Mesenchymal stem cells tune the development of monocyte-derived dendritic cells toward to a myeloid-derived suppressive phenotype through GRO chemokines1
Running Title: MSCs direct the unity of MDSCs by GRO-
Hsin-Wei Chen*,†, Hsin-Yu Chen*, Li-Tzu Wang*,§, Fu-Hui Wang*, Li-Wen Fang¶, Hsiu-Yu Lai||, Hsuan-Hsu Chen*, Jean Lu#, Ming-Shiu Hung**, Yao Cheng*, Mei-Yu Chen*, Shih-Jen Liu*,†, Pele Chong*,†, Oscar Kuang-Sheng Lee||,††,‡‡, Shu-Ching Hsu*,§,§§,2
*National Institute of Infectious Diseases and Vaccinology, National Health Research Institutes, Miaoli, Taiwan
†Graduate Institute of Immunology, China Medical University, Taichung, Taiwan
§Graduate Institute of Life Sciences, National Defense Medical Center, Taipei,
Taiwan
¶Department of Nutrition, I-Shou University, Kaohsiung, Taiwan
||Institute of Clinical Medicine, National Yang-Ming University, Taipei, Taiwan
#Genomics Research Center, Academia Sinica, Taipei, Taiwan
**Institute of Biotechnology and Pharmaceutical Research, National Health Research Institutes, Miaoli, Taiwan
††Stem Cell Research Center, National Yang-Ming University, Taipei, Taiwan
‡‡Department of Orthopaedics and Traumatology, Taipei Veterans General Hospital,
Taipei, Taiwan
Chung-Hsing University, Taichung, Taiwan
1This study was supported by the following grants: VC-099-PP-01 and VC-100-PP-01
to HWC and VC-099-PP-03, VC-100-PP-03 and IV-101-PP-22 to SCH from the National Health Research Institutes. This work was also supported in part by the UST-UCSD International Center of Excellence in Advanced Bio-engineering sponsored by the Taiwan National Science Council I-RiCE Program under Grant Number NSC100-2911-I-009-101. We also acknowledge financial support from the Taipei Veterans General Hospital (VGH100D-003-2, VGH101E1-012, VGH101C-015 and VN101-07) and the National Science Council, Taiwan (NSC100-2120-M-010-001, NSC100-2314-B-010-030-MY3, NSC100-2321-B-010-019, NSC98-2314-B-010-001-MY3,NSC 100-2911-I-010-503, and NSC 99-3114-B-002-005) to OKSL. This study was also supported by a grant from the Ministry of Education, Aim for the Top University Plan.
2 Correspondence authors:
Dr. Shu-Ching Hsu, Ph.D., E-mail: [email protected] , Tel: +886-37-246-166 ext. 37707, Fax: +886-37-583-009.
Abbreviations: DC, dendritic cell; GRO, growth-regulated oncogene; MDDC, monocyte-derived DC; MSC, Mesenchymal stroma/stem cell; CM, MSC-conditioned medium; MDSC, myeloid-derived suppressor cell; ARG-1, arginase 1; NOS2, nitric oxide synthase 2; MMP9, matrix-metallopeptidase-9.
Abstract
Mesenchymal stem/stromal cells (MSCs) are promising potential candidates for the treatment of immunological diseases because of their immunosuppressive functions. However, the molecular mechanisms that mediate MSCs’
immunosuppressive activity remain elusive. Here, we report, for the first time, that secreted growth-regulated oncogene (GRO) chemokines, specifically GRO-, in human MSC-conditioned media have an effect on the differentiation and the function of human monocyte-derived dendritic cells (MDDCs). The MDDCs were driven toward a myeloid-derived suppressor cell (MDSC)-like phenotype by the GRO chemokines. GRO--treated MDSCs had a tolerogenic phenotype that was
characterized by an increase in the secretion of IL-10 and IL-4 and a reduction in the production of IL-12 and IFN-. We have also shown that the mRNA expression levels of the ARG-1 and iNOS genes, which characterize MDSCs, were up-regulated by GRO--primed mouse bone marrow-cells. Additionally, the ability of GRO--treated MDSCs to stimulate the OVA-specific CD8+ T (OT-1) cell proliferation and the
cytokine production of IFN- and TNF- were significantly decreased in vivo. Our findings allow a greater understanding of how MDSCs can be generated and offer new perspectives to exploit the potential of MDSCs for alternative approaches to treat
chronic inflammation, autoimmunity as well as for the prevention of transplant rejection.
Introduction
Mesenchymal stem/stromal cells (MSCs) have been isolated and characterized by their adherent properties, surface phenotype, and capacity for controlled self-renewal. They have the potential to differentiate into cartilage, bone, tendon, adipose tissue, and muscle in vitro . MSCs are attractive candidates for tissue engineering as well as for cell and gene therapy because of their immunological activity and ability to preferentially migrate to sites of inflammation or tissue injury . Therapeutic approaches that used allogeneic MSCs have yielded promising results in osteogenesis imperfecta, graft-versus-host disease (GVHD), myocardial infarction, and organ transplantation in animal models or in the clinic . Studies analyzing the immunomodulatory properties of MSCs have established their beneficial role in both regenerative and immunoregulatory cell therapy . MSCs have been show to modulate naïve and effector T lymphocytes, B lymphocytes, dendritic cells (DCs),
macrophages, and natural killer cells (NKs) through direct cell-cell contact or MSC-derived soluble factors. However, the specific molecular mechanisms by which MSCs regulate these immune cells remain unknown.
DCs play a critical role in the induction of the adaptive immune response, alloantigen elimination, and transplant rejection. Previous studies have reported that
DCs are sensitive to the immunosuppressive effects of MSCs. Several well-studied regulatory mediators, such as prostaglandin E2 (PGE2), indoleamine 2,3-dioxygenase (IDO), IL-6, and IL-10, contribute to the immunosuppressive properties of MSCs . However, the regulation of the differentiation and cellular properties of DCs by MSCs are still unclear. In the present study, the mechanisms that underlie the MSC-mediated suppression of DC differentiation were evaluated.
The subgroup of growth-regulated oncogenes (GROs), consisting of
CXCL1/GRO-, CXCL2/GRO-, and CXCL3/GRO-, contain a Glu-Leu-Arg (ELR) motif and belong to the IL-8 angiogenic cytokine family. This subfamily was
originally discovered in human melanoma cell lines . Currently, there is even little information available on the biological activity of GRO chemokines. Binding to their cognate receptors, which are G protein-coupled receptors that are characterized as CXCR2, can activate leukocyte migration, enhance the chemotaxis of endothelial cells, regulate inflammation, and angiogenesis that is associated with tumorigenesis , mediate cell cycle arrest in monocytes and activate cell migration by neutrophils . However, the effect of GRO- on MDDCs and downstream effects on T-cell responses have not been explored.
Myeloid-derived suppressor cells (MDSCs) represent a heterogeneous population of early myeloid progenitors/precursors of granulocytes, macrophages, and
dendritic cells. MDSCs are commonly characterized by the expression of the myeloid lineage markers Gr-1 and CD11b, and these cells are thought to play a critical role in tumor immune escape, autoimmune diseases, transplant rejection as well as in chronic inflammation and infection because of their ability to suppress T-cell effector
functions by up-regulating the expression of immunosuppressive factors, such as arginase 1 (ARG-1) and nitric oxide synthase 2 (NOS2) in mice . However,
generating stable and safe MDSCs ex vivo and selecting optimal approaches for cell-based therapies are still major challenges. We observed that MSCs secrete elevated levels of GRO-. Therefore, the aim of this study was to investigate the role of GRO chemokines in the function and differentiation of MDDCs. We demonstrated that GRO chemokines that were secreted from MSCs inhibited the differentiation and function of MDDCs and drove their differentiation toward a MDSC-like
immunophenotype both in vitro and in vivo. The results from this study offer novel insights into the potential therapeutic platform that is effective to generate MDSCs capable of suppressing uncontrolled immune activation.
Material and Methods
Mice
C57BL/6 (H2b) mice and BALB/c (H2d) were purchased from the National
Laboratory Animal Center, National Applied Research Laboratories, Taiwan. C57BL/6 (H2b)/OT-1 transgenic mice (transgenic for the TCR-specific peptide
OVA257-264, SIINFEKL) were a gift from Dr. John Kung, Academica Sinica, Taiwan.
Six- to eight-week-old mice were used for this study. All animal experiments were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee of the National Health Research Institutes. (Protocol Number: NHRI-IACUC-100003, and NHRI-IACUC-097077-A)
Reagents
Recombinant human GRO-, GRO-, GRO-, IL-4, GM-CSF and
recombinant mouse GM-CSF were purchased from PeproTech Inc. (Rocky Hill, NJ, USA). Recombinant mouse GRO-, GRO-, and GRO- were purchased from R&D Systems (Minneapolis, MN, USA).
