The medical diagnostic approaches with phylogenetic analysis for rare Brucella spp. diagnosis in Taiwan
Ni Tien a,b, Yun-Ju Sung a, Yi-Chih, Chang b, Bang-Jau You c, Michelle Liangd, Yun-Ping Lime, Wen-Yu Hof, Hsiu-Shen Lin a, Mao-Wang Hog, Chen-Mao Hoa,g, Chao-Chin Chang h and Yu-Ching Lani*, ,
a Department of Laboratory Medicine, China Medical University Hospital, Taichung, Taiwan.
b Department of Medical Laboratory Science and Biotechnology, China Medical University, Taichung, Taiwan.
c Department of Chinese Pharmaceutical Sciences and Chinese Medicine Resources, China Medical University, Taichung, Taiwan.
d Department of Microbiology, UCLA, USA.
e Department of Pharmacy, College of Pharmacy, China Medical University, Taichung, Taiwan.
f Department of Laboratory Medicine, China Medical University Beigang Hospital, Taichung, Taiwan. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
g Department of Internal Medicine, School of Medicine, China Medical University, Taichung, Taiwan.
h Graduate Institute of Microbiology and Public Health, National Chung Hsing University, Taichung,Taiwan
i Department of Health Risk Management, China Medical University, Taichung, Taiwan.
Address of Correspondence: Yu-Ching Lan, PhD
Department oh Health Risk Management, China Medical University, Taichung, Taiwan, e-mail: [email protected] 20 21 22 23 24 25 26 27 28 29 30
The medical diagnostic approaches with phylogenetic analysis for rare Brucella spp. diagnosis in Taiwan
Abstract
Brucellosis is a bacterial zoonotic disease which can be easy to misdiagnose in clinical microbiology laboratories. In the present study, we have tried to improve the current clinical method for detecting Brucella spp. and its antibiotic characteristics. Our method begins with detecting the clinical isolate through traditional biochemical methods and automatic identification systems. Then, we move on to editing the sequence for BLAST allows us to compare 16s rRNA sequences with sequences from other species, allowing the gene level to be determined. Next, the phylogenetic analysis of multiple genetic loci is able to determine the evolutionary relationships between our bacteria strain and those from other locations. Finally, an anti-microbial susceptibility test hones in on the level of antibacterial activity that the bacteria displays. Employing these four steps in concert is extremely effective in identifying rare bacteria. Thus, when attempting to determine the identity of rare bacteria such as Brucella, utilizing these four steps from our research should be highly effective and ultimately prevent further identification errors and misdiagnoses. The standards we have suggested to identify rare bacteria strains is applicable not only to Brucella, but also to other rarely encountered bacteria.
31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51
Key words: Brucella, traditional biochemical methods, 16s rRNA, phylogenetic analysis, anti-microbial susceptibility test
52 53 54
Introduction
Brucellosis is one of the most common zoonotic diseases, with more than 500,000 new cases yearly. Its prevalence is more than 10/100,000 population in some endemic areas such as France, Israel, and most of Latin America, the Middle East, northern Africa, and central Asia (1, 2). The disease is transmitted by consumption of unpasteurized dairy products or by occupational contact with infected animals. In the past 15 years, the epidemiology of human brucellosis has increasingly evolved through tourism and cases of animal brucellosis (2). Furthermore, infected objects are the most common cause of laboratory-transmitted infections in laboratory workers (3, 4). Brucella spp. has been classified in the high risk group of pathogens (5).
Since Brucella spp are intracellular bacteria, relapse is often seen (6-9). The features of Brucella spp include being a facultative intracellular pathogen, lacking capsules, flagellates, endosperms or native plasmids, and being slow growing and small (0.5-0.7 × 0.6-1.5μm) gram-negative coccobacilli (GNCB). Brucellosis usually causes systemic diseases in the osteoarticular, hematological, hepatobiliary, gastrointestinal, cardiovascular, and central nervous systems (10). Common clinical symptoms of brucellosis are characterized by high fever, myalgia, and arthralgia of the large joints. Apart from these main symptoms, brucellosis can also mimic various 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74
multisystem diseases by exhibiting wide clinical polymorphism and nonspecific symptoms, which frequently lead to misdiagnosis and treatment delay (11, 12). Brucellosis may be difficult to diagnose because of its wide clinical polymorphism. Previous identification experiences have had problems with errors. Laboratories had been report some cases of Brucella initially misdiagnosed by automatic identification systems before. These errors can lead to misdiagnosis, delayed treatment, and ultimately, the infection of even more individuals (11-14).
