by two surgeons (Y-Y. Hsieh and C-C. Chang). This study was ap-proved by the Ethical Committee and institute reviewing board of the China Medical University Hospital. Informed consents were signed by all women who
Fig. 1. Electrophoresis of different genotypes of transforming growth factor beta 1-509.
donated their blood. Age, weight, and height differences between the groups were nonsignificant.
All women accepted the use of peripheral blood sampling for genotype analysis. Genomic DNA was isolated from peripheral blood using a Genomaker DNA extractor kit (Blossom, Taiwan). About 50 ng of genomic DNA was mixed with 20 pmole of each PCR primer in a total volume of 25µL containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2.0 mM MgCl2, 0.2 mM each deoxyribonucleotide triphosphate, and 1 unit of Amplitaq DNA polymerase (Perkin Elmer Applied Biosystems, Foster City, Calif.).
For the DdeI polymorphism analysis, TGF-B1 exon 9 was amplified by using two polymerase chain reaction (PCR) primers. The sequences of the 2 primers were as follows (from 5to 3end): Upstream, GGAGAGCAATTCTTACAGGTG; Downstream, TAGGAGAAGGAGGGTCTGTC. PCR conditions were as follows: 35 cycles at 95◦C for 30 s, 60◦C for 30 s, and 72◦C for 30 s. After complete DdeI digestion (0.5 unit DdeI in 10µL buffer for 30 min at 37◦C), the product was a single fragment of 120 bp for the T allele (undigested by DdeI) or two fragments of 74 and 46 bp for the C allele (digested by DdeI).
PCR products were analyzed by electrophoresis on 3% agarose gel. Each allele was recognized according to its size (Fig. 1). Genotype and allelic frequencies for TGF-B1 polymorphism in both groups were compared. Allelic frequencies are expressed as a percentage of the total number of alleles. The SAS system with χ2 test was utilized for statistical analyses. A p < 0.05 was considered statistically significant.
RESULTS
Genotype proportions and allele frequencies of TGF-B1-509 gene polymor-phisms were significantly different between the two groups. Most genotypes for
cuttable; for T allele 120 bp, uncuttable.
bp-value was calculated byχ2tests.
TGF-B1 polymorphism in both groups were heterozygotes. Proportions of C homozygote, heterozygote, and T homozygote for TGF-B1 gene polymorphisms were 9.3/61.3/29.4% in the endometriosis group and 41.3/58.5/0% in the non-endometriosis group (Table I). T homozygotes TGF-B1-509 are associated with higher susceptibility to endometriosis (p= 0.000014). There was no normal individual with T homozygous. Frequencies for alleles C and T for TGF-B1 gene polymorphism were 40/60% in the endometriosis group and 70.8/29.2% in the non-endometriosis group (Table II). The T allele for TGF-B1-509 is associated with higher susceptibility to endometriosis (p= 0.000026).
DISCUSSION
Endometriosis, a complex immunologic disease, is related to changes of sev-eral cytokines in serum and peritoneal fluid (Pellicer et al., 1998). Inflammation and genetics are both prominent mechanisms in the pathogenesis of endometrio-sis. Endometriosis involves a complex interaction between immunoinflammatory processes, cytokine activation, and genetic factors (Vigano et al., 1998). En-dometriosis displays features similar to malignancy, including local invasion and aggressive spread to distant organs. Numerous cytokines are associated with the
Table II. Allelic Frequencies for TGF-B1-509 Gene Polymorphism
in Women with and Without Endometriosis Allele Endometriosis Non-endometriosis
frequencies (n= 300) (n= 318) p-valuea
Allele C 120 (40) 225 (70.8) 0.000026
Allele T 180 (60) 93 (29.2)
Note. Percentages are shown in parentheses.
molecular mechanism of endometriosis. Several growth factors, including TGF, in-sulin growth factor, epidermal growth factor, fibroblast growth factor, and platelet-derived growth factors, are present in the endometrium (Ferriani et al., 1993).
Previous studies have implicated TGF-B receptors in a variety of impor-tant hereditary clinical disorders. Transmembrane signaling by TGF-B occurs via a complex of the serine/threonine kinases TGF-B type 1 (TGF-B1), type 2 (TGF-B2), and type 3 (TGF-B3) receptors (Lucke et al., 2001). TGF-B1 is a mul-tifunctional cytokine, which inhibits both development of Th1 and Th2 subsets and the Th1 proinflammatory response (Bijlsma et al., 2002). TGF-B1, combined with other paracrine factors, is related to the complex remodeling and differentia-tion processes during endometrial cycling changes (Osteen et al., 2002). TGF-B1 could regulate the production of urokinase plasminogen activator, which further influences endometriosis development (Guan et al., 2003). TGF-B1 and its re-ceptor have important roles in the maintenance and propagation of endometriosis (Loverro et al., 2001).
Single nucleotide polymorphism (SNP) has been observed in various types of human cancers and is considered an important mechanism in tumorigenesis. TGF-B1 production is influenced through several SNPs in the structural gene and promoter region. The TGF-B gene, located at chromosome 19q13.1, may be a candidate locus for susceptibility to numerous diseases.