N-(2-Hydroxy-4-nitrophenyl)-N′-(2-bromophenyl) urea (SB225002) was obtained from Calbiochem (San Diego, CA, USA). Lipopolysaccharide (LPS, from E. coli 055:B5) was obtained from Sigma-Aldrich (St. Louis, MO, USA). R-Phycoerythrin (PE)-labeled mouse anti-human
CD11c, HLA-DR and CD83 antibodies were obtained from eBioscience (San Diego, CA, USA). Fluorescent isothiocyanate (FITC)-conjugated mouse anti-human CD86, DC-SIGN, CD40, and CD80 antibodies were purchased from BioLegend (San Diego, CA, USA).
Preparation of MSC-conditioned medium (MSC-CM)
Umbilical mesenchymal stem cells (uMSCs) were purified from cord blood and characterized as reported previously . The uMSCs were growth in expanded medium that contained α-MEM with 10% ES-FBS (HyClone, Logan, UT, USA) then maintained for one more passages in medium that was supplemented with pooled AB-type human serum (Invitrogen, Carlsbad, CA, USA). Each passage was 5 days in duration. The cultured uMSCs (3×105) were re-seeded in 15 mL of α-MEM medium
with 10% pooled AB-type human serum for 5 days which condition have been used as the same as human DCs in vitro differentiation. The supernatant collected from the final uMSC cultures was centrifuged at 300 × g, for 10 minutes at 4°C to remove cellular debris. This supernatant was subsequently used as MSC-conditioned medium (MSC-CM). Human serum containing medium without uMSC cultured was used as control cultured medium.
The cytokines secretion profile of uMSCs was determined using the Human Cytokine Array C Kit (RayBio, Redwood City, CA, USA) according to the
manufacturer’s instructions. The chemiluminescent signal was detected using an
ECL system (Amersham Pharmacia Biotech, Aylesbury, UK) and the signal intensity was quantified by spot densitometry using an AlphaImager 1220 Analysis and
Documentation System (Alpha Innotech, Braintree, UK). Each spot signal was
corrected for the adjacent background intensity and normalized to the positive control sample on the membrane.
Generation of human MDDCs
CD14+ monocytes were isolated using the human CD14+ Cell Isolation Kit
(MACS, Miltenyi Biotec, Inc., Auburn, CA, USA) according to the manufacturer’s instructions. The purified CD14+ cells were cultured in MSC-CM or -MEM
complete medium that was supplemented with pooled AB-type human serum, rhGM-CSF (80 ng/mL), and rhIL-4 (80 ng/mL) (Peprotech, NJ) in the presence or absence of GRO chemokines to induce differentiation of the cells into DCs. An additional 1 mL of medium that contained the same concentrations of rhGM-CSF and rhIL-4 with or without GRO chemokines was added to each group of cells on day 3. Half of the volume of the culture medium was removed and replaced with an equal volume of cultured medium that contained the same concentrations of rhGM-CSF and rhIL-4 on day 5. Maturation of
MDDCs (mature DCs, mMDDCs) was induced by adding 1 μg/mL of LPS to the culture medium of the iMDDCs on day 5 then subsequently cultured for another 48 h. The study protocols were approved by the Institutional Review Board of Human Subject Research Ethics Committee of Academia Sinica (AS-IRB01-10113) and the Institutional Review Board of Research Ethics Committee of National Health Research Institutes (EC1001101).
FACS analysis
The phenotypic profiles of monocytes, iMDDCs and mMDDCs were analyzed by staining 1×105 cells with fluorochrome-labeled antibodies (Abs) against
CD11c, HLA-DR, CD80, CD86, CD83, CD40, and DC-SIGN. The fluorescence intensity was measured by flow cytometry. The following corresponding isotype-matched controls were used: FITC-IgG1, FITC-IgG2a, PE-IgG2a, and PE-IgG2b (BD Biosciences, San Jose, CA, USA). Surface-labeled cells were analyzed using a FACS Calibur-flow cytometer (BD Biosciences). For cell purification, sorting was
performed using a FACS Aria cell sorter (BD Biosciences). The purity of individual sorted cell populations was greater than 95%.
Endocytosis test
Differentiated cells only (iDCs, 5×104 cells), differentiating DCs which either
supplement with MSC-CM (iDC+CM), or co-cultured with μMSCs in 24 well trans-well plate (iDC+MSC) were collected and then incubated in RPMI-1640 medium with 1 mg/mL of FITC-dextran for 30 min at 37°C then fixed with 1%
paraformaldehyde. The endocytosed signal within the cells was analyzed by FACS. The data analysis was performed using the FlowJo version 5.7.2 software. The signal obtained for the cells incubated with medium without FITC-dextran was used as a negative control.
Mixed-lymphocyte reaction (MLR) assay
Monocyte-derived cells (3×104) at different stages of differentiation were
irradiated with 30 Gy using an X-ray biological irradiator (X-ray R-2000, Rad Source Technologies, Inc., Alpharetta, GA, USA) and then cultured with purified allogenic CD3+ T cells (3×105). For the allogenic T-cell response in mouse system,
splenocytes (1×105) harvested from BALB/c (H2d) mice were reacted with or
without X-ray irradiated splenocytes (1×105) isolated from C57BL/6 (H2b) in
the presence of either BMDC (1×104) or GRO- treated BMDCs (1×104). After
72 h of incubation, [3H]-thymidine (1 μCi) was added to each well and the cell
cultures were harvested using a Filtermate 96-well harvester followed by a 16 h
a Packard microplate scintillation and luminescence counter (Perkin-Elmer-Packard; Waltham, MA, USA).
Preparation of GROγ knock-down MSCs
Lentiviral systems for gene silencing were obtained from the Taiwan National RNAi Core Facility. Sequences of short hairpin RNA (shRNA) in the pLKO.1 vector are the following: pLKO.1-shluc (target sequence,
GCGGTTGCCAAGAGGTTCCAT-3’), pLKO.1- shGRO--2 (target sequence, 5’-ACATCCAAAGTGTGAATGTAA-3’), and pLKO.1- shGRO--4 (target sequence, 5’-CCTCAAGAACATCCAAAGTGT-3’). Lentiviruses were collected from media of 293FT cells cotransfected with pLKO.1-derived plasmids and packaging vectors pCMVdelR8.91 and pMD.G according to the protocols provided by the Taiwan National RNAi Core Facility.
MSCs (2× 104 cells) were pre-seed in 24-well plates for 16 h then infected
with lentiviruses at a multiplicity of infection (MOI) of 8 PFU per cell in the presence of protamine sulfate (8 μg/ml, Sigma). Mock MSCs, shLeu-none-target MSCs, and
GRO- targeting MSCs (shGRO--2, and shGRO--4) were incubated for further
24 h and then replaced culture media with the puromycin (5 μg/ml) containing media for 2 days. The surviving MSCs were pooled and amplified for use in subsequent experiments. Sequentially, human peripheral CD14+ monocytes were added to mock
MSCs or virus-infected MSCs, and iMDDC process were performed in DC complete culture media. Suspended cells were collected for further endocytosis assay and supernatants were determined for GROγ cytokine by commercial Enzyme-linked immunosorbent assay (Antigenix America, NY, USA).
RNA preparation and quantitative RT-PCR
Total RNA was extracted using the Trizol reagent and was converted to cDNA using a ReverTra Ace set (Toyobo Life Science, Osaka, Japan), according to the manufacturer’s instructions. Real-time PCR analysis was performed using an ABI Prism 7900 system (Applied Biosystems, Foster City, CA, USA). Samples were subjected to the following PCR program: 5°C for 2 min, 94°C for 10 min, and 40 cycles of 95°C for 15 s and 60°C for 1 min. Analyses were performed in triplicate. For each sample, the cycle threshold (Ct) value was determined. The results were normalized to the levels of the GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene on the same plate. The level of mRNA expression for different cell groups was calculated using the 2ΔCt method. Primers specific for each gene were designed, and their sequences are as follows: human GAPDH, GAGTCAACGGATTTGGTCGT (forward primer, F), TTGATTTTGGAGGGATCTCG (reverse primer, R); human IL-10, ATGCCCCAAGCTGAGAACCAAGACCC (F),
CGCCTTGCACGTCTAGTTCTG (F), TGACCTTTGCCCCACACAT (R); human matrix-metallopeptidase-9 (MMP-9), GAAGATGCTGCTGTTCAGCG (F),
ACTTGGTCCACCTGGTTCAA (R); human IL-4,
GGCAGTTCTACAGCCACCATG (F), GCCTGTGGAACTGCTGTGC (R); human IL-12p40, CGGTCATCTGCCGCAAA (F),
CAAGATGAGCTATAGTAGCGGTCCT (R); human TNF-,
GGTGCTTGTTCCTCAGCCTC (F), CAGGCAGAAGAGCGTGGTG (R); human IFN-, CCAACGCAAAGCAATAGCTGC (F), CGCTTCCCTGTTTTAGCTGC (R); human Cox2, CGGTGAAACTCTGGCTAGACAG (F),
GCAAACCGTAGATGCTCAGGGA (R); human PD-L1,
TATGGTGGTGCCGACTACAA (F), TGCTTGTCCAGATGACTTCG (R); human PD-L2, TGACTTCAAATATGCCTTGTTAGTG (F),
GAAGAGTTCTTAGTGTGGTTATATG (R); human TGF-,
GCAGAAGTTGGCATGGTAGC (F), CCCTGGACACCAACTATTGC (R); human IL-6, ATTCTGCGCAGCTTTAAGGA (F), AACAACAATCTGAGGTGCCC (R); IL-1, ACGAATCTCCGACCACCACT (F), CCATGGCCACAACAACTGAC (R); mouse GAPDH, GATGCAGGGATGATGTTC (F), TGCACCACCAACTGCTTAG (R); mouse Arginase 1(Arg-1), CTCCAAGCCAAAGTCCTTAGAG (F),
AAAGTGACCTGAAAGAGGAAAAGGA (F),
TTGGTGACTCTTAGGGTCATCTTGTA (R); mouse IFN-, CATTGAAAGCCTAGAAAGTCTGAATAAC (F),
TGGCTCTGCAGGATTTTCATG (R).