Since 1980, Taiwan has been free of this disease after an eradication program was implemented (15-17). However, in 2011 a few cases were reported. These cases were traced back to North Africa and Malaysia (16-18). They indicate that the pathogen can still pose a threat to public health in Taiwan despite previously being eradicated. There are worries that the overall capacity of Taiwanese physicians may be lacking due to inexperience in identification of the bacteria and subsequent misdiagnoses in clinical microbiology laboratories.
Therefore, the aim of this report is to share our experiences, to culture and identify the findings of this rare pathogen in Taiwan, and to compare the phylogenetic relevance of our genetic sequence with other epidemic strains in the geographical areas mentioned above. This research will aid in refining our understanding about the 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94
source of pathogens, thus allowing clinical microbiology laboratory workers to pay more attention to the identification and diagnosis of the rare Brucella spp (19).
95 96
Materials and methods
In this study, we detected the clinical isolate by utilizing traditional biochemical methods and automatic identification systems which include the BD Phoenix system and API 20E and 32 GN identification kits. Furthermore, we used the 16s rRNA sequences method for determining gene level. We performed an antibiotic sensitivity test. In addition, we also carried out phylogenetic analysis. By analyzing our strain of bacteria and comparing it with those from other geographical areas, we were able to determine the evolutionary relationship between the strain from Taiwan and other areas’ strains.
Collection and Identification of Bacteria isolate:
The conventional biochemical tests used included Oxidase-positive, urease-positive, H2S production, dye tolerance such as basic fuchsin and thionin and sero-agglutination tests. We routinely employed the BD Phoenix NMIC/ID-2 commercial kit (Becton Dickinson diagnostic System, Sparkes, MD, USA). Inoculation was performed according to the manufacturer's instructions. The API 20E and 32 GN systems (Biomerieux SA, Marcy l’Etoile, France) were also used to identify the strain. Inoculation, reading, and interpretation of panels were performed according to the manufacturer's instructions (20). 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116
16S ribosomal RNA Gene Sequencing
Sampling and sample preparation: The bacteria from positive blood culture specimens of the patient were plated on Trypticase soy agar with 5% defibrinated sheep blood (BBL Microbiology Systems, Cockeysville, Md.) and incubated
aerobically for 2 days at 37°C. Several visible colonies were selected and suspended in 600μl TE buffer and adjusted to MacFaland 3.0 cell density for nucleic acid extraction.
Nucleic acid extraction: DNA was extracted from fluid samples (600μl) using the Genomic DNA Mini Kit (Geneaid, Taiwan). The appropriate protocols were followed according to the manufacturer’s instructions; with a final elution volume of 50 µL. Extracted DNA was stored at 4℃ until required for PCR.
Amplification of 16s rRNA genes: The 16s rRNA gene from the microorganisms was amplified by PCR. A primer pair consisting of 8f
GAGAGTTTGATCCTGGCTCAG-3’) and 1492r
(5’-TACGGCTACCTTGTTACGACT-3’) (21, 22) was used to amplify nearly 1500-bp fragments of the 16s rRNA genes. The samples were amplified in the following PCR mixture: 10 μmol of each primer in a 2X buffer containing 4 mM MgCl2, 0.4 mM of each deoxynucleoside triphosphate, 0.05 U Taq DNA polymerase, and 40 mM 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135
(NH4)2SO4 (Ampliqon, Skovlunde, Denmark) in a final volume of 50 µL. The
following temperature cycles were used: 94°C for 5 min, 30 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min and 30 s, and a final extension at 72°C for 7 min. All reactions were conducted in a GeneAmp 9700 thermocycler (Applied Biosystems, Foster City, Calif.).
