Changes in Mitochondrial DNA Deletion, Content, and Biogenesis in Folate-Deficient

The Journal of Nutrition

Biochemical, Molecular, and Genetic Mechanisms

Changes in Mitochondrial DNA Deletion, Content, and Biogenesis in Folate-Deficient

Tissues of Young Rats Depend on Mitochondrial Folate and Oxidative DNA Injuries ^1–3

Yi-Fang Chou, Chu-Ching Yu, and Rwei-Fen S. Huang*

Department of Nutritional Science, Fu-Jen University, HsinChuang 242, Tapei, Taiwan, ROC

Abstract

We aimed to characterize folate-related changes in mitochondrial (mt) DNA of various tissues of young rats. Weaning Wistar rats were fed folate-deficient (FD) or folate-replete (control) diet for 2 or 4 wk. The mtDNA 4834-bp large deletion (mtDNA

⁴⁸³⁴

deletion) and mtDNA content were analyzed by quantitative real-time PCR. Compared with pooled 2-wk and 4-wk control groups, 4-wk folate deprivation significantly increased the frequency of the mtDNA

⁴⁸³⁴

deletion in pancreas, heart, brain, liver, and kidney and reduced mtDNA contents in brain, heart, and liver (P , 0.05). Decreased mt folate levels were correlated with increased mtDNA

⁴⁸³⁴

deletion frequency in tissues from FD rats after 2 wk (r ¼ 20.380, P ¼ 0.001) and 4 wk FD (r ¼ 20.275, P ¼ 0.033) and with reduced mtDNA content after 4 wk (r ¼ 0.513, P ¼ 0.005). In liver of 4-wk FD rats, the accumulated mtDNA large deletions and decline in mtDNA accompanied increased expressions of messenger RNAs (mRNA) of factors that regulate mtDNA proliferation and transcription, including nuclear respiratory factor 1, mt transcriptional factor A, mt single-strand DNA-binding protein, and mt polymerase r. In parallel, expression of mRNA for nuclear-encoded cytochrome c oxidase subunits (CcOX) IV, V, cytochrome c, and mtDNA-encoded CcOX III increased significantly. This enhanced mt biogenesis in 4-wk FD liver coincided with an elevated ratio of 8 hydroxydeoxyguanosine (8-OHdG):deoxyguanosine (dG) (2.67 6 1.41) relative to the controls (0.99 6 0.36; P ¼ 0.0002). The 8-OHdG:dG levels in FD liver were correlated with liver mt folate (r ¼ 20.819, P , 0.001), mtDNA deletions (r ¼ 0.580, P ¼ 0.001), and mtDNA contents (r ¼ 20.395, P ¼ 0.045). Thus, folate deprivation induced aberrant changes of mtDNA

⁴⁸³⁴

deletion and mtDNA content in a manner that was dependent on mt folate and oxidative DNA injuries. The folate-related mt biogenesis provides a molecular mechanism to compensate mtDNA impairment in FD tissues. J. Nutr. 137: 2036–2042, 2007.

Introduction

Human mitochondrial (mt)

⁴

DNA is a double-stranded, circular, 16.5-kb molecule containing genes necessary for the synthesis of the catalytic components of oxidative phosphorylation. Due to the absence of histones, inefficiencies in the DNA repair system, and the proximity to the electron transfer chain with its release of reactive oxygen species (ROS) (1), mtDNA is vulnerable to free radical attack, with a high mutation rate relative to nuclear

DNA (2). Among various types of mtDNA mutations, large- scale deletions of mtDNA, a 4977-bp deletion in humans and a 4834-bp deletion (mtDNA

⁴⁸³⁴

deletion) in rodents, are com- monly found to accumulate in aging tissues (3–5) and in tissues of patients with mt myopathies (6), Kearns-Sayre syndrome (7), and progressive external ophthalmoplegia (8). Accumulation of large mtDNA deletions beyond a certain threshold may involve the altered synthesis of mt proteins, respiratory chain abnor- malities, and the production of free radicals (9,10). mtDNA de- fects and dysfunctions have been implicated in several human diseases, such as liver cirrhosis (11), and in tumor progression and aggressiveness (12,13).

Although the exact causes of the accumulation of mtDNA large deletions remain elusive, oxidative stress may relate to al- tered mtDNA genome integrity (14). Sublethal redox stress may result in a dramatic loss of mtDNA molecules or in deletions or loss of function by base modification in the mtDNA (15,16). The smaller size of partially deleted molecules could have a replica- tive advantage, which may lead to the accumulation of mtDNA large deletions in aging tissues (17,18). This increased mtDNA proliferation requires regulated nuclear gene expression. The mt

1

Supported by grants from the National Science Council, Taiwan (NSC 94-2320- B-030-002 and NSC 95-2320-B-002 to R.F.S. Huang).

2

Author disclosures: Y.-F. Chou, C.-C. Yu, and R.-F. S. Huang, no conflicts of interest.

3

Supplemental Table 1 and Supplemental Figures 1 and 2 are available with the online posting of this paper at jn.nutrition.org.

4

Abbreviations used: CcOX, cytochrome c oxidase; C

t

, threshold cycle number;

Cyt c, cytochrome c; dG, deoxyguanosine; D-loop, displacement loop; 8-OHdG, 8-hydroxydeoxyguanosine; FD, folate deficient; Hcy, homocysteine; mRNA, messenger RNA; mt, mitochondrial; mtDNA

⁴⁸³⁴

deletion, 4834-bp large deletion in mtDNA; NRF, nuclear respiratory factor; RE, relative expression; ROS, reactive oxygen species; TFAM, mitochondrial transcriptional factor A.

* To whom correspondence should be addressed. E-mail: 034825@mail.fju.edu.

tw.