Recently, TGF-B gene polymorphisms have been reported to be associated with increased risk or severity of numerous diseases, including cervical carci-noma (Stanczuk et al., 2002), systemic sclerosis (Ohtsuka et al., 2002), rheuma-toid arthritis (Sugiura et al., 2002), hypertension (Yamada et al., 2002), diabetic retinopathy (Beranek et al., 2002), hepatitis C (Vidigal et al., 2002), asthma (Pulleyn et al., 2001), osteoporosis (Hinke et al., 2001), Crohn’s disease (Schulte et al., 2001), etc. In contrast, some investigators demonstrated the non-association of the TGF-B gene polymorphisms with individual diseases, including melanoma (Edmunds et al., 2002), keloid disease (Bayat et al., 2002a), Alzheimer’s disease (Araria-Goumidi et al., 2002), tuberculosis (Niimi et al., 2002), and periodontitis (Holla et al., 2002). TGF-B polymorphisms do not have a strong influence on dis-ease onset or clinical progression in sarcoidosis and tuberculosis (Araria-Goumidi et al., 2002).
The T homozygote and T allele, which are associated with higher production of TGF-B1, are associated with higher risk of rheumatoid arthritis (Sugiura et al., 2002). Cervical cell carcinoma was noted to be devoid of TGF-B, which suggested that elevated TGF-B levels could protect against cervical cancer (Stanczuk et al., 2002). TGF-B is a potent stimulator of collagen production by fibroblasts, which play a role in the pathogenesis of systemic sclerosis (Ohtsuka et al., 2002). Serum levels of TGF-B1 were higher in women with the TT genotype than in those with the CC genotype (Hinke et al., 2001). The CC genotype was associated with higher bone marrow density and decreased bone loss (Hinke et al., 2001).
In conclusion, endometriosis is associated with TGF-B1-509 gene polymor-phism. The T homozygote and T allele for TGF-B1-509 are associated with higher susceptibility to endometriosis. Genotype and allele frequencies of TGF-B1 poly-morphism are useful markers for the prediction of endometriosis susceptibility. This could provide a preliminary database for further surveys of the TGF-B1 polymorphisms. The real role and mechanism of the TGF-B1 polymorphism in endometriosis, however, remains to be clarified. Furthermore, the roles of other TGF subtypes and their receptors as well as other growth factors in the develop-ment of endometriosis merit further surveys.
REFERENCES
Akoum, A., Jolicoeur, C., and Boucher, A. (2000). Estradiol amplifies interleukin-1-induced monocyte chemotactic protein-1 expression by ectopic endometrial cells of women with endometriosis.
J. Clin. Endocrinol. Metab. 85:896–904
American Fertility Society. (1985). Revised American Fertility Society classification of endometriosis: (1985). Fertil. Steril. 43:351–352.
Araria-Goumidi, L., Lambert, J. C., Mann, D. M., Lendon, C., Frigard, B., Iwatsubo, T., Cottel, D., Amouyel, P., and Chartier-Harlin, M. C. (2002). Association study of three polymorphisms of TGF-beta1 gene with Alzheimer’s disease. J. Neurol. Neurosurg. Psychiatry 73:62–64. Bayat, A., Bock, O., Mrowietz, U., Ollier W. E., and Ferguson M. W. (2002a). Genetic susceptibility to
keloid disease and transforming growth factor beta 2 polymorphisms. Br. J. Plast. Surg. 55:283– 286.
Bayat, A., Watson, J. S., Stanley, J. K., Ferguson, M. W., and Ollier, W. E. (2002b). Novel single nucleotide polymorphisms in the 3-UTR of the TGFbetaRI and TGFbetaRIII genes. Eur. J.
Immunogenet. 29:445–446.
Beranek, M., Kankova, K., Benes, P., Izakovicova-Holla, L., Znojil, V., Hajek, D., Vlkova, E., and Vacha, J. (2002). Polymorphism R25P in the gene encoding transforming growth factor-beta (TGF-beta1) is a newly identified risk factor for proliferative diabetic retinopathy. Am. J. Med.
Genet. 109:278–283.
Bijlsma, F. J., van der Horst, A. A., Tilanus, M. G., Rozemuller, E., de Jonge, N., Gmelig-Meyling, F. H., de Weger, R. A. (2002). No association between transforming growth factor beta gene poly-morphism and acute allograft rejection after cardiac transplantation. Transpl. Immunol. 10:43– 47.
Chang, C. C., Hsieh, Y. Y., Tsai, F. J., Tsai, C. H., Tsai, H. D, and Lin, C. C. (2002). The proline form of p53 codon 72 polymorphism is associated with endometriosis. Fertil. Steril. 77:43–45
Edmunds, S. C., Kelsell, D. P., Hungerford, J. L., and Cree, I. A. (2002). Mutational analysis of selected genes in the TGFbeta, Wnt, pRb, and p53 pathways in primary uveal melanoma. Invest.
Ophthalmol. Vis. Sci. 43:2845–2851.