16s rRNA gene sequencing and alignment: Sequencing primers were chosen from a pair of previously described oligonucleotides, 8f and 1492r. Sequencing was performed with a 3730xl DNA Analyzer (Applied Biosystems, Foster City, Calif.). Sequences were aligned using the BioEdit suite of programs (www.mbio.ncsu.edu/BioEdit/bioedit.html), and the identity was evaluated by
checking against existing sequences using BLAST
(http://www.ncbi.nlm.nih.gov/BLAST). Sequencing of the 16s rRNA gene fragments showed a clear division of sequences into Brucella melitensis (22-24).
The multiple genetic loci for p hylogenetic relationship identification
A previous study already successfully determined the sequences of multiple genetic loci in order to examine the relationships between Brucella isolates (25). In order to further identify the genetic relationship among Brucella strains in this study 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154
and others strains in the GenBank, we extracted the Brucella DNA and amplified multiple genetic loci of the isolate, including aroA, glK, danK, and gyrB partial gene fragments (Table 1) for phylogenetic analysis(25).
Polymerase chain reactions (PCRs) and sequencing
Four distinct genome fragments were amplified by PCR using the primers shown in Table 1. PCR reaction mixes were prepared for each sample by mixing 10 μmol of each primer in a 2X buffer containing 4 mM MgCl2, 0.4 mM of each deoxynucleoside triphosphate, 0.05 U Taq DNA polymerase, and 40 mM (NH4)2SO4 (Ampliqon, Skovlunde, Denmark) in a final volume of 30 µL. Cycling parameters were as follows: 94°C for 5 min. followed by 30 cycles of 94°C for 1 min., 53°C for 1 min. and 72°C for 1 min., and a final polishing step of 72°C for 10 min. Products were separated by agarose gel electrophoresis to check for efficiency of amplification and to ensure that only a single product of the expected size was present. The DNA products were sequenced by using a GeneAmp 9700 thermocycler (Applied Biosystems, Foster City, Calif.).
Phylogenetic anlaysis 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174
The aroA, glK, dank and gyrB gene partial segments sequence data were edited using Bioedit for alignment, and then these data were combined with each other and before undergoing phylogenetic analysis. Sequences of the four loci were concatenated to produce a 1675 bp sequence for each genotype sequence. Phylogenetic analysis was performed with the MEGA software, Version 3.1. The neighbor joining tree was constructed with the concatenated sequence data of the four loci (1,675 bp) using the neighbor joining approach. The Jukes-Cantor model, which is based on the assumption that all nucleotide substitutions are equally likely, was used to determine genetic distances. The percentage bootstrap confidence levels of internal branches were calculated from 1,000 resamplings of the original data.
Antimicrobial Susceptibility Test of Brucella Isolate from clinical specimens
The antibiotic susceptibility test applied the paper disc diffusion method and the minimal inhibition concentration test; MIC. Tigecycline (TGC) MICs were determined by the E test (Biomerieux, Sweden). Mueller-Hinton agar supplemented with 5% sheep’s blood agar plate (Oxoid, UK) was inoculated with bacterial suspensions with a equivalent to a 0.5 McFarland turbidityand was interpreted 2 days after incubation in ambient air. The susceptibility testing of tetracycline (Te) (30 μg/ml), streptomycin (STR) (300, 10 μg/ml), rifampin (RIF) (5 μg/ml), and 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194
trimethoprim-sulfamethoxazole (TMP-SMZ) (1.25/23.75 μg/ml) was determined by disk diffusion method. Mueller-Hinton agar supplemented with 5% sheep’s blood was inoculated with suspensions of bacteria with equivalent 0.5 McFarland turbidity and was interpreted 48 hours after incubation in ambient air.
Results
Conventional identification
The gram- negative coccobacilli on the BAP plate are batter growth and appeared small and white. The glossy quality of the batter growth suggests that the gram-negative coccobacilli were of the smooth-quality type. The size of the bacteria was about 0.5-0.8 μ m x 0.6-1.5 μ m. There were no colonies growing on the EMB plate. The conventional biochemical tests showed a positive reaction that included the catalase, oxidase, and urease. Automated instruments and the API system (32 GN and 20 E) were employed to identify the bacteria. The results presented two species, Ochrobactrum antropi and Myrodes spp, respectively. The Phoenix instrument gave an Ochrobactrum antropi result, and the species was identified with 90% confidence. The API 20E identification was analyzed, and then code number 0210004 presented Myroides / Chryseobacterium indologenes (% id: 47.4, T=0.92), Bordetella / Alcaligenes / Moraxella spp. (% id: 25.7, T = 0.87) and Ochrobactrum antropi (% id: 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214
21.7, T=0.82). The API 32 GN identification code number 00000000002 was Myroides spp. (% id: 90.0, T=1.00).