2036 0022-3166/07 $8.00 ª 2007 American Society for Nutrition.

at Swets Information Services Inc on August 31, 2007 jn.nutrition.org Downloaded from

http://jn.nutrition.org/cgi/content/full/137/9/2036/DC1

Supplemental Material can be found at:

transcriptional factor A (TFAM) is one of the nuclear-encoded regulators of mtDNA replication and transcription (19). TFAM expression is coordinated and regulated by a specific set of tran- scription factors such as the nuclear respiratory factor (NRF)-1 and NRF-2 (20). Mt single-strand DNA-binding protein and mt polymerase r are 2 other proteins crucial for mtDNA repli- cation, repair, and recombination (21). Redox stress can activate NRF to induce production of TFAM (22). mtDNA biogenesis is then promoted, as evidenced by increased mtDNA copy number in rat liver (23), rat hippocampus (24), and senescent cells or aging tissues (25–28). Under oxidative stress, both nuclear and mt gene expressions work in concert to regulate mtDNA bio- genesis so as to compensate for defective mtDNA.

Our previous study showed that folate deprivation promoted oxidative injuries in liver mitochondria, including elevated pro- tein carbonyl levels, accumulation of mtDNA large deletions, and superoxide overproduction (29). Rats given folic acid supple- mentation had fewer mtDNA

⁴⁸³⁴

deletions in hepatic tissue upon chemotherapeutic drug treatments (30) or in aging liver tissues (31). As growing evidence supports folate’s role as an antioxidant (32,33), the physiological consequences of dietary folate deprivation for oxidative stress (34) suggest that depriva- tion may also lead to accumulation of mtDNA deletions in other tissues. Little, however, is known about the impact of folate deprivation on genetic modifications of mitochondria in various tissues of young rats. This study aimed to characterize changes in the mtDNA

⁴⁸³⁴

deletion and mtDNA contents in 5 tissues of young rats during dietary folate deprivation. In light of the fact that low folate intake leads to elevated homocysteine (Hcy) con- centrations in humans (35) and animals (34), plasma Hcy levels of rats were measured to indicate functional folate deficiency. We tested the hypothesis that folate deprivation-induced mtDNA changes are linked to subcellular folate levels, oxidative stress, and the expression of factors responsive to mt biogenesis.

Materials and Methods

Animals and experimental diets. An

L

-amino acid–defined folate- deficient (FD) diet with 1% succinylsulfothiazole was specially formu- lated by Harlan Teklad. Because the use of antibiotics in all diets may reduce the absorption of gut folate, the basal FD diet supplemented with 8 mg folic acid/kg was designated the control diet (34,36). After a 3-d acclimation period during which male weaning Wistar rats (n ¼ 24) were fed a nonpurified diet, they were randomly assigned to the FD or control diet using a pair-fed model as previously described (34). After a 2- or 4-wk feeding period, 6 rats, aged 6–8 wk old, from each group were killed with diethyl ether to collect blood and tissues. Five tissues (heart, liver, kidney, pancreas, and brain) were quickly excised, immediately frozen in liquid nitrogen, and stored at 280C until analysis. The ex- perimental protocols were approved by the Institutional Animal Care Committee of Fu-Jen University.

Preparation of cytosolic and mt fractions from various tissues of rats. Mitochondria were isolated from various tissues of rats by conven- tional differential centrifugation in buffer containing 250 mmol/L sucrose, 5 mmol/L Tris-HCl (pH 7.4), and 1 mmol/L EGTA (37). Briefly, tissue homogenates were prepared in this buffer by using a Potter-Elvehjem-type homogenizer. The homogenate was centrifuged twice at 5000 3 g; 10 min at 4C and the mitochondria were then pelleted by centrifugation at 20,000 3 g; 20 min. The purity was determined by measuring the relative specific activities of glutamate dehydrogenase in the supernatant (cytosolic fraction) and mt pellet, as described previously (37). Yields of mt fractions, as reflected by protein content (38), were similar in each experimental group.

Folate and Hcy assay. Blood and tissue samples for folate analysis were prepared according to Varela-Moreiras and Selhub (39). After incuba-

tion of the thawed sample extracts with chicken pancreas conjugase (v:v 4:1) at 37C for 6 h, a microbiologic assay was performed using cryo- protected Lactobacillus casei in 96-well microtiter plates (40). Absorbance was detected at 600 nm in an MRX model ELISA reader (Dynatech Laboratories). Hcy concentrations in plasma samples were analyzed by fluorescence polarization immunoassay and an Abbott AxSYM system (Becton Dickinson).

Analysis of mtDNA

⁴⁸³⁴

in various rat tissues. The quantity of the mtDNA

⁴⁸³⁴

deletion was determined by coamplifying the mtDNA displacement-loop (D-loop) and mtDNA

⁴⁸³⁴

deletion in a real-time PCR assay. Primers for each were previously described by Branda et al. (30).

The degree of mtDNA

⁴⁸³⁴

deletion was quantified with a deletion probe [DYXL-5#-(12952) TCACTTTAATCGCCACATCCATAACTGCTGT (12982)-3# BHQ1] and mtDNA probe [6FAM (15795) 5#-TTGGTT- CATCGTCCATACGTTCCCCTTA (15822)-3# BHQ1]. PCR amplifica- tion was carried out in a 20-mL reaction volume consisting of TaqMan Universal Master mix (4 mL), 200 nmol/L each mtDNA

⁴⁸³⁴

deletion primer, 50 nmol/L each D-loop primer, and 100 nmol/L each mtDNA

⁴⁸³⁴

deletion and D-loop probe primer. The cycling condition included an initial phase of 2 min at 50C, 10 min at 95C, then 40 cycles of 15 s at 95C and 0.5 min at 72C. The fluorescence spectra were monitored by the LightCycler Detection system with Sequence Detection software version 4 (LightCycler, Roche Diagnostics).

Qualification of mtDNA

⁴⁸³⁴

deletion by DNA sequencing. After the reaction, we separated the desired amplified DNA fragments by electro- phoresis in a 2% agarose gel at 100 V for 40 min. The mtDNA bands were excised from the gel, placed on the filter of a Spin-X Centrifuge Tube filter (Costar), frozen at 220C, and recovered by centrifugation (10,000 3 g; 1 min). DNA sequencing was performed with a Big Dye Terminator Cycle Sequencing kit (Perkin Elmer) and an ABI 377 auto- mated sequencer (Applied Biosystems).