Enzyme-linked immunosorbent assay (ELISA)
Supernatants from the MDDCs alone (5×104), CD3+ purified T cells alone
(isolated using the human CD3+ Cell Isolation Kit, MACS, Miltenyi Biotec, Inc.,
5×105), or MDDCs (5×104) that were co-cultured with CD3+ purified T-cells (5×105)
were harvested. The concentrations of IL-4, IL-10, IL-12, INF-, IL-6 and TNF- in the supernatant were determined in triplicate using commercial ELISA kits according to the manufacturer’s protocol (R&D systems).
IDO activity assay
The biological activity of IDO can be determined by measuring the level of kynurenine in culture supernatants which modified from previously described . Briefly, culture supernatants, or standard samples defined kynurenine concentration (0-160 μM), was mixed with 30% trichloroacetic acid and centrifuged at 2000 × g for 10 min. Mixed 75 μl of the suspension with the equal amount of Ehrlich reagent (100 mg of p-dimethylbenzaldehyde in 5 ml of glacial acetic acid) in a 96-well plate then the absorbance of optical density (OD) was measured at 492 nm. Thus, the
concentration of kynureninein in determined samples could be calculated according to the standard curve.
Arginase activity assay
Arginase activity was measured in cell lysate using commercial arginase assay kits according to the manufacturer’s protocol (Abnova systems, Taipei City, Taiwan). In brief, lyse cell pellets for 10 min in 100 μL of 10 mM Tris-HCl (pH 7.4) containing 1 μM pepstatin A, 1 μM leupeptin, and 0.4% (w/v) Triton X-100.
Centrifuge lysates at 14,000g at 4°C for 10 min. Subsequently, arginine substrate buffer was added to the supernatant and incubated at 37°C for 2 hours. The reaction was stopped then the concentration of urea was determined by reading OD at 430nm. Protein extraction and Western blot analysis
Cells (2×106/well) were lysed, and protein concentration in the supernatant
was determined by BCA kit (Thermo Fisher Scientific, Rockford, IL, USA). Protein samples (20μg /lane) were resolved by 5–20% SDS-PAGE and transferred to
nitrocellulosemembranes (GE Healthcare) according to the manufacturer’s
instructions. The expression of MMP9 (BD Biosciences), COX-2 (Santa Cruz), and
IDO (Santa Cruz) and β-actin (Sigma-Aldrich) were determined in human MDDC, the expression level of iNOS and arginase-1 (BD Biosciences) in mouse BMDC were
also detected. The quantification of expression profile was manipulated by Image J software.
Confocal microscopy
MDDCs (5×104) were plated onto a poly-L-lysine-coated glass slide and
fixed by adding 1% paraformaldehyde (Sigma-Aldrich). Cells were then incubated with anti-human IDO antibody (Chemicon Inc., Temecula, CA, USA) and the DyLight 488 conjugated secondary antibody (Sigma-Aldrich). The slides were mounted with 10% Glycerol/PBS and sealed with nail polish. Fluorescent images were captured using a Leica TCS SP5 camera (Leica Camera AG, Solms, Germany). Generation of mouse BMDCs
Murine bone marrow cells were harvested and differentiated into dendritic cells (BMDCs) as previously described . BM cells (2×105 cells/mL) were cultured in
RPMI-1640 medium that contained 20 ng/mL of recombinant mouse GM-CSF in the presence or absence of the recombinant mouse GRO chemokine. On day 3, half of the volume of the culture medium was removed and replaced. On day 6, BMDCs from the different treatment groups were collected from each dish, washed and
characterized.
Assay to measure the immunosuppressive activity of mouse GRO-treated cells in
The in vitro immunosuppressive activity of the GRO--treated cells was evaluated by measuring the inhibition of the proliferation of purified, OVA-specific OT-1 CD8+ T cells stimulated with OVA-primed DCs. Mouse (C57BL/6) BMDCs
were differentiated in the presence or absence of GRO- collected on day 6, and then re-suspended in LCM medium (RPMI 1640 supplemented with 5% FBS, 50 μg/mL Gentamicine, 20.25 mM HEPES, 50 μM 2-ME, 100 U/mL penicillin, and 100 μg/mL streptomycin). OT-1 CD8+ T cells (2×105 cells/well) were collected by cell sorting
using a FACS Aria flow cytometer. These cells were cultured alone or with BMDCs (1×105 cells/well) or BMDC/GRO- cells (1×105 cells/well) in the presence of either
the OVA257-264 CTL peptide epitope (1 μg/mL) or in the presence of a human
papilloma virus 16 E749-57 peptide (RAH control peptide) (1 μg/mL). The cultures
were maintained in 200 μL of LCM medium in 96-well U-bottom microplates.
Cultures were incubated at 37°C in a 5% CO2 incubator for 3 days. Subsequently, [3H]
thymidine (1 μCi) was added to each well followed by a 16 h incubation. Cells were harvested using a semi-automated sample harvester, and the radioactivity (cpm) was measured to quantify cell proliferation using a Packard microplate scintillation and luminescence counter.
For the in vivo immunosuppression assay, mouse BMDCs that were exposed to different treatments were prepared on day -6. OT-1 splenocytes (4×107/mouse)
were prepared and administered intravenously into 6-8-week-old X-ray pre-irradiated (2 Gy) B6 mice on day -1. BMDCs that were differentiated in the presence or absence of GRO- were collected and incubated with or without the OVA257-264 peptide (1
μg/mL) at 37°C for 1 h. The cells were then washed to remove unbound peptide on the day of injection. The various BMDC preparations (5×104 cells /mouse) were
subcutaneously injected into OT-1 splenocyte-reconstituted B6 mice to initiate antigen-specific activation on day 0 in vivo. Mice from each group that were treated with HBSS, BMDCs, BMDCs/GRO-, BMDCs/OVA257-264, or
BMDCs/GRO-/OVA257-264 were sacrificed on day 7. Splenocytes (2×105 cell/well) harvested from
individual mice were stimulated with the OVA257-264 (1 μg/mL) or an RAH control
peptide (1 μg/mL) in 96-well U-bottom plates. Cultures were incubated at 37°C in 5% CO2 for 12, 36, and 60 h. The proliferation of splenocytes from the HBSS group or
the different groups of BMDC-primed mice was determined by 3H-thymidine
incorporation. Assays were performed in duplicate. Representative data from groups of three mice from three independent experiments are presented.
Statistical analysis
Statistical analyses were performed using GraphPad Prism, version 5.02 (GraphPad Software, Inc.). The data are presented as the mean ± standard error of the mean (SEM) from at least three independent experiments. The statistically significant
differences between the groups were assessed using a one-tailed Student’s t-test. We considered p-values < 0.05 to be significant. The degree of significance is indicated as follows: *, P < 0.05; **, P < 0.01; ***, P < 0.001.