16S ribosomal RNA Gene Sequencing
The 16s rRNA gene sequences were aligned by the BioEdit program and BLAST. A 99 % similarity between Brucella melitensis and Brucella ovis was discovered. The 16s rRNA gene sequence illustrated a homology between these two species. We further conducted phylogenetic analysis from multiple genetic loci in order to examine the relationships between Brucella isolates.
The phylogenetic relationships with other Brucella
To recognize the phylogenetic relationships of this Brucella strain, sequences of the four loci were concatenated to produce a 1675 bp sequence. The multiple genetic loci that were analyzed included aroA, glK, dank and gyrB partial gene fragments. The reference sequences with whole genomes came from the GenBank. The topology of the phylogenetic reference tree from the four loci was similar to the tree from the whole genome. The percentage bootstrap confidence levels of internal branches were calculated from 1,000 re-samplings of the original data. After comparison with the 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234
brucellosis in the Genbank as reference sequences, the bacterial strain in this study was clustered with the Brucella melitensis strains in a significantly monophyletic branch of the neighboring joining tree. The branch lengths represent the genetic variation between Taiwan Brucella melitensis and strains from other geographic areas.
Antimicrobial Susceptibility Test
In the tigecycline MICs, results were determined by the E test with turbidity between 0.5, 0.75, and 1.0 McFarland, but the results appeared all the same as 0.094μg/ml (Fig. 1). The inhibitory zone size of tetracycline (Te), streptomycin (STR), rifampin (RIF) and trimethoprim-sulfamethoxazole (TMP-SMZ) are shown in Table 2. 235 236 237 238 239 240 241 242 243 244 245
Discussion
Brucellosis has become a rare disease in developed and developing countries. As the infectious dose is very low, infections are an occupational risk for farmers, veterinarians, abattoir workers, laboratory personnel, and others who work with animals and consume their products (18, 26). The increase in business and leisure travel to brucellosis-endemic countries has led to the importation of the disease into non-endemic areas (26). Two problems arise from this importation. First, clinicians in non-endemic areas often have insufficient experience with brucellosis and have difficult making the correct diagnosis. Second, there could be failures in notifying laboratories, and brucellosis bacteria could be misidentified by using commercial automatic diagnosis system. These two problems are serious enough to deserve special attention in Taiwanese clinical microbiology laboratories (27).
The “gold standard” in the diagnosis of brucellosis is bacterial isolation, which requires long cultivation periods and is often unsuccessful. Because of this, we back-tracked the identification process and found that Brucella spp. is not included regularly in the database of automatic identification systems. The results of our tests presented Ochrobactrum antropi and Myroides / Chryseobacterium indologenesthe, 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264
respectively, and were given by two identification systems, the Phoenix and the API 20E systems. The confirmed rates were untrustworthy (9, 12, 13). Whereas Brucella spp. are classified as highly pathogenic biosafety level 3 agents, only two species of the genus Ochrobactrum (O. anthropi and O. intermedium) have been associated with opportunistic immunocompromised human disease (28). It can be seen that errors in identification of Brucella spp. may not only affect physicians’ treatments, they may also affect the safety of laboratory personnel.