Quantification of mtDNA

⁴⁸³⁴

deletion. The cycle at which a signif- icant increase in normalized fluorescence was first detected was desig- nated as the threshold cycle number (C

_t

). The ratio of mtDNA

⁴⁸³⁴

deletion to mtDNA was calculated with DC

_t

(¼ mt C

_{t del}

2 mt C

_{t D-loop}

);

a smaller DC

t

indicates more deletions. The relative expression (RE) indicates the factorial difference in deletions between the 2-wk FD, 4-wk FD, and pooled control groups. RE was calculated as 2

^2DDCt

, where DDC

t

¼ DC

t mtDNA deletion in FD group

2 DC

t mtDNA deletion in the control

.

Analysis of relative amount of mtDNA content. The content of mtDNA (abundance) relative to nuclear genomic DNA was determined by coamplifying the mt D-loop and the nuclear-encoded b-actin gene by real-time PCR assay. Primers for each were previously described by Branda et al. (30). The amount of b-actin gene was quantified by a fluorescent probe [DYXL 5#-(3347) CGGTCGCCTTCACCG-TTCC- AGTT (3325)-3# BHQ1]. PCR amplification and the cycling conditions were as described above. The fluorescence spectra were monitored by LightCycler (Roche Diagnostics). The ratio of mtDNA to genomic DNA content was calculated with DC

t

(mt C

t D-loop

– nuclear C

t b-actin

). A smaller DC

t

indicates a less relative mtDNA content. RE indicates the factorial difference in mtDNA content between the 2-wk FD, 4-wk FD, and pooled control groups. RE was calculated as 2

^2DDCt

, where DDC

t

¼ DC

t mtDNA content in FD group

2 DCt

mtDNA content in the control

.

mRNA expression levels. Total RNA was extracted with an RNAzol Bee-RNA isolation kit (Tel-Test). Briefly, 1 mg of each sample was reverse- transcribed using Moloney murine leukemia virus RT in a reaction buffer containing random hexamer primers, deoxyribonucleoside triphos- phates, and the ribonuclease inhibitor RNasin (Clontech Laboratories).

Gene transcripts were amplified using gene-specific primers (see Supple- mental Table 1) and b-actin was used to control for variation in effi- ciency of RNA extraction and reverse transcription. The cycling conditions included an initial phase of 2 min at 50C, 10 min at 95C, then 40 cycles of 10 s at 95C, 0.5 min at 60C, and 10 s at 72C.

Amplified cDNA was quantified using the QuantiTect SYBR Green PCR kit in a LightCycler (Roche Diagnostics).

at Swets Information Services Inc on August 31, 2007 jn.nutrition.org Downloaded from

Analyses of 8-hydroxydeoxyguanosine levels. Total DNA was extracted and the 8-hydroxydeoxyguanosine (8-OHdG) levels were measured according to the method of Shigenaga et al. (41). An aliquot of 25 mg DNA was dissolved in 20 mmol/L sodium acetate/1 mmol/L defer- oxamine mesylate, heated to 98C for 10 min, and then cooled rapidly on ice. The DNA solution was treated with 20 units of DNase I in 25 mL of 0.1 mol/L MgCl

2

and incubated at 37C for 30 min. DNAs were hydrolyzed to nucleotides by further incubation with nuclease P1, sodium acetate (0.25 mol/L, pH 5.4), and 0.1 mol/L zinc sulfate at 37C for 60 min. The resultant mixture was hydrolyzed to nucleosides by incubation with calf intestine alkaline phosphatase for 30 min at 37C. A reverse-phase C18 HPLC column (4.6 mm 3 150 cm, with a particle size of 5 mm; Waters Associates) was used to separate the nucleosides. The mobile phase of 50 mmol/L KH

2

PO

4

buffer (pH 5.5) and 20% methanol was delivered at a flow rate of 0.8 mL/min. Pure deoxyguanosine (dG;

Sigma Chemical) and 8-OHdG (Cayman Chemical) were used as standards. An HP 1100 series UV detector (Shimadzu SPD-M 10A) set at 254 nm was used to measure dG and an ECD detector (Shodex EC-1), with the electrode potential adjusted to 0.594 V, was used to detect 8-OHdG. The results are expressed as the ratio of 8-OHdG:dG.

Statistical methods. Data are presented as means 6 SD. Student’s t test was used to compare animal growth and messenger RNA (mRNA) ex- pression between the FD and the control group at 2 and 4 wk, and variables between each control group. Because plasma folate (250.5 6 14.2 vs. 260.3 6 20.8 nmol/L), RBC folate (585 6 121 vs. 646 6 187 nmol/L), Hcy levels (19.7 6 3.0 vs. 20.4 6 4.7 mmol/L), 8-OHdG ratio (0.92 6 0.42 vs. 1.03 6 0.29), and liver mtDNA deletions (DCt ¼ 3.67 6 0.22 vs. 4.34 6 0.59) in 2-wk and 4-wk control groups did not differ significantly, the 2 control groups were pooled. The effects of dietary folate deprivation with the pooled controls were analyzed by 1-way ANOVA and Duncan’s multiple range test using the General Linear Model of SAS Institute. Unequal variances were first transformed using a logarithmic function. Pearson’s correlation coefficient was used to mea- sure the association among mtDNA damage, mtDNA biogenesis, and folate depletion variables in the controls and FD groups separately. Dif- ferences were considered significant at P , 0.05.

Results

Blood folate and Hcy levels. Rats in each group were fed a similar amount of food. Accumulated weight gains did not differ between the 4-wk control (300 6 18 g) and 4-wk FD group (286 6 16 g). Compared with the controls, plasma folate levels of rats decreased significantly after 2-wk FD feeding followed by a reduction in red blood cell folate and a corresponding elevation in plasma Hcy levels after 4-wk FD feeding (Fig. 1). The biochemical measurements indicated signs of functional folate deficit in rats fed the FD diet for 4 wk.