Results
MSC-conditioned medium exerts a suppressive effect on MDDC differentiation and function
We established a standard operating procedure in vitro to induce the differentiation of human CD14+ monocytes into MDDCs and established assays to
characterize the phenotypes of myeloid cells at each stage of their differentiation pathways as shown in Figure 1. To investigate whether the MSC-CM affected the differentiation of MDDCs, the normal culture medium was replaced with MSC-CM during the differentiation and maturation process of human CD14+ cells. We observed
a significant reduction in the surface expression of CD40, CD80 HLA-DR, CD11c, DC-SIGN, and CD83 on immature MDDCs (iDCs) that were treated with MSC-CM compared to untreated iDCs (Fig. 2A, upper panel). Similar results were obtained for mature MDDCs (mDCs) (Fig. 2A, lower panel). To further examine if the MSC-CM affected the endocytic activity of iDCs, iMDDCs which differentiated in the presence or absence of collected MSC-CM, or differentiated iMDDCs cultured with MSCs in the separated trans-well condition have been prepared. The capability of FITC-dextran uptake for various treatments of iDCs was further analyzed by flow
cytometry. The results revealed that both of the endocytic ability of iDCs from the MSC-CM and the trans-well cultured with MSCs treated groups were significantly reduced compared to controls (Fig. 2B). In addition, the capacity of the mDCs to stimulate allogeneic T-cell proliferation in a mixed-lymphocyte reaction was also down-regulated in the MSC-CM cultured mDCs (Fig. 2C). These results show that MSC-CM exhibits a suppressive effect on MDDC differentiation and functionality.
GRO- plays a key role in mediating the inhibitory effects of MSCs on the differentiation and function of MDDCs
Next, we investigated which soluble factors in the MSC-CM were
responsible for the observed suppressive activity on the differentiation of MDDCs. A significant increase in the GRO chemokine concentration was detected in the MSC-CM by the human cytokine array analysis (Fig. 3A). We further examined the biological effects of the different isoforms of GRO on the phenotype of human iMDDCs. GRO-, , and were analyzed, and it was determined that only GRO- and GRO- had significant inhibitory effects on CD40 expression (Fig. 3B). Because there was only a very minor increase in the intensity of GRO- in the
cytokine/chemokine array (Fig. 3A), we focused our study on GRO- in subsequent experiments. To further confirm the effect of GRO- present in MSC-CM on MDDC differentiation, we showed that the suppressive effect of the conditioned medium on
iDCs and mDCs was partially reversed with the anti-GRO--antibody but not by the corresponding isotype control (Fig. 3C). In the presence of the neutralizing antibody, the surface level expression of CD80, DC-SIGN, and CD83 on iDCs was significantly increased compared to cells that were treated with the isotype control or MSC-CM. The anti-GRO- antibody also substantially reversed the suppressive effect of the MSC-CM on the surface expression of CD80, CD11c, DC-SIGN, and CD40 on mature DCs (Fig. 3C, lower panel).
In addition to the neutralizing effect of anti-GRO- on the cellular properties of MDDCs, we have also prepared the GRO- targeting MSCs to culture with
differentiated iDCs in order to verify the roles of GRO- in regulating the immune function of MSCs during DCs’ differentiation. The amount of secreted GRO- in the supernatants of iDCs combined with two independent GRO- silenced clones, either shGRO--2 or shGRO--4, was significantly reduced compared to the mock control MSCs and the lentiviral control infected MSCs (Fig 4A). The endocytic activity of CD14+ iDC in the absence or presence of various shRNA treated MSCs was
determined by measuring the cellular cytofluorimetry intensity after dextran-FITC uptaken. The percentage of endocytotic cells in differentiated iDC alone was 75%, and the capability of antigen up-taken was down to around 39% in those either mock MSCs or shLeu-infected MSCs contacted iDCs. Therefore, both of the shGRO--2
and shGRO--4 targeting MSCs showed the little decline of endocytic pattern compared to those control iDCs (Fig 4B). The means and standard deviations obtained from three independent experiments are shown in Fig 4C.
The ability of recombinant GRO- to inhibit the differentiation of MDDCs and to suppress their functions was then evaluated. In the presence of the recombinant GRO- during monocyte-iDC differentiation, the surface expression of CD40, CD80, CD86, CD11c, CD83, and DC-SIGN on iDCs was significantly reduced compared to the expression levels on cells that were cultured in the absence of GRO- (Fig. 5A, upper panel). Similar results were observed with mDCs except that the expression of DC-SIGN was not affected by the addition of GRO- (Fig. 5A, lower panel). The addition of SB225002, which is a CXCR2 inhibitor, to the culture medium significantly reversed the suppressive effect of GRO- on the expression of these select surface markers on both iDCs and mDCs (Fig. 5A). Again, the expression of DC-SIGN on iDCs and mDCs was not affected by the addition of SB225002. GRO- also significantly down-regulated the endocytic activity of iDCs and reduced the ability of mDCs to stimulate T-cell proliferation in the MLR. These effects were also reversed by the addition of SB225002 to the culture (Fig. 5B-C). Thus, these data demonstrate that the GRO- secreted by MSCs plays a key role in suppressing the differentiation and function of MDDCs.
GRO- drives the differentiation of MDDCs toward a myeloid-derived suppressor cell-like immunophenotype
In addition to the suppressive effects of GRO- on the differentiation and function of MDDCs, this chemokine influences the cytokine expression profile during MDDC differentiation. Real-time PCR was performed to examine the relative mRNA levels of selected genes expressed by MDDCs in 7-day cultures. These results showed that the expression levels of inflammatory cytokine genes, such as TNF-, IFN-, and IL-12, were significantly down-regulated during the differentiation of MDDCs in the presence of GRO-. The expression levels of the IL-10, IL-4, TGF-, IL-1, and IL-6 cytokine genes and the genes encoding COX2, matrix metallopeptidase 9 (MMP-9), programmed death ligands (PD-L1 and PD-L2), and IDO were significantly up-regulated (Fig. 6A). Human MDSCs are characterized by their ability to secrete IL-10, IL-4, IL-1 and IL-6 and to express COX2, PD-L1, PD-L2, MMP-9 and IDO . This real-time PCR data revealed that treating MDDCs with GRO- increased the expression of these MDSC marker genes compared to untreated MDDC controls (Fig. 6A). The protein expression levels of MMP9, COX-2, and IDO were increased up to nearly two fold in GRO- treated MDDCs compared to those untreated MDDCs (Fig 6B, left panel). Intracellular staining with the anti-IDO antibody showed an increase in the intracellular expression of IDO by iDCs that were differentiated in the presence
of GRO- (Fig. 6B, right panel). Additionally, the quantity of kynurenine, the most prominent intermediate product of tryptophan catabolism by IDO, in culture supernatants of iDC in the present or absence of GRO- with or without SB225002 was revealed. Not only the expression of IDO protein was improved in GRO- treated DC, but the tryptophan degraded activity was increased in DC+ GRO- cells (Fig. 6C) These results indicate that GRO- suppresses MDDC differentiation and skews cell differentiation toward a MDSC-like immunophenotype.
GRO--primed MDDCs drive T-cell differentiation toward a tolerogenic immunophenotype
To further investigate the effects of GRO--treated MDDCs on T-cell
responses, the human CD3+ T cells were purified and exposed to autologous irradiated
MDDCs that were either treated or untreated with GRO-. The RNA of CD3+ T cells
which isolated from the T/MDDCs mixtures was then extracted and the expression of selected cytokine genes was assessed using real-time PCR. We found that higher levels of expressed IL-4 and IL-10 but lower levels of IFN- and IL-12 were expressed by GRO--primed MDDCs co-cultured T cells (Fig. 7A). The cytokine profile of the MDDCs/T cells co-culture medium was also analyzed by ELISA. Consistent with the real-time PCR data, we found that the levels of secreted IL-4 and IL-10 were significantly elevated in the supernatants from the T cells co-cultured with
GRO--primed MDDCs. The concentration of IL-12 and IFN- in the co-culture medium was significantly reduced by the presence of GRO--primed MDDCs (Fig. 7B). These data suggest that GRO--primed MDDCs can drive T cells toward a more tolerogenic phenotype.