Ochrobactrum represent a distinct genus distantly related to Achromobacter but phylogenetically closely related to the rRNA superfamily IV of the Alphaproteobacteria--in particular, to Brucella and Phyllobacterium (9). The close relationship to Brucella was emphasized in 1998 by Velasco et al (29). This close relationship has led to misidentification of Brucella melitensis as Ochrobactrum anthropi in the past. In previous research, the 16s rRNA sequences of Brucella spp. and O. intermedium were found to be 98.6% identical (29). Like the previous research group report (14), our study also had a similar misclassification experience with Brucella spp. in our automatic identification and 16s nucleotides blast. The result of our 16s rRNA BLAST illustrated a homology between Brucella melitensis and Brucela ovis. 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283
Results that are not accurate have the very real potential of misleading the examiner(s) of these bacteria. One could potentially send the wrong bacteria culture report and cause clinicians to misdiagnose (12, 13). There is currently a growing trend in errors due to the increasing utilization of automated equipment for microbial identification. Limitations in the instruments’ databases and inability to distinguish similar phenotype strains mean laboratory staff must sometimes use traditional options such as characterizing bacterial colonies and examining staining patterns as well as biochemical reactions to determine what bacteria are in a given sample. However, a clinical microbiology laboratory can also think ahead and identify bacteria and bacterial genotypes using molecular biological techniques. 16s rRNA analysis methods and phylogenetic analysis can provide more accurate reports in order to make up for the inability of automated systems to distinguish between closely related bacterial strains.
Ever since the early microbiological work performed by Wilson (30), researchers have been developing increasingly sophisticated methods of classifying Brucella species. However, despite technical advances in genotyping, the methods we have chosen have been able to roughly generate the same evolutionary relationships as 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302
those seen in whole genome phylogenies, especially in clinical approaches with a short time-span. Multilocus sequence typing trees in our study of Brucella roughly approximate the whole-genome phylogeny but use only four housekeeping genes. Although each approach to genotyping has its value, particularly when low-cost genotyping is the goal, only whole-genome sequencing can capture the full extent of genetic variation. Furthermore, only whole-genome phylogenies allow us to gauge the accuracy of previous genetic methods. Understanding the evolutionary framework of the genus Brucella is essential for designing assays that differentiate the various strains or biovars, and only by rooting our phylogeny can we understand the directionality of the evolutionary process. A future study might pursue a strategy for tracing the relationship between strains of Brucella in Taiwan, China or other neighboring countries.
The CLSI-M100-S20 specification standards of susceptibility of Brucella spp. illustrated streptomycin 8 μg/ml, ≦ tetracyclin 1 μg/ml, ≦ doxycycline 1 μg/ml,≦ gentamicin 4 μg/ml, ≦ trimethoprim-sulfamethoxazole (SXT) 2/38 μg/ml. When we≦ manipulated the antibiotic sensitivity test, we found that when bacterial growth is slow and the colonies are small, they cannot take advantage of automated identification systems to perform the MIC test. The interpretation of inhibition zone 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321
size does not follow the CLSI standards. The same scenario is found in a previous report (11, 12). Resistance to Brucella is not common, but research has pointed out that minimum inhibitory concentration of ceftriaxone and streptomycin (MIC) has been on the rise (7). Intermediate rifampin susceptibility strains also have become widespread (8). Kuwait and Mexico have found a good bacteriostatic effect that includes tetracycline, amikacin, gentamicin (11, 12), streptomycin and ciprofloxac for Brucella spp. However, rifampin and trimethoprim-sulfamethoxazole’s (SXT) antibacterial effects have been decreasing. The anti-microbial susceptibility test used in previous studies (15, 17) was the disk diffusion method. But the disk diffusion method is an atypical anti-microbial susceptibility test, meaning it is nearly impossible to interpret the results. In our interpretation, we have followed the standard that 16 mm indicates low anti-≦ Brucella activity and >16 mm is evidence of good anti-Brucella activity.
Contrary to cases of brucellosis previously discovered in Taiwan, our report may be the first to suspect cases of local infection. A review of brucellosis infection cases in Taiwan found that the first cases of infection of B. abortus occurred in 1978 when university veterinary students came into contact with infected cattle. Later in 1994, a report from 1980-1981 tracked and collected all contacts with infected cattle or other 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340
animals by veterinarians, laboratory workers, and farmers, and analyzed if they had been infected with B. abortus. Results showed about a 42.1% sero-positive reaction. But these results were never confirmed as being from outside or local cases (2 2 ) . However, in 2011 Taiwan also had four cases confirmed from outside the country (2
3 ) . In Taiwan it is still possible to become infected by touching infected animals such as deer. The main clinical signs of human Brucellosis are often nonspecific clinical manifestations. Clinicians in Taiwan may easily overlook the possibility of a Brucellosis infection. From this study, our aim is to increase the awareness of laboratory staff as well as aid physicians in their clinical and diagnostic abilities. In addition, we hope to raise awareness about the process of identifying bacteria in clinical microbiology laboratories.