Changes in subcellular folate levels during dietary folate deprivation. In liver, pancreas, and kidney, cytosolic and mt folate levels decreased in parallel after 2- and 4-wk folate dep- rivation compared with the controls (Table 1). In heart and brain, mt folate levels decreased before cytosolic folate levels (2 wk). In all tissues, 4-wk folate deprivation depleted mt folate levels and all cytosolic folate levels except in brain to ,50% of the control values. Pancreas of FD rats after 4 wk had the most depleted mt folate pool, with 77% reduction of the control values.

Detection and mapping of mtDNA

⁴⁸³⁴

common deletion.

Amplification of the sequence with the mtDNA

⁴⁸³⁴

loss gave different C

_t

values between groups, suggesting different quan- tities of mtDNA

⁴⁸³⁴

deletion in control and FD tissues (Supple- mental Fig. 1A). To confirm the deleted mtDNA at the breakpoints of the mtDNA

⁴⁸³⁴

deletion with 2 16-bp repeats that normally flank the wild-type mtDNA, we directly se- quenced the PCR fragments. Sequence comparison with rodent mtDNA sequence data (42) showed that the deletion junction (bp 8103, bp 12937–12952) was present in PCR fragments amplified from FD rat liver and confirmed that the common deletion region was 4834 bp (Supplemental Fig. 1B).

Changes in accumulation of mtDNA

⁴⁸³⁴

deletion among FD tissues. By real-time PCR analysis, we found spontaneous or background mtDNA common deletions in tissues of the con- trols (Table 2). Compared with the controls, 2-wk folate depri- vation significantly increased the frequency of the mtDNA

⁴⁸³⁴

deletion in pancreas, heart, and liver. Further mtDNA deletions in those tissues were accumulated after 4-wk folate deprivation, with RE values of 2.3–5.2 (P , 0.05). mtDNA deletions did not change significantly in brain and kidney until 4 wk. Pancreas accumulated the mtDNA

⁴⁸³⁴

deletion at the greatest rate among the measured tissues.

Changes in mtDNA content among FD tissues. Compared with the controls, 2-wk folate deprivation did not significantly alter mtDNA content of any tissues except pancreas (Table 3).

Four-week folate deprivation significantly decreased mtDNA content in brain, heart, and liver. Among the measured tissues,

FIGURE 1 Plasma and RBC folate and Hcy concentrations of controls, 2-wk, and 4-wk FD rats. Values are means 6 SD, n ¼ 12 for control group, n ¼ 6 for each FD group. Means for a variable without a common letter differ, P , 0.05.

TABLE 1 Folate levels in compartmental fractions isolated from 5 tissues of rats fed the control or FD diet for 2 or 4 wk

¹

Rat tissues Controls 2-wk FD 4-wk FD

Liver pmol/mg protein (% of controls)

Cyt 840 6 346

^a

(100) 368 6 11

^b

(44) 265 6 10

^c

(32) mt 147 6 2

^a

(100) 60 6 1

^b

(44) 42 6 2

^c

(28) Pancreas

Cyt 872 6 118

^a

(100) 467 6 60

^b

(54) 369 6 78

^b

(43) mt 208 6 7

^a

(100) 105 6 7

^b

(50) 48 6 3

^c

(23) Heart

Cyt 401 6 43

^a

(100) 343 6 66

^a

(98) 172 6 31

^b

(48) mt 122 6 4

^a

(100) 47 6 6

^b

(39) 43 6 5

^b

(35) Brain

Cyt 895 6 75

^a

(100) 880 6 72

^a

(97) 490 6 48

^b

(55) mt 118 6 5

^a

(100) 86 6 6

^b

(73) 55 6 4

^c

(47) Kidney

Cyt 913 6 70

^a

(100) 582 6 40

^b

(64) 382 6 40

^c

(42) mt 136 6 6

^a

(100) 83 6 3

^b

(61) 58 6 2

^c

(43)

1

Data are means 6 SD, n ¼ 12 for controls, n ¼ 6 for each FD group. Means in a row without a common letter differ, P , 0.05.

at Swets Information Services Inc on August 31, 2007 jn.nutrition.org Downloaded from

brain had the highest reduction and kidney the lowest, with RE values of 0.2 and 0.8, respectively.

Correlations between folate status, mtDNA

⁴⁸³⁴

deletion, and mtDNA content of rat tissues. Relationships between subcellular folate status and mtDNA alterations were analyzed (Table 4). There was a lack of correlations in the controls. In FD groups, decreased mt folate levels were associated with increased mtDNA

⁴⁸³⁴

deletions (after 2 wk, r ¼ 20.380, P ¼ 0.001; after 4 wk, r ¼ 20.275, P ¼ 0.033). Decreased mtDNA contents in FD rats after 4 wk were strongly associated with mt folate (r ¼ 0.513, P ¼ 0.005). There was a negative correlation between mtDNA content and accumulation of mtDNA

⁴⁸³⁴

deletions after 2 wk (r ¼ 20.504, P ¼ 0.004) and 4 wk (r ¼ 20.587, P ¼ 0.001).

Effects of folate deprivation on expression of mRNA for factors involved in mt biogenesis and respiratory func- tion. We postulated that FD-related mtDNA changes may be linked to factors involved in mt biogenesis and tested this hypo- thesis in rat liver. Four-week folate deprivation induced 30–60%

higher expression of NRF-1, TFAM, mt single-strand DNA- binding protein, and mt polymerase r mRNA than the control (Fig. 2A). In parallel, expression of mRNA for nuclear-encoded cytochrome c oxidase subunits (CcOX IV, V) and cytochrome C (Cyt c) increased (Fig. 2B). mtDNA-encoded genes for respiratory subunits seemed to be differentially regulated. CcOX III mRNA expression was significantly elevated, whereas expressions of NADPH dehydrogenase subunit 1 and CcOX II mRNA did not alter significantly (Fig. 2B). Expressions of mRNA for factors involved in mtDNA biogenesis and respiratory function in 2-wk FD rat livers did not differ from the control (data not shown).