Ferriani, R. A., Charnock-Jones, D. S., Prentice, A., Thomas, E. J., and Smith, S. K. (1993). Im-munohistochemical localization of acidic and basic fibroblast growth factors in normal human endometrium and endometriosis and the detection of their mRNA by polymerase chain reaction.
Hum. Reprod. 8:11–16.
Guan, Y. M., Carlberg, M., Bruse, C., and Bergqvist A. (2003). Impact of epidermal growth factor and transforming growth factor beta-1 on the release of fibrinolytic factors from cultured endometrial and ovarian endometriotic stromal cells. Gynecol. Obstet. Invest. 55:7–13.
Hinke, V., Seck, T., Clanget, C., Scheidt-Nave, C., Ziegler, R., and Pfeilschifter, J. (2001). Association of transforming growth factor-beta1 (TGFbeta1) T29—>C gene polymorphism with bone mineral density (BMD), changes in BMD, and serum concentrations of TGF-beta1 in a population-based sample of postmenopausal german women. Calcif. Tissue. Int. 69:315–320.
Holla, L. I., Fassmann, A., Benes, P., Halabala, T., and Znojil, V. (2002). 5 polymorphisms in the transforming growth factor-beta 1 gene (TGF-beta 1) in adult periodontitis. J. Clin. Periodontol.
29:336–341.
Hsieh, Y. Y., Chang, C. C., Tsai, F. J., Wu, J. Y., Tsai, C. C., and Tsai, H. D. (2001a). Androgen receptor trinucleotide polymorphism in endometriosis. Fertil. Steril. 76:412–413.
Hsieh, Y. Y., Tsai, F. J., Chang, C. C., Chen, W. C., Tsai, C. H., Tsai, H. D., and Lin, C. C. (2001b).
p21 gene codon 31 arginine/serine polymorphism: Non-association with endometriosis. J. Clin. Lab. Anal. 15:184–187.
Hsieh, Y. Y., Chang, C. C., Tsai, F. J., Hsu, Y., Tsai, H. D., and Tsai, C. H. (2002). Polymorphisms for interleukin-4 (IL-4) -590 promoter, IL-4 intron3, and tumor necrosis factor alpha -308 promoter: Non-association with endometriosis. J. Clin. Lab. Anal. 16:121–126.
Hsieh, Y. Y., Chang, C. C., Tsai, F. J., Yeh, L. S., Lin, C. C., Peng, C. T., and Tsai, C. H. (2003). Insulin-like growth factor II ApaI polymorphism is not associated with endometriosis susceptibility.
Genet. Mol. Biol., in press.
Loverro, G., Perlino, E., Maiorano, E., Cormio, G., Ricco, R., Marra, E., Nappi, L., Giannini, T., and Selvaggi, L. (1999). TGF-beta 1 and IGF-1 expression in atrophic post-menopausal endometrium.
Maturitas 31:179–184.
Loverro, G., Maiorano, E., Napoli, A., Selvaggi, L., Marra, E., and Perlino, E. (2001) Transforming growth factor-beta 1 and insulin-like growth factor-1 expression in ovarian endometriotic cysts: a preliminary study. Int. J. Mol. Med. 7:423–429.
Lucke, C. D., Philpott, A., Metcalfe, J. C., Thompson, A. M., Hughes-Davies, L., Kemp, P. R., and Hesketh, R. (2001). Inhibiting mutations in the transforming growth factor beta type 2 receptor in recurrent human breast cancer. Cancer Res. 61:482–485.
Niimi, T., Sato, S., Sugiura, Y., Yoshinouchi, T., Akita, K., Maeda, H., Achiwa, H., Ninomiya, S., Akita, Y., Suzuki, M., Nishio, M., Yoshikawa, K., Morishita, M., Shimizu, S., and Ueda, R. (2002). Transforming growth factor-beta gene polymorphism in sarcoidosis and tuberculosis patients. Int. J. Tuberc. Lung Dis. 6:510–515.
Ohtsuka, T., Yamakage, A., and Yamazaki, S. (2002). The polymorphism of transforming growth factor-beta1 gene in Japanese patients with systemic sclerosis. Br. J. Dermatol. 147:458–463. Osteen, K. G., Bruner-Tran, K. L., Ong, D., and Eisenberg, E. (2002). Paracrine mediators of
en-dometrial matrix metalloproteinase expression: Potential targets for progestin-based treatment of endometriosis. Ann.. NY Acad. Sci. 955:139–146.
Pellicer, A., Albert, C., Mercader, A., Bonilla-Musoles, F., Remohi, J., and Simon, C. (1998). The follicular and endocrine environment in women with endometriosis: Local and systemic cytokine production. Fertil. Steril. 70:425–431.
Pulleyn, L. J., Newton, R., Adcock, I. M., and Barnes, P. J. (2001). TGF beta1 allele association with asthma severity. Hum. Genet. 109:623–627.
Schulte, C. M., Goebell, H., Roher, H. D., and Schulte, K. M. (2001). C-509T polymorphism in the TGFB1 gene promoter: impact on Crohn’s disease susceptibility and clinical course?
a polymorphism of the transforming growth factor-beta1 gene with blood pressure in Japanese individuals. J. Hum. Genet. 47:243–248.