GRO--treated BMDCs showed MDSC-like characteristics both in vitro and in
vivo
To further investigate the function of GRO- primed DCs in vivo, we studied the differentiation of DCs in the presence or absence of GRO- in the mouse system. Differentiated BMDCs were collected and stained for mouse MDSC markers using CD11b and Gr-1 fluorescent antibodies (Fig. 8A). The expression of the ARG-1 and inducible NO synthase (iNOS) genes, which are known to be up-regulated in MDSCs and function to inhibit T-cell proliferation and apoptosis in mice , was further
analyzed in the CD11b+Gr-1+ sorted cells. As expected, the mRNA levels of ARG-1
and iNOS were elevated in GRO--treated BMDCs (Fig. 8B), and the protein
expression level of Arg-1 and iNOS were up-regulated in BMDCs in the presence of GRO- (Fig. 8C). The addition of the CXCR2 inhibitor SB 225002 reversed the induction of both of these genes in the GRO--treated BMDCs. Moreover, the arginase activity and the production of nitrate were significantly increased in GRO- containing BMDCs (Fig. 8D). These data indicate that the functional changes in the
properties of GRO- treated BMDCs mediate the immunosuppressive functions. Next, we used an ovalbumin (OVA)-specific challenge system to assess whether the MDSCs that are induced by GRO- treatment ex vivo were tolerogenic in vitro and in vivo. OT-1/CD8+ sorted T cells were stimulated with GRO--treated or
untreated BMDCs in the presence of the OVA257-264 peptide. T-cell proliferation was
then measured by [3H]-thymidine incorporation. The results revealed that the
proliferation of the OT-1/CD8+ T cells stimulated by in vitro differentiated BMDCs in
the presence of OVA257-264 peptide that was pulsed on day 3 were down-regulated by
GRO--primed-BMDCs (Fig. 8E, left panel).In order to elucidate whether GRO- treated BMDCs play an actively suppressive roles in controlling the proliferating activity of lymphocytes, the BALB/c (H2d) splenocytes have been stimulated with
irradiated C57BL/6 (H2b) splenocytes in the presence of GRO-- or none-GRO-
BMDCs. Our results showed that the reduction of proliferating activity only denoted by the GRO- treated BMDCs but not represented by the BMDCs group in the allogenice MLR (Fig. 8E, right panel).
The suppressive effect of the GRO--generated MDSCs on T cells was then tested in vivo. A schematic experimental flowchart that was designed to assess the function of GRO--generated MDSCs is shown in Fig. 8F. Bone marrow cells were
differentiated in the presence or absence of GRO- for 6 days. The various
preparations of BMDCs were collected and subcutaneously injected into the OT-1 splenocytes-adapted B6 mice. Mice immunized with different OVA257-264
peptide-pulsed BMDC cultures were then sacrificed on day 7. Splenocytes from immunized mice were collected and stimulated with the OVA257-264 peptide in vitro for 12, 36 and
60 h. The results revealed that the proliferation of the OVA257-264 peptide-stimulated
splenocytes from mice injected with the GRO--primed BMDCs was significantly reduced compared to cells from mice that received injection with control BMDCs after OVA257-264 peptide re-stimulation at 60 h (Fig. 8G). The supernatants from the
OVA257-264 peptide-stimulated splenocytes from the different experimental groups
were also analyzed for cytokine secretion by ELISA. We observed reduced levels of IFN- and TNF- in the supernatants from the GRO--primed BMDC group
compared to the untreated BMDC group (Fig. 8H). These data show that GRO--primed iDCs exhibit an MDSC-like phenotype and function in vivo.
Discussion
MSCs reside in the bone marrow and can be mobilized into the bloodstream to migrate to sites of inflammation and injury in various organs and tissues. More importantly, MSCs modulate the cellular development and biological functions of different types of cells of the innate and adaptive immune system in vitro and in vivo . Therefore, the immunoregulatory properties of MSCs not only contribute to their role in tissue repair and regeneration but also to their antimicrobial effector functions . The secretion of various cytokines/chemokines and the expression of the
corresponding cytokine receptors by MSCs either alone or by interaction with other cellular effectors have been demonstrated in MSC maintenance cultures and after stimulation of MSCs . These data indicate that the fate and biological function of both MSCs and cells that they interact with are determined by the cytokine network in their local microenvironment after interacting with other cells. It has also been documented that MSCs block the differentiation of monocytes and CD34+ progenitors into CD1a+
DCs and inhibit the function of these cells which partially mediated by soluble factors, such as IL-6, M-CSF, PGE2, and IL-10 . Chiesa et al. showed that MSCs
cell priming capability of the DCs. MSCs have also been shown to inhibit the formation of immune synapses by disrupting the distribution of actin within DCs . Therefore, the inhibitory effects of the soluble factors secreted by MSCs on DCs need to be further explored. In the present study, we found that small quantities of GRO- and large amounts of GRO- chemokines were present in MSC-CM (Fig. 3A), that the suppressive activity of MSC-CM on the differentiation of human MDDCs was
significantly reduced when GRO--specific neutralizing antibodies were present (Fig. 3C), the endocytic activity of CD14+ iDC was affected by contacting with GRO-
expressed MSCs but not shGRO- treated MSCs (Fig. 4), and that the addition of GRO- to MDDC cultures directed the differentiation of these cells toward an MDSC immunophenotype (Fig. 5 and Fig. 6). This is the first report that demonstrates that GRO directly contributes to the immunomodulatory properties of MSCs by altering the biological activity of differentiated myeloid cells.
The fate of the differentiated cells of the myeloid lineage critically influences the immune response. In our study, the expression of surface markers, the ability of iDCs to take-up antigen, and the reactivity of the mixed-lymphocyte reaction
mediated by human MDDCs were all inhibited by GRO chemokines. This inhibition was reversed in the presence of the CXCR2 specific inhibitor, SB225002 (Fig. 5A, 5B, and 5C). In contrast, the expression levels of MDSC-related genes, such as
COX2, MMP-9, PD-L1, PD-L2, and IDO in human MDDCs (Fig. 6A and 6B) and Arg-1 and iNOS in mouse BMDCs (Fig. 8B and 8C), were up-regulated in GRO-treated cells. Furthermore, adding SB225002 to GRO-GRO-treated cells reduced the gene expression of Arg-1 and iNOS (Fig. 8B) and also prevented the initiation of the immunosuppressive activity of these cells (Fig. 5C). For the first time, we have shown that GRO- could drive the differentiation of human MDDCs and mouse BMDCs toward an MDSC-like phenotype. GRO- induced MDSC-like cells that were generated ex vivo were able to inhibit the immune response of autologous T
lymphocytes and reduce the secretion of inflammatory cytokines, such as IFN- and TNF- (Fig. 7B and Fig. 8H). Our data suggest that myeloid-derived cell
differentiation may be regulated by local levels of GRO chemokines in the peripheral blood and bone marrow.
GRO chemokines and their cognate receptor, CXC-receptor 2 (CXCR2), are known to mediate the recruitment of neutrophils and to stimulate metastasis by regulating angiogenesis in several tumor models and in various human cancers . Pappa et al. showed that the serum levels of IL-8, ENA-78 and GRO- in patients with multiple myeloma were elevated. Doll et al. also found that there was a
significant increase in the expression of GRO-, GRO-, and IL-8 in colon carcinoma compared to normal tissue and that the GRO- levels were related to metastasis
formation. In parallel, the modulation of the expression of CXCR2 has been shown to regulate malignant melanoma growth, angiogenesis and metastasis . These data suggest that GRO chemokines may contribute to cell transformation and tumor growth. Our present results strongly suggest that GRO chemokines contribute to tumorigenesis may through their capability to generate MDSCs. Therefore, it is imperative to elucidate how GRO chemokines and their receptors down-regulate the anti-tumor immune responses. In this study, we have established that GRO
chemokines mediated immunosuppression of MSCs and that the GRO family of chemokines may play a crucial role in directing the differentiation pathway of MDSCs. In addition to GRO-, GRO- also exhibited a suppressive activity. These observations warrant further exploration about the role of individual GRO
chemokines, about the generation of MDSCs, and about the physiological control of immunity by MDSCs.
MDSCs are a heterogeneous population of cells that are characterized by the co-expression of the granulocyte differentiation antigen Gr-1 and the 1M integrin CD11b in mice . In healthy mice, the MDSCs represent nearly 20-30% of the bone marrow cells. Approximately 2 to 4% of the cells in a healthy spleen are CD11b+
Gr-1+, but this percentage increases to 50% in tumor-bearing mice . These results indicate
Haile et al. have previously reported that CD11b+CD49d+ monocytic-MDSCs are
more potent suppressors of antigen-specific T cells in vitro compared to
CD11b+CD49d− granulocytic MDSCs . In most cancer patients, MDSCs are defined
as cells that express the common myeloid marker CD33 but lack the expression of the markers of mature myeloid and lymphoid cells . The percentage of CD14+
HLA-DR-/low cells is increased in hepatocellular carcinoma (HCC) patients . However, little
is known about the biological characteristics and the functions of MDSCs in non-tumor settings because of the lack of specific markers. In this study, we have
demonstrated that GRO--treated MDSC-like cells exhibit tolerogenic properties and have the ability to suppress the effector functions of T cells in both humans and mice. We have also provided evidence that GRO- induced MDSCs that were generated ex vivo are able of reducing the in vivo effector activities of OT-1 T cells in B6 mice. This reduction includes their proliferative response to OVA-pulsed antigen-presenting cells and the secretion of the inflammatory cytokines IFN- and TNF- in response to OVA peptide-specific stimulation. These data indicate that the GRO--treated MDSC-like cells that were generated in vitro may be promising candidates for the treatment of diseases as a result of an exacerbated immune response. The identification of reliable markers that can distinguish MDSCs from non-MDSC cells is still
characterize and define subsets of human and mouse MDSCs based on the acquisition of differential suppressive properties after GRO stimulation.