Effects of folate deprivation on oxidative DNA injuries in liver. To understand whether increased mtDNA biogenesis at

the transcriptional level was linked to increased oxidative stress, we analyzed DNA oxidative injuries by HPLC (Supplemental Fig. 2). The level of oxidative DNA injury was calculated as the ratio of 8-OHdG to dG. The levels were 0.99 6 0.36 in the control rat liver, 1.46 6 0.08 in the FD rat liver after 2 wk, and 2.67 6 1.41 in the FD rat liver after 4 wk. 8-OHdG levels in FD rat liver after 4 wk were 1.8 times those after 2 wk (P ¼ 0.0135) and 2.7 times those in the control group (P ¼ 0.0002). The in- creased 8-OHdG levels in liver tissue of FD rats after 2 and 4 wk were correlated with cytosolic folate (r ¼ 20.834, P , 0.001), mt folate (r ¼ 20.819, P , 0.001), mtDNA deletions (r ¼ 0.580, P ¼ 0.001), and mtDNA contents (r ¼ 20.395, P ¼ 0.045).

Discussion

Our study identified a substantial rise in the mtDNA

⁴⁸³⁴

deletion in various tissues of young rats during dietary folate deprivation.

This mtDNA large deletion in FD tissues was found to accu- mulate at levels 1.6–5.2 times those in control rats. Crott et al.

(31) reported similar changes of mtDNA

⁴⁸³⁴

deletion in liver of old rats at a difference of 3.2 times between FD- and folate- supplemented rats. The mtDNA

⁴⁸³⁴

deletion in FD tissues of young rats increased the most in pancreas, heart, brain, and liver but increased only a little in kidney. This folate-related distri- bution of altered mtDNA

⁴⁸³⁴

deletion levels in young rat tissues mimics the age-related pattern of deleted mtDNA accumulation in humans; the mtDNA

⁴⁹⁷⁷

common deletion in aging human tissues is present at the highest levels in brain and heart and at a much lower level in kidney (3,43–45). Reduced mtDNA copy numbers have been reported to occur with aging in rat liver and heart (46), whereas folate deprivation significantly depleted mtDNA content in rat brain, heart, and liver of young rats.

Given the similarities in the deletion levels, accumulation pat- tern of mtDNA large deletions, and changes in mtDNA content

TABLE 3 Changes in relative mtDNA content in 5 tissues of rats fed control or FD diet for 2 or 4 wk

¹

Controls 2 wk-FD 4 wk-FD

Rat tissues DCt

²

RE

³

DCt RE DCt RE

Brain 210.8 6 0.99

^a

1 29.76 6 1.28

^ab

0.5 28.63 6 2.69

^b

0.2

Heart 211.1 6 0.55

^a

1 210.4 6 0.85

^ab

0.6 29.72 6 1.44

^b

0.4

Liver 210.3 6 0.66

^a

1 29.97 6 0.70

^a

0.8 28.92 6 0.86

^b

0.4

Pancreas 26.98 6 0.67

^a

1 25.83 6 0.77

^b

0.5 26.54 6 1.15

^ab

0.7

Kidney 29.89 6 0.83

^a

1 29.52 6 0.84

^a

0.8 29.54 6 1.55

^a

0.8

1

Values are means 6 SD (n ¼ 12 for controls; n ¼ 6 for each FD group). Means in a row without a common letter differ, P , 0.05.

2

The ratio of mtDNA to genomic DNA content was calculated with DC

t

¼ mt C

t D-loop

2 nuclear C

t b-actin

.

3

The RE indicates the factorial difference in deletions between 2-wk FD, 4-wk FD, and the controls.

TABLE 2 Changes in the accumulation of mtDNA

⁴⁸³⁴

deletions in 5 tissues of rats fed the control or FD diet for 2 or 4 wk

¹

Controls 2 wk-FD 4 wk-FD

Rat tissues DCt

²

RE

³

DCt RE DCt RE

Pancreas 5.04 6 0.74

^a

1 3.73 6 0.46

^b

2.5 2.65 6 0.29

^c

5.2

Heart 5.55 6 0.85

^a

1 4.14 6 0.09

^b

2.6 3.70 6 0.44

^c

3.6

Liver 4.00 6 0.55

^a

1 3.41 6 0.33

^b

1.5 2.78 6 0.54

^c

2.3

Brain 4.48 6 0.69

^a

1 4.14 6 0.80

^a

1.3 3.23 6 0.30

^b

2.4

Kidney 3.89 6 0.47

^a

1 3.79 6 0.44

^a

1.1 3.19 6 0.39

^b

1.6

1

Values are means 6 SD, n ¼ 12 for controls, n ¼ 6 for each FD group. Means in a row without a common letter differ, P , 0.05.

2

The ratio of mtDNA

⁴⁸³⁴

deletion to mt DNA was calculated with DC

t

¼ mt C

t del

2 mt C

t D-loop

.

3

The RE indicates the factorial difference in deletions between 2-wk FD, 4-wk FD, and the control group.

at Swets Information Services Inc on August 31, 2007 jn.nutrition.org Downloaded from

between aging and FD tissues, our data therefore suggest an ability of dietary folate deprivation to accelerate mtDNA pre- mature aging in tissues of young animals.

The exact cause of the increased mtDNA

⁴⁸³⁴

deletion levels in FD tissues remains unknown. Several lines of evidence from this study indicate that mtDNA

⁴⁸³⁴

deletion level in FD tissues is mt folate-dependent. First, the FD tissue with the most depleted mt folate content harbored the highest increase in mtDNA

⁴⁸³⁴

deletions. Also, decreased mt folate levels were strongly corre- lated with increased frequency of mtDNA deletion among all

measured tissues. This relationship was not found in tissues of the control rats. Reduced mt folate content resulted in mt oxi- dative injuries, including compromised antioxidant enzymatic activities, elevated protein carbonyl contents, and ROS produc- tion, as we have previously demonstrated in primary hepato- cytes of FD rats after 4 wk (29). The elicited oxidative stress inside FD mitochondria could be attributable to mtDNA large deletions. This speculation is supported by the finding that sub- lethal redox stress such ROS production could lead to loss of mtDNA molecules or to deletions or a loss of function by base modification in the mtDNA (15,16). Similarly, tissues with high antioxidant capability in mitochondria essentially have a low level of mtDNA deletions (47). It has also been hypothesized that mtDNA large deletions could arise by slip-replication, in which replication is stalled by oxidative damage, allowing slipped mispairing between repeated sequences or by erroneous RNA splicing (48). Indeed, we found that the increased accumulation of the mtDNA

⁴⁸³⁴

deletion in FD rat liver significantly cor- related with increased 8-OHdG content, a biomarker of DNA oxidative injuries. Thus, our work and others’ suggest that re- duced mt folate content and elicited oxidative stress inside mitochondria contribute to the increased frequency of the mtDNA

⁴⁸³⁴

deletion in FD tissues.