341 342 343 344 345 346 347 348 349 350 351
Conclusion
This is the first study to provide both an improved genotype and phenotype analysis of Taiwan Brucella infection in clinical works. Through our research, we built a standard method of four steps for detecting the Brucella spp. and its antibiotic characteristics. We have worked to improve the standards by which we identify rare bacteria strains, and to make them applicable not only to Brucella, but also to other rarely-encountered bacteria. Our standard method begins with detecting the clinical isolate through traditional biochemical methods and automatic identification systems. The second step is the editing sequence for BLAST that allows one to compare 16s rRNA sequences with sequences from other species, allowing the gene level to be determined. In the third step, a phylogenetic analysis of multiple genetic loci is able to determine evolutionary relationships between our bacteria strain and those from other locations. Finally, an anti-microbial sensitivity test hones in on the level of antibacterial activity that the bacteria displays. Employing these four steps in concert is extremely effective in identifying rare bacteria. Thus, when attempting to determine the identity of rare bacteria such as Brucella, utilizing these four steps from our research will be highly effective and will hopefully ultimately prevent further identification errors and misdiagnoses.
352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370
Acknowledgments
The authors appreciate the collaborating work with the staff at the Department of Laboratory Medicine, China Medical University Hospital, Taichung, Taiwan. This work was supported by the grants CMU97-244, CMU98-S-16, CMU99-S-03; DMR-102-081 and DMR-102-078 from China Medical University Hospital, Taichung, Taiwan; and the grant NSC99-2314-B-039-022-MY3 from the National Science Council. 371 372 373 374 375 376 377 378
Fig. 1 The Tigecycline MICs results were determined by the E test that turbidity between 0.5, 0.75 and 1.0 McFarland, the results appear all the same as 0.094μg/ml.
Fig.1 Tigecycline MICs results were determined by the E test. 379
380
381 382
Table 1. Oligonucleotide sequences used for the amplification and sequencing of four genetic loci.
Locus Function Primer sequences Length(bp)
aroA 3-phosphoshikimate 1-carboxyvinyltransferase 5' GACCATCGACGTGCCGGG 3' 5' YCATCAKGCCCATGAATTC 3' 565 glK glucokinase 5' TATGGAAMAGATCGGCGG 3' 5' GGGCCTTGTCCTCGAAGG 3' 475 danK , chaperone protein 5' CGTCTGGTCGAATATCTGG 3' 5' GCGTTTCAATGCCGAGCGA 3' 470
gyrB DNA gyrase B subunit
5' ATGATTTCATCCGATCAGGT 3' 5' CTGTGCCGTTGCATTGTC 3' 469 383 384 385 386
Table 2 Susceptibility testing results were determined via disk diffusion method. Antibiotics Concentration (μg/ml) Inhibitory zone (mm)
Tetracycline 30 28 Streptomycin 10 30 300 40 Rifampin 5 21 Trimethoprim-sulfamethoxazole 1.25/23.75 22 387 388
Fig.2
The Neighbour joining tree was constructed with the concatenated sequence data of the four loci (1,675 bp) using the neighbour joining approach. The percentage bootstrap confidence levels of internal branches were calculated from 1,000 re-samplings of the original data.
389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413
Reference
1. Organization WH. 1997. Fact Sheet N173. Geneva: World Health
Organization.
2. Pappas G, Papadimitriou P, Akritidis N, Christou L, Tsianos EV.
2006. The new global map of human brucellosis. The Lancet infectious diseases 6:91-99.
3. Fiori PL, Mastrandrea S, Rappelli P, Cappuccinelli P. 2000. Brucella
abortus infection acquired in microbiology laboratories. Journal of clinical microbiology 38:2005-2006.
4. Robichaud S, Libman M, Behr M, Rubin E. 2004. Prevention of
laboratory-acquired brucellosis. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 38:e119-122.
5. Gilligan PH YM. 2002. Basic protocols for level A laboratories for the
presumptive identification of Brucella species. Washington: American Society for Microbiology.