Over the last decade, there has been enormous progress in MSC-based therapy in various medical fields, such as transplantation, allo-reactive pathology, and autoimmunity. These therapies take advantage of the regenerative capacities,
chemoattraction to tissues that are undergoing active remodeling, easy accessibility for isolation and expansion, remarkably low-immunogenicity, and the ethical acceptability of MSCs . However, numerous unresolved questions about the true identity of MSCs remain because of the absence of a specific cell surface marker, the complexity of their interactions with other cell types and the broad range of
cytokines/growth factors that MSCs produce. Recently, we have demonstrated that MSCs regulate the functional activation of neutrophils by orchestrating the secretion of IL-17 from activated CD4+CD45RO+ T cells . Our results support the concept that
MSCs play a significant role in linking adaptive and innate immunity because of their immunomodulatory activities. Indeed, MSCs may not be restricted to an
immunosuppressive role, but they also may promote other functional activities of immune cells. This may depend on their interaction with other cell types and the cytokine/chemokine profile that they secrete into their microenvironment. Thus, further efforts are required to better understand the interaction of MSCs with other
cells and to characterize the factors and sequential cellular events that dictate their response to environmental stimuli. Furthermore, the hypothesis that MDSCs mediate the immunosuppressive activity of MSCs in vivo could also be induced by MSC-derived soluble factors other than GRO chemokines. These possibilities need to be validated.
There is increasing evidence that MDSCs have the potential to suppress autoimmune responses, including type 1 diabetes (T1D) and central nervous system autoimmune diseases , in experimental murine models. These observations suggest that the failure of endogenous MDSCs to appropriately control auto-reactive T-cell responses in vivo may contribute to the pathogenesis of autoimmune diseases. Thus, the use of well-defined preparations of MSCs and MDSCs may become crucial therapeutic requirements for clinical applications in the near future. Considering the difficulty in producing safe clinical lots of these cells and the uncertainty about the potential of MSCs to control autoimmune or inflammatory diseases, GRO-treated MDSC-like cells could be more reliable candidates for cell therapy because of their high degree of functionality and their stability in vivo. However, the use of either MSCs or MDSCs in large-scale clinical trials should be performed with caution because the underlying mechanism of action of these cells has not been fully elucidated.
In summary, we have established for the first time that GRO chemokines and their receptors play a critical role in mediating the immunosuppressive activity of MSCs on the differentiation of cells in the myeloid lineage, in particular through the generation of MDSC-like cells. Our study may provide a novel, alternative approach to the design of cell-based therapies. GRO-induced MDSC-like cells represent a promising approach for the treatment of human pathologies that result from an exacerbated immune response.
Acknowledgments
The authors thank the Core Facility of the Flow Activation Cell Sorter at the National Health Research Institutes for performing all sterile cell sorting. RNAi reagents were obtained from the National RNAi Core Facility located at the Institute of MolecularBiology/Genomic Research Center, Academia Sinica, Taiwan. We are also grateful to Dr. John Kung and Dr. Michel Klein for critically reviewing the manuscript and providing suggestions. The authors have no conflicting financial interests.
References
1. Friedenstein, A. J., K. V. Petrakova, A. I. Kurolesova, and G. P. Frolova. 1968. Heterotopic of bone marrow. Analysis of precursor cells for osteogenic and hematopoietic tissues. Transplantation 6: 230-247.
2. Bernardo, M. E., F. Locatelli, and W. E. Fibbe. 2009. Mesenchymal stromal cells. Ann N Y Acad Sci 1176: 101-117.
3. Aquino, J. B., M. F. Bolontrade, M. G. Garcia, O. L. Podhajcer, and G. Mazzolini. 2010. Mesenchymal stem cells as therapeutic tools and gene carriers in liver fibrosis and hepatocellular carcinoma. Gene Ther 17: 692-708.
4. Vanleene, M., Z. Saldanha, K. L. Cloyd, G. Jell, G. Bou-Gharios, J. H. Bassett, G. R. Williams, N. M. Fisk, M. L. Oyen, M. M. Stevens, P. V. Guillot, and S. J. Shefelbine. 2011. Transplantation of human fetal blood stem cells in the osteogenesis imperfecta mouse leads to improvement in multiscale tissue properties. Blood 117: 1053-1060.
5. Popp, F. C., P. Renner, E. Eggenhofer, P. Slowik, E. K. Geissler, P. Piso, H. J. Schlitt, and M. H. Dahlke. 2009. Mesenchymal stem cells as
immunomodulators after liver transplantation. Liver Transpl 15: 1192-1198. 6. Sato, K., K. Ozaki, M. Mori, K. Muroi, and K. Ozawa. 2010. Mesenchymal
outcomes. J Clin Exp Hematop 50: 79-89.
7. Nauta, A. J., and W. E. Fibbe. 2007. Immunomodulatory properties of mesenchymal stromal cells. Blood 110: 3499-3506.
8. Muller, I., S. Lymperi, and F. Dazzi. 2008. Mesenchymal stem cell therapy for degenerative inflammatory disorders. Curr Opin Organ Transplant 13: 639-644.
9. Yagi, H., A. Soto-Gutierrez, B. Parekkadan, Y. Kitagawa, R. G. Tompkins, N. Kobayashi, and M. L. Yarmush. 2010. Mesenchymal stem cells: Mechanisms of immunomodulation and homing. Cell Transplant 19: 667-679.
10. Mougiakakos, D., R. Jitschin, C. C. Johansson, R. Okita, R. Kiessling, and K. Le Blanc. 2011. The impact of inflammatory licensing on heme oxygenase-1-mediated induction of regulatory T cells by human mesenchymal stem cells. Blood.
11. Prigione, I., F. Benvenuto, P. Bocca, L. Battistini, A. Uccelli, and V. Pistoia. 2009. Reciprocal interactions between human mesenchymal stem cells and
gammadelta T cells or invariant natural killer T cells. Stem Cells 27: 693-702. 12. Jarvinen, L., L. Badri, S. Wettlaufer, T. Ohtsuka, T. J. Standiford, G. B. Toews, D.
J. Pinsky, M. Peters-Golden, and V. N. Lama. 2008. Lung resident
mesenchymal stem cells isolated from human lung allografts inhibit T cell proliferation via a soluble mediator. J Immunol 181: 4389-4396.
13. Kim, J., and P. Hematti. 2009. Mesenchymal stem cell-educated macrophages: a novel type of alternatively activated macrophages. Exp Hematol 37: 1445-1453.
14. Rasmusson, I., K. Le Blanc, B. Sundberg, and O. Ringden. 2007. Mesenchymal stem cells stimulate antibody secretion in human B cells. Scand J Immunol 65: 336-343.
15. Hsu, S.-C., L.-T. Wang, C.-L. Yao, H.-Y. Lai, K.-Y. Chan, B.-S. Liu, P. Chong, O. K.-S. Lee, and H.-W. Chen. 2012. Mesenchymal stem cells promote neutrophil activation by inducing IL-17 production in CD4+ CD45RO+ T cells.
Immunobiology.
16. Aggarwal, S., and M. F. Pittenger. 2005. Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 105: 1815-1822. 17. Spaggiari, G. M., H. Abdelrazik, F. Becchetti, and L. Moretta. 2009. MSCs
inhibit monocyte-derived DC maturation and function by selectively
interfering with the generation of immature DCs: central role of MSC-derived prostaglandin E2. Blood 113: 6576-6583.
18. Richmond, A., and H. G. Thomas. 1988. Melanoma growth stimulatory activity: isolation from human melanoma tumors and characterization of tissue distribution. J Cell Biochem 36: 185-198.
Schreiber, and C. Van Waes. 2000. Growth regulated oncogene-alpha expression by murine squamous cell carcinoma promotes tumor growth, metastasis, leukocyte infiltration and angiogenesis by a host CXC receptor-2 dependent mechanism. Oncogene 19: 3477-3486.
20. Keeley, E. C., B. Mehrad, and R. M. Strieter. 2010. CXC chemokines in cancer angiogenesis and metastases. Adv Cancer Res 106: 91-111.
21. Smith, D. F., E. Galkina, K. Ley, and Y. Huo. 2005. GRO family chemokines are specialized for monocyte arrest from flow. Am J Physiol Heart Circ Physiol 289: H1976-1984.
22. Rainard, P., C. Riollet, P. Berthon, P. Cunha, A. Fromageau, C. Rossignol, and F. B. Gilbert. 2008. The chemokine CXCL3 is responsible for the constitutive chemotactic activity of bovine milk for neutrophils. Molecular Immunology 45: 4020-4027.
23. Gabrilovich, D. I., and S. Nagaraj. 2009. Myeloid-derived suppressor cells as regulators of the immune system. Nat Rev Immunol 9: 162-174.