Our data demonstrate for the first time, to our knowledge, that mt biogenesis was enhanced during folate deficiency. In FD rat livers after 4 wk, the adaptive response occurred via the genetic regulation of factors for mt biogenesis (Fig. 2). NRF-1 is an oxidative-responsive transcriptional factor that binds to the promoter region of genes for proteins such as TFAM and cyt c (20,21) to trigger mt biogenesis. In 4-wk FD rat liver with elevated oxidative DNA damage, expression of NRF-1 mRNA was significantly induced. The NRF-1 induction coincided with upregulation of NRF-1 target genes, Cyt c, and TFAM (Fig. 2).

In parallel, expression of mRNA for nuclear-encoded and mt- encoded respiratory subunits (CcOX IV, V, III, Cyt c) increased.

This finding was consistent with reports that showed that oxi- dative stress caused via the stimulation of LPS (23), reactive oxy- gen (15), and elevated Hcy (49) could induce NRF and TFAM mRNA expression. It is likely that the enhanced mtDNA biogenesis at the transcriptional level in FD tissues was the consequence of mt oxidative injuries as a compensation to rescue the impaired tissues, a scenario previously reported in LPS- treated rat liver (23) and in senescent cells or aging tissues (24–

28). Several studies have shown in cardiac myocytes (15), human fibroblasts (27), leukocytes (28), and mouse brains (24) that the elevated oxidative stress was related to increased mtDNA TABLE 4 Pearson’s correlation coefficients of relationships between compartmental folate levels and

alteration of mtDNA in 5 tissues of young rats fed control or FD diet

¹

DmtDNA

⁴⁸³⁴

(DC

t

) mtDNA content (DC

t

)

Diet Variables r P-value r P-value

Controls Cyt folate 20.026 0.847 0.127 0.510

mt folate 20.119 0.413 0.176 0.268

mtDNA content 20.280 0.056 – –

2-wk FD Cyt folate 20.076 0.536 0.172 0.362

mt folate 20.380 0.001 0.264 0.182

mtDNA content 20.504 0.004 – –

4-wk FD Cyt folate 20.145 0.267 0.389 0.040

mt folate 20.275 0.033 0.513 0.005

mtDNA content 20.587 0.001 – –

1

Correlations were considered significant at P , 0.05.

FIGURE 2 Effects of folate deprivation on expression of mRNA for regulatory factors involved in mtDNA biogenesis (A) and nuclear or mtDNA-encoded respiratory subunits (B) in livers of rats fed control or FD diet for 4 wk. Changes in the specific gene PCR products were corrected for the corresponding level of b-actin in the sample. The data are expressed as a percentage of the control. Values are means 6 SEM, n ¼ 3 (means of duplicate samples). *Different from control, P , 0.05 (Student’s t test).

at Swets Information Services Inc on August 31, 2007 jn.nutrition.org Downloaded from

damage and mtDNA biogenesis. On the other hand, triggered mt biogenesis may reciprocally facilitate propagation of mutated mtDNA already carried within the impaired tissues, particularly in growing cells (16,17). Certain mutant mtDNA molecules ex- hibit a replicative advantage and mitochondria that undergo rep- lication appear to acquire DNA damage more readily (18). The enhanced mt biogenesis in 4-wk FD liver of young rats that are still growing and undergoing cell division may explain in part, if not all, the accumulation of mtDNA

⁴⁸³⁴

deletion in FD tissues.

Although machinery of mt biogenesis for mtDNA prolifer- ation and transcription was triggered during the 4-wk FD pe- riod, mtDNA content of FD tissues did not increase accordingly.

This decline of mtDNA content significantly associated with decreased mt folate levels of FD tissues in general and with elevated 8-OHdG levels of FD liver in particular. The data sug- gested that elicited oxidative stress (29) and DNA oxidative injuries (this study) as a result of mt folate deficit may otherwise interfere with mtDNA replication. The mtDNA molecule con- tains the noncoding region of a unique D-loop that contains the leading strand origin of replication and the promoters of tran- scription (50). Mutations in this region might affect the rate of DNA replication by modifying the binding affinity of important trans-acting factors. The D-loop region is a ‘‘hot spot’’ for so- matic mutations in human cancers (51). Frequent mutations in the D-loop region and decreased mtDNA contents were found in oxidative stress-associated human liver diseases such as hepatitis and hepatocellular carcinoma (52,53). Whether mt folate deficit and elevated DNA oxidative injuries may result in increased mu- tations of D-loop leading to reduced mtDNA contents warrants more studies.

In summary, this study demonstrates that the mtDNA

⁴⁸³⁴

deletion is increasingly accumulated in various tissues of young rats during dietary folate deprivation. The corollary findings of elevated oxidative DNA injuries and enhanced mt biogenesis associated with this mtDNA large deletion apparently represent novel phenomena observed in FD tissues of young animals. mt Folate level was a significant predictor of increased accumula- tion of the mtDNA common deletion and decreased mtDNA content. The folate-related mt biogenesis depicts a molecular mechanism to compensate mtDNA impairment in folate- deficient tissues.

Acknowledgment

The authors are deeply grateful to Professor Y.-H. Wei, Depart- ment of Biochemistry, National Yang-Ming University, Taiwan, for his kind support and invaluable advice on mt DNA mutations.

Literature Cited

1. Sawyer DE, Van Houten B. Repair of DNA damage in mitochondria.

Mutat Res. 1999;434:161–76.