24. Lee, O. K., T. K. Kuo, W. M. Chen, K. D. Lee, S. L. Hsieh, and T. H. Chen. 2004. Isolation of multipotent mesenchymal stem cells from umbilical cord blood. Blood 103: 1669-1675.
25. Mahanonda, R., N. Sa-Ard-Iam, P. Montreekachon, A. Pimkhaokham, K. Yongvanichit, M. M. Fukuda, and S. Pichyangkul. 2007. IL-8 and IDO
expression by human gingival fibroblasts via TLRs. J Immunol 178: 1151-1157. 26. Song, Y. C., A. H. Chou, A. Homhuan, M. H. Huang, S. K. Chiang, K. Y. Shen, P.
W. Chuang, C. H. Leng, M. H. Tao, P. Chong, and S. J. Liu. 2011. Presentation of lipopeptide by dendritic cells induces anti-tumor responses via an
endocytosis-independent pathway in vivo. J Leukoc Biol 90: 323-332. 27. Lechner, M. G., D. J. Liebertz, and A. L. Epstein. 2010. Characterization of
cytokine-induced myeloid-derived suppressor cells from normal human peripheral blood mononuclear cells. J Immunol 185: 2273-2284.
28. Condamine, T., and D. I. Gabrilovich. 2011. Molecular mechanisms regulating myeloid-derived suppressor cell differentiation and function. Trends Immunol 32: 19-25.
29. Shi, Y., G. Hu, J. Su, W. Li, Q. Chen, P. Shou, C. Xu, X. Chen, Y. Huang, Z. Zhu, X. Huang, X. Han, N. Xie, and G. Ren. 2010. Mesenchymal stem cells: a new strategy for immunosuppression and tissue repair. Cell Res 20: 510-518. 30. Kronsteiner, B., A. Peterbauer-Scherb, R. Grillari-Voglauer, H. Redl, C. Gabriel,
M. van Griensven, and S. Wolbank. 2011. Human mesenchymal stem cells and renal tubular epithelial cells differentially influence monocyte-derived
dendritic cell differentiation and maturation. Cell Immunol 267: 30-38. 31. Meisel, R., S. Brockers, K. Heseler, O. Degistirici, H. Bulle, C. Woite, S.
and W. Daubener. 2011. Human but not murine multipotent mesenchymal stromal cells exhibit broad-spectrum antimicrobial effector function mediated by indoleamine 2,3-dioxygenase. Leukemia 25: 648-654.
32. Ghannam, S., C. Bouffi, F. Djouad, C. Jorgensen, and D. Noel. 2010.
Immunosuppression by mesenchymal stem cells: mechanisms and clinical applications. Stem Cell Res Ther 1: 2.
33. Liu, C. H., and S. M. Hwang. 2005. Cytokine interactions in mesenchymal stem cells from cord blood. Cytokine 32: 270-279.
34. Volarevic, V., A. Al-Qahtani, N. Arsenijevic, S. Pajovic, and M. L. Lukic. 2010. Interleukin-1 receptor antagonist (IL-1Ra) and IL-1Ra producing mesenchymal stem cells as modulators of diabetogenesis. Autoimmunity 43: 255-263. 35. Nauta, A. J., A. B. Kruisselbrink, E. Lurvink, R. Willemze, and W. E. Fibbe. 2006.
Mesenchymal stem cells inhibit generation and function of both CD34+-derived and monocyte-CD34+-derived dendritic cells. J Immunol 177: 2080-2087. 36. Jiang, X. X., Y. Zhang, B. Liu, S. X. Zhang, Y. Wu, X. D. Yu, and N. Mao. 2005.
Human mesenchymal stem cells inhibit differentiation and function of monocyte-derived dendritic cells. Blood 105: 4120-4126.
37. Chiesa, S., S. Morbelli, S. Morando, M. Massollo, C. Marini, A. Bertoni, F. Frassoni, S. T. Bartolome, G. Sambuceti, E. Traggiai, and A. Uccelli. 2011. Mesenchymal stem cells impair in vivo T-cell priming by dendritic cells.
Proceedings of the National Academy of Sciences of the United States of America 108: 17384-17389.
38. Aldinucci, A., L. Rizzetto, L. Pieri, D. Nosi, P. Romagnoli, T. Biagioli, B. Mazzanti, R. Saccardi, L. Beltrame, L. Massacesi, D. Cavalieri, and C. Ballerini. 2010. Inhibition of immune synapse by altered dendritic cell actin distribution: a new pathway of mesenchymal stem cell immune regulation. J Immunol 185: 5102-5110.
39. Reiland, J., L. T. Furcht, and J. B. McCarthy. 1999. CXC-chemokines stimulate invasion and chemotaxis in prostate carcinoma cells through the CXCR2 receptor. Prostate 41: 78-88.
40. Vandercappellen, J., J. Van Damme, and S. Struyf. 2008. The role of CXC chemokines and their receptors in cancer. Cancer Lett 267: 226-244.
41. Pappa, C. A., G. Tsirakis, P. Kanellou, M. Kaparou, M. Stratinaki, A. Xekalou, A. Alegakis, A. Boula, E. N. Stathopoulos, and M. G. Alexandrakis. 2011.
Monitoring serum levels ELR+ CXC chemokines and the relationship between microvessel density and angiogenic growth factors in multiple myeloma. Cytokine 56: 616-620.
42. Doll, D., L. Keller, M. Maak, A. L. Boulesteix, J. R. Siewert, B. Holzmann, and K. P. Janssen. 2010. Differential expression of the chemokines GRO-2, GRO-3, and interleukin-8 in colon cancer and their impact on metastatic disease and
survival. Int J Colorectal Dis 25: 573-581.
43. Singh, S., K. C. Nannuru, A. Sadanandam, M. L. Varney, and R. K. Singh. 2009. CXCR1 and CXCR2 enhances human melanoma tumourigenesis, growth and invasion. Br J Cancer 100: 1638-1646.
44. Youn, J. I., S. Nagaraj, M. Collazo, and D. I. Gabrilovich. 2008. Subsets of myeloid-derived suppressor cells in tumor-bearing mice. J Immunol 181: 5791-5802.
45. Haile, L. A., R. von Wasielewski, J. Gamrekelashvili, C. Kruger, O. Bachmann, A. M. Westendorf, J. Buer, R. Liblau, M. P. Manns, F. Korangy, and T. F. Greten. 2008. Myeloid-derived suppressor cells in inflammatory bowel disease: a new immunoregulatory pathway. Gastroenterology 135: 871-881, 881 e871-875. 46. Montero, A. J., C. M. Diaz-Montero, C. E. Kyriakopoulos, V. Bronte, and S.
Mandruzzato. 2012. Myeloid-derived Suppressor Cells in Cancer Patients: A Clinical Perspective. J Immunother 35: 107-115.
47. Hoechst, B., L. A. Ormandy, M. Ballmaier, F. Lehner, C. Kruger, M. P. Manns, T. F. Greten, and F. Korangy. 2008. A new population of myeloid-derived
suppressor cells in hepatocellular carcinoma patients induces CD4(+)CD25(+)Foxp3(+) T cells. Gastroenterology 135: 234-243.
48. Salem, H. K., and C. Thiemermann. 2010. Mesenchymal stromal cells: current understanding and clinical status. Stem Cells 28: 585-596.
49. Yin, B., G. Ma, C. Y. Yen, Z. Zhou, G. X. Wang, C. M. Divino, S. Casares, S. H. Chen, W. C. Yang, and P. Y. Pan. 2010. Myeloid-derived suppressor cells prevent type 1 diabetes in murine models. J Immunol 185: 5828-5834. 50. Ioannou, M., T. Alissafi, I. Lazaridis, G. Deraos, J. Matsoukas, A. Gravanis, V.
Mastorodemos, A. Plaitakis, A. Sharpe, D. Boumpas, and P. Verginis. 2012. Crucial role of granulocytic myeloid-derived suppressor cells in the regulation of central nervous system autoimmune disease. J Immunol 188: 1136-1146.
Figure legends
Figure 1. Phenotypic analysis of the differentiation stages of myeloid-derived dendritic cells by flow cytometry. Purified human CD14+ monocytes (Mo) and MDDCs differentiated using -MEM medium that contained 10% human AB+ serum
in the presence of IL-4 (80 ng/mL) and GM-CSF (80 ng/mL) without (iDCs) or with (mDCs) LPS (1 μg/mL) were surface labeled. Cells were analyzed by flow cytometry. Gray lines indicate isotype controls. The percentages of positive cells that were obtained for the different antibodies, CD14, CD64, CD80, CD86, CD40, CD83, HLA-DR, and DC-SIGN, are indicated. Representative results of five independent
experiments are shown.