2. Richter C, Park JW, Ames BN. Normal oxidative damage to mitochon- drial and nuclear DNA is extensive. Proc Natl Acad Sci USA. 1988;

85:6465–7.

3. Cortopassi GA, Shibata DD, Soong NW, Arnheim N. A pattern of accumulation of a somatic deletion of mitochondrial DNA in aging human tissues. Proc Natl Acad Sci USA. 1992;89:7370–4.

4. Cortopassi GA, Arnheim N. Detection of a specific mitochondrial DNA deletion in tissues of older humans. Nucleic Acids Res. 1990;18:6927–

33.

5. Wei YH. Mitochondrial DNA alterations as ageing-associated molec- ular events. Mutat Res. 1992;275:145–55.

6. Holt IJ, Harding AE, Morgan-Hughes JA. Deletions of muscle mito- chondrial DNA in patients with mitochondrial myopathies. Nature.

1988;331:717–9.

7. Lestienne P, Ponsot G. Kearns-Sayre syndrome with muscle mitochon- drial deletion. Lancet. 1988;1:885.

8. Moraes CT, DiMauro S, Zeviani M, Lombes A, Shanske S, Miranda AF, Nakase H, Bonilla E, Werneck LC, et al. Mitochondrial DNA deletions in progressive external ophthalmoplegia and Kearns-Sayre syndrome.

N Engl J Med. 1989;320:1293–9.

9. Lezza AM, Boffoli D, Scacco S, Cantatore P, Gadaleta MN. Correlation between mitochondrial DNA 4977-bp deletion and respiratory chain enzyme activities in aging human skeletal muscles. Biochem Biophys Res Commun. 1994;205:772–9.

10. Wei YH, Lee HC. Oxidative stress, mitochondrial DNA mutation, and impairment of antioxidant enzymes in aging. Exp Biol Med (May- wood). 2002;227:671–82.

11. Yamamoto H, Tanaka M, Katayama M, Obayashi T, Nimura Y, Ozawa T. Significant existence of deleted mitochondrial DNA in cirrhotic liver surrounding hepatic tumor. Biochem Biophys Res Commun. 1992;182:

913–20.

12. Amuthan G, Biswas G, Zhang SY, Klein-Szanto A, Vijayasarathy C, Avadhani NG. Mitochondria-to-nucleus stress signaling induces phe- notypic changes, tumor progression and cell invasion. EMBO J. 2001;

20:1910–20.

13. Chinnery PF, Samuels DC, Elson J, Turnbull DM. Accumulation of mitochondrial DNA mutations in ageing, cancer, and mitochondrial disease: is there a common mechanism? Lancet. 2002;360:1323–5.

14. Raha S, Robinson BH. Mitochondria, oxygen free radicals, disease and ageing. Trends Biochem Sci. 2000;25:502–8.

15. Suematsu N, Tsutsui H, Wen J, Kang D, Ikeuchi M, Ide T, Hayashidani S, Shiomi T, Kubota T, et al. Oxidative stress mediates tumor necrosis factor-alpha-induced mitochondrial DNA damage and dysfunction in cardiac myocytes. Circulation. 2003;107:1418–23.

16. Suliman HB, Caraway MS, Velsor LW, Day BJ, Ghio AJ, Piantadosi CA.

Rapid mtDNA deletion by oxidants in rat liver mitochondria after hemin exposure. Free Radic Biol Med. 2002;32:246–56.

17. Elson JL, Samuels DC, Turnbull DM, Chinnery PF. Random intracel- lular drift explains the clonal expansion of mitochondrial DNA mutations with age. Am J Hum Genet. 2001;68:802–6.

18. Diaz F, Bayona-Bafaluy MP, Rana M, Mora M, Hao H, Moraes CT.

Human mitochondrial DNA with large deletions repopulates organelles faster than full-length genomes under relaxed copy number control.

Nucleic Acids Res. 2002;30:4626–33.

19. Ekstrand MI, Falkenberg M, Rantanen A, Park CB, Gaspari M, Hultenby K, Rustin P, Gustafsson CM, Larsson NG. Mitochondrial transcription factor A regulates mtDNA copy number in mammals.

Hum Mol Genet. 2004;13:935–44.

20. Virbasius JV, Scarpulla RC. Activation of the human mitochondrial transcription factor A gene by nuclear respiratory factors: a potential regulatory link between nuclear and mitochondrial gene expression in organelle biogenesis. Proc Natl Acad Sci USA. 1994;91:1309–13.

21. Scarpulla RC. Nuclear control of respiratory gene expression in mam- malian cells. J Cell Biochem. 2006;97:673–83.

22. Piantadosi CA, Suliman HB. Mitochondrial transcription factor A induction by redox activation of nuclear respiratory factor 1. J Biol Chem. 2006;281:324–33.

23. Suliman HB, Carraway MS, Welty-Wolf KE, Whorton AR, Piantadosi CA. Lipopolysaccharide stimulates mitochondrial biogenesis via acti- vation of nuclear respiratory factor-1. J Biol Chem. 2003;278:41510–8.

24. Gutsaeva DR, Suliman HB, Carraway MS, Demchenko IT, Piantadosi CA. Oxygen-induced mitochondrial biogenesis in the rat hippocampus.

Neuroscience. 2006;137:493–504.

25. Pesce V, Cormio A, Fracasso F, Vecchiet J, Felzani G, Lezza AM, Cantatore P, Gadaleta MN. Age-related mitochondrial genotypic and phenotypic alterations in human skeletal muscle. Free Radic Biol Med.

2001;30:1223–33.

26. Wei YH, Lee CF, Lee HC, Ma YS, Wang CW, Lu CY, Pang CY. Increases of mitochondrial mass and mitochondrial genome in association with enhanced oxidative stress in human cells harboring 4,977 bp-deleted mitochondrial DNA. Ann N Y Acad Sci. 2001;928:97–112.

27. Lee HC, Yin PH, Chi CW, Wei YH. Increase in mitochondrial mass in human fibroblast under oxidative stress and replicative cell senescence.

J Biomed Sci. 2002;9:517–26.

28. Liu CS, Tsai CS, Kuo CL, Chen HW, Lii CK, Ma YS, Wei YH.

Oxidative stress-related alterations of the copy number of mitochon- drial DNA in human leukocytes. Free Radic Res. 2003;37:1307–17.

at Swets Information Services Inc on August 31, 2007 jn.nutrition.org Downloaded from

29. Chang CM, Yu CC, Lu HT, Chou YF, Huang RFS. Folate deprivation promotes mitochondrial oxidative decay: DNA large deletions, cyto- chrome c oxidase dysfunction, membrane depolarization and superox- ide overproduction in rat liver. Br J Nutr. 2007;97:855–63.

30. Branda RF, Brooks EM, Chen Z, Naud SJ, Nicklas JA. Dietary modulation of mitochondrial DNA deletions and copy number after chemotherapy in rats. Mutat Res. 2002;501:29–36.

31. Crott JW, Choi SW, Branda RF, Mason JB. Accumulation of mitochon- drial DNA deletions is age, tissue and folate-dependent in rats. Mutat Res. 2005;570:63–70.

32. Joshi R, Adhikari S, Patro BS, Chattopadhyay S, Mukherjee T. Free radical scavenging behavior of folic acid: evidence for possible antiox- idant activity. Free Radic Biol Med. 2001;30:1390–9.

33. Rezk BM, Haenen GRMM, van der Vijgh WJF, Bast A. Tetrahydrofo- late and 5-methyltetrahydrofolate are folates with high antioxidant activity. Identification of the antioxidant pharmacophore. FEBS Lett.

2003;555:601–5.

34. Huang RFS, Hsu YC, Lin HL, Yang FL. Folate depletion and elevated plasma homocysteine promote oxidative stress in rat livers. J Nutr.

2001;131:33–8.

35. Jacob RA, Gretz DM, Taylor PC, James SJ, Pogripny IP, Miller BJ, Henning SM, Swendseid ME. Moderate folate depletion increases plasma homocysteine and decreases lymphocyte DNA methylation in postmenopausal women. J Nutr. 1998;128:1204–12.

36. Walzem RL, Clifford AJ. Folate deficiency in rats fed diets containing free amino acid or intact proteins. J Nutr. 1988;118:1089–96.

37. Evans WH. Isolation and characterization of membranes and cell organelles. In: Rickwood D, editor. Preparative centrifugation: a practical approach. New York: Oxford University Press; 1992. p.

233–70.

38. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–54.

39. Varela-Moreiras G, Selhub J. Long-term folate deficiency alters folate content and distribution differentially in rat tissues. J Nutr. 1992;122:

986–91.

40. Horne DW, Patterson D. Lactobacillus casei microbiological assay of folic acid derivatives in 96-well microtiter plates. Clin Chem. 1988;34:2357–9.

41. Shigenaga MK, Aboujaoude EN, Chen Q, Ames BN. Assays of oxidative DNA damage biomarkers 8-oxo-2(-deoxyguanosine and 8-oxoguanine in nuclear DNA and biological fluids by high perfor-

mance liquid chromatography with electrochemical detection. Methods Enzymol. 1994;234:16–33.

42. The National Center for Biotechnology Information (NCBI) [database on the internet]. Saccone,C;[cited 2006 Jul 06]. Unique AC_000022.2.

Available from: http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db¼ nucleotide&val¼110189662.

43. Simonetti S, Chen X, Dimauro S, Schon EA. Accumulation of deletions in human mitochondrial DNA during normal aging analysis by quanti- tative PCR. Biochim Biophys Acta. 1992;1180:113–22.

44. Lee HC, Pang CY, Hsu HS, Wei YH. Differential accumulations of 4,977 bp deletion in mitochondrial DNA of various tissues in human ageing. Biochim Biophys Acta. 1994;1226:37–43.

45. Yowe DL, Ames BN. Quantitation of age-related mitochondrial DNA deletions in rat tissues shows that their pattern of accumulation differs from that of humans. Gene. 1998;209:23–30.

46. Barazzoni R, Short KR, Sreekumaran NK. Effects of aging on mitochondrial DNA copy number and cytochrome c oxidase gene expression in rat skeletal muscle, liver, and heart. J Biol Chem. 2000;

275:3343–7.

47. Ji LL, Dillon D, Wu E. Myocardial aging: antioxidant enzyme systems and related biochemical properties. Am J Physiol. 1991;261:R386–92.

48. Madsen CS, Ghivizzani SC, Hauswirth WW. In vivo and in vitro evidence for slipped mispairing in mammalian mitochondria. Proc Natl Acad Sci USA. 1993;90:7671–5.

49. Perez-de-Arce K, Foncea R, Leighton F. Reactive oxygen species mediates homocysteine-induced mitochondrial biogenesis in human endothelial cells: modulation by antioxidants. Biochem Biophys Res Commun. 2005;338:1103–9.

50. Clayton DA. Replication of animal mitochondrial DNA. Cell. 1982;28:

693–705.

51. Sanchez-Cespedes M, Parrella P, Nomoto S, Cohen D, Xiao Y, Esteller M, Jeronimo C, Jordan RCK, Nicol T, et al. Identification of a mononucleotide repeat as a major target for mitochondrial DNA alterations in human tumors. Cancer Res. 2001;61:7015–9.

52. Kubo S, Nishikawa M, Hirohashi K, Tanaka H, Shuto T, Tamori A, Kinoshita H, Inoue M, Nishiguchi S. Multicentric occurrence of hepato- cellular carcinoma in patients with a somatic mutation of mitochondrial DNA and hepatitis C virus. Hepatol Res. 2003;25:78–82.

53. Lee HC, Li SH, Lin JC, Wu CC, Yeh DC, Wei YH. Somatic mutations in the D-loop and decrease in the copy number of mitochondrial DNA in human hepatocellular carcinoma. Mutat Res. 2004;547:71–8.

at Swets Information Services Inc on August 31, 2007 jn.nutrition.org Downloaded from