Figure 2. MSC-conditioned medium exerts a suppressive effect on MDDC differentiation. Purified CD14+ monocytes from human PBMCs were cultured in DC-differentiation medium in the presence or absence of MSC-conditioned medium (MSC-CM) (1/2x volume). MDDCs were untreated (iDC) or treated (mDC) with LPS (1 μg/mL) on day 5 and for an additional 2 days. The phenotype and function of the MDDCs were analyzed on day 7. (A) Surface markers associated with DC maturation were stained and analyzed by flow cytometry. Mean fluorescence intensity (MFI) was
determined after analyzing 10,000 cells. (B) The endocytic activities of differentiated iMDDCs which supplemented with MSC-CM or iMDDCs cultured in MSCs
containing system (trans well) were executed. Immature MDDCs were pulsed with FITC-dextran (1 mg/mL) for 30 min at 37°C, and their endocytic ability was assessed by FITC-dextran uptake measured by flow cytometry. FACS profiles are shown for iMDDCs in the absence of FTIC-Dextran as a negative control (NC, gray line), iMDDCs (iDC, dashed line), iMDDCs in the presence of MSC-CM (iDC+MSC-CM, solid black line, left panel), or iMDDCs in MSCs containing trans well environment (iDC+MSC, solid black line, right panel) after FITC-Dextran uptake. Data are representative of three independent experiments. (C) Mature MDDCs were co-cultured with allogeneic T cells (DC:T=1:10) for 4 days. Thymidine incorporation was measured after a 16-h pulse with 1 μCi /well of [3H]-thymidine.T-cell
proliferation was determined by [3H]-thymidine incorporation in triplicate cultures of
three different donors. Data are expressed as the fold change relative to the group without MSC-CM supplementation (mean ± SEM in MFI) (A) or CPM (mean ± SEM) of [3H]-thymidine uptake (C). Representative results of three separate
experiments performed in triplicate are shown. *:p < 0.05. **:p < 0.01. ***:p < 0.0001.
Figure3. The suppressive effect of MSC-CM on MDDCs is reversed by addition of an anti-GRO- neutralizing antibody to MSC-CM. (A) Comparison of the cytokine profiles from the MSC-conditioned medium (MSC-CM) and the serum-containing control medium was performed using a commercial human
cytokine/chemokine antibody array (RayBio). The cytokine and chemokine levels in the culture media were determined by incubating the array membrane with biotin-labeled antibodies that were reactive for specific cytokines or chemokines, followed by adding HRP-conjugated streptavidin and then exposing the array to X-ray film. The results are representative of two independent experiments. (B) The influence of GRO chemokines and IL-8 on the expression of CD40 on immature MDDCs was assessed by flow cytometry analysis. Human CD14+ monocytes were differentiated in
-MEM medium containing 10% human AB+ serum in the presence of IL-4 (80
ng/mL) and GM-CSF (80 ng/mL). CD14+ monocytes, immature MDDCs alone, or
immature MDDCs supplemented with GRO-, GRO-β, GRO-, or IL-8 were stained for CD40 expression and analyzed by flow cytometry on day 7. Gray lines correspond to unstained controls. The percentages of CD40-positive cells for the indicated chemokines are shown. The results are representative of three independent
experiments. (C) GRO- activity in MSC-CM was neutralized with the addition of an anti-GRO- (10 μg/mL) or an isotype-matched control antibody at 37°C for 60 min
followed by an incubation at 4°C overnight. MDDCs were differentiated in DC differentiating medium with or without MSC-CM (1/2x volume) in the presence or absence of the neutralizing anti-GRO- antibody. Phenotypic analyses of the MDDCs were performed by flow cytometry, and the results are expressed as the fold change of mean fluorescence intensity relative to the values obtained for untreated iDC (MFI). The means and the standard error of the mean obtained from three independent experiments are shown. *:p < 0.05. **:p < 0.01.
Figure 4. GRO- mediated the immune-modulated activity of MSCs in DC’s function. MSCs were infected with shLuc (as a none-specific targeting control), shGRO--2, shGRO--4 lentiviruses or without lentiviruses (as a mock control) in the puromycin (5 μg/ml) containing media for two days. The surviving MSCs (2×104)
from each treatment were pooled and then co-cultured with human peripheral purified CD14+ monocytes in the DC differentiation media for five days. (A) The
concentration of human GRO- in the cultured supernatants for iDCs alone or iDCs combined with various MSCs were determined by ELISA. (B) The endocytosis activity of CD14+ cells in differentiated iDCs alone or iDCs contact with various
lentiviral infected-MSCs were measured as indicated. One of three experimental results was represented. (C) The percentages of CD14+ endocytotic cells in either
differentiated iDC alone or iDCs co-cultured with different treatments of MSCs were calculated. The results are presented as the mean ± SEM for triplicates from three separate experiments. *:p < 0.05. **:p < 0.01. ***:p < 0.0001.
Figure 5. GRO- suppresses the differentiation of MDDCs. CD14+ monocytes that were purified from human PBMCs were differentiated in the presence or absence of recombinant GRO- (250 ng/mL) with or without pre-treatment with the CXCR2 agonist SB225002 (250 nM) for 30 min. The phenotype and function of the MDDCs were analyzed on day 7. (A) After surface marker labeling, the phenotypic analysis of the MDDCs was performed by flow cytometry. Bar graphs represent the fold change of MFI relative to the MFI that was observed for untreated iDCs (fold change of MFI ± SEM). The results are representative of three to five independent experiments. (B) Immature MDDCs were pulsed with FITC-dextran (1 mg/mL) for 30 min at 37°C, and the uptake of the FTIC-dextran was measured by flow cytometry. Data are representative of three separate experiments and are expressed as the fold change of MFI ± SEM relative to the DC group. The right panel was also shown the one representive cytofluorimetry profile of endocytosis activity for iMDDCs in the absence of FTIC-Dextran as a negative control (NC, gray line), iMDDCs alone (iDC, dashed line), iMDDCs in the presence of MSC-CM (iDC+ CM, solid black line) and
supplement with SB225002 (iDC+ CM+SB, solid fine line) after FITC-Dextran uptake. Data are representative of three independent experiments. (C) Mature MDDCs were co-cultured with allogeneic T cells (DC:T = 1:10) for 4 days. Thymidine
incorporation was measured after a 16 h pulse with 1 μCi /well of [3H]-thymidine. T
cell proliferation was determined by [3H]-thymidine incorporation. Data are expressed
as the fold change of CPM (mean ± SEM) relative to untreated MDDCs and are representative of three separate experiments. *:p < 0.05. **:p < 0.01. ***:p < 0.0001.
Figure 6. MDDCs differentiated in the presence of GRO- exhibit a tolerogenic cytokine profile. Purified CD14+ monocytes from human PBMCs were differentiated in the presence or absence of recombinant GRO- (250 ng/mL) with or without pretreatment with SB225002 (250 nM) for 30 min. (A) The expression levels of the indicated mRNAs after 7-day cultures of MDDCs were determined by real-time PCR. Ct values were normalized to the expression of the GAPDH gene. Differences were calculated with the 2-ΔCt method, and the data are expressed as the percentage relative
to the values obtained for the untreated DCs. (B) The expression of
immune-modulatory factors, MMP9, COX-2, and IDO were performed in GRO- and none- GRO- BMDCs. Immature MDDCs differentiated for 5 days were fixed on glass slides and were permeabilized with 0.1% (v/v) of NP-40/PBS. Intracellular IDO
expression was detected by staining MDDCs with a mouse anti-human IDO antibody followed by a goat anti-mouse IgG-DyLight 488-conjugated antibody. The image was obtained using confocal microscopy. Bar = 10 μm. (C) The biological activity of IDO was verified by measuring the production of kynurenine in cultured supernatants of DC, DC+ GRO-, and DC+ GRO-+SB. The results are presented as the mean ± SEM for triplicates from five separate experiments. *:p < 0.05. **:p < 0.01. ***:p < 0.0001.
Figure 7. T-cells primed with GRO--treated MDDCs present with tolerogenic properties. Human CD3+ T cells (3×105) were stimulated with 3×104 MDDCs differentiated in the presence or absence of recombinant GRO- with or without SB225002. (A) The mRNA expression levels of selective genes, IL-4, IL-10, IL-12 and IFN-, in magnetic binding CD3+ T cells purified from MDDC and T cell
co-cultures were evaluated by real time PCR. Relative gene expression was normalized to that of GAPDH. Data are expressed as the fold change of gene expression relative to values obtained for the DC primed-T cell group. The results are represented as the mean ± SEM from five separate experiments. (B) The cytokine profiles in
supernatants that were collected from the GRO-–treated and untreated MDDCs that were co-cultured with T lymphocytes were analyzed by ELISA. Data are indicated as the mean of the cytokine concentration ± SEM. The results are representative of five