6. E.J. Young GLM, J.E. Bennett, R. Dolin (Eds.). 2005. Brucella
species in Principles and practice of infectious diseases (6th ed.), p. 2669–2672. Churchill Livingstone, Philadelphia, PA, USA, 2005.
7. Gotuzzo E. EC, S.I. Gorbach, J.G. Bartlett, N.R. Brucella, Blacklow
(Eds.). 1992. Infectious diseases. Harcourt Brace Jovanovich Inc,
Philadelphia.
8. W.H. Hall ASE, P.S. Brachman (Eds.). 1991. Brucellosis Bacterial
infections of humans (2nd ed.). Plenum Publishing Corp, New York.
9. Elsaghir AAF, James EA. 2003. Misidentification of Brucella
melitensis as Ochrobactrum anthropi by API 20NE. Journal of Medical Microbiology 52:441-442.
10. Buzgan T, Karahocagil MK, Irmak H, Baran AI, Karsen H, Evirgen
O, Akdeniz H. 2010. Clinical manifestations and complications in 1028
cases of brucellosis: a retrospective evaluation and review of the literature. International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases 14:e469-e478.
11. Peiris V, Fraser S, Fairhurst M, Weston D, Kaczmarski E. 1992.
Laboratory diagnosis of brucella infection: some pitfalls. The Lancet
339:1415-1416. 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449
12. Batchelor BI, Brindle RJ, Gilks GF, Selkon JB. 1992. Biochemical
mis-identification of Brucella melitensis and subsequent laboratory-acquired infections. The Journal of hospital infection 22:159-162.
13. Barham WB, Church P, Brown JE, Paparello S. 1993.
Misidentification of Bruceila Species with Use of Rapid Bacterial Identification Systems. Clinical Infectious Diseases 17:1068-1069.
14. Yang J, Ren XQ, Chu Ml, Meng DY, Xue WC. 2013. Mistaken Identity
of Brucella Infection. Journal of clinical microbiology 51:2011.
15. Lu YS LY, Lin DF, Tsai HJ. . 1994. Case study on human brucellosis
of bovine-origin in Taiwan. Taiwan Prov Res Inst Anim Hlth Exp Rep
30:127-134.
16. Chuang YC, Chen SC, Mu JJ, Lin HY, Chang CH, Yang WS, Hsueh
PR. 2011. Brucellosis, Taiwan, 2011. Emerg Infect Dis 17:2374-2375.
17. Huang XT WY, Tung HP, Chen WC,Su CP, Chang SJ, Lai CL. 2011.
Case report of two imported Brucellosis cases, May 2011. Taiwan Epidemiology Bulletin.
18. Smits HL SC. 2004. Contributions of biotechnology to the control and
prevention of brucellosis in Africa. Afr J Biotechnol 3:631-636.
19. Araj GF. 2010. Update on laboratory diagnosis of human brucellosis.
Int J Antimicrob Agents 36 Suppl 1:S12-17.
20. Brigante G, Luzzaro F, Bettaccini A, Lombardi G, Meacci F, Pini B,
Stefani S, Toniolo A. 2006. Use of the Phoenix Automated System for
Identification of Streptococcus and Enterococcus spp. Journal of clinical microbiology 44:3263-3267.
21. James G. 2010. Universal Bacterial Identification by PCR and DNA
Sequencing of 16S rRNA Gene, p. 209-214. In Schuller M, Sloots TP, James GS, Halliday CL, Carter IWJ (ed.), PCR for Clinical Microbiology. Springer Netherlands.
22. Clarridge JE, 3rd. 2004. Impact of 16S rRNA gene sequence analysis
for identification of bacteria on clinical microbiology and infectious diseases. Clin Microbiol Rev 17:840-862.
23. Janda JM, Abbott SL. 2007. 16S rRNA gene sequencing for bacterial
identification in the diagnostic laboratory: pluses, perils, and pitfalls. Journal of clinical microbiology 45:2761-2764.
24. Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 1991. 16S
ribosomal DNA amplification for phylogenetic study. Journal of bacteriology 173:697-703. 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486
25. Whatmore A, Perrett L, MacMillan A. 2007. Characterisation of the
genetic diversity of Brucella by multilocus sequencing. BMC Microbiology 7:34. doi:10.1186/1471-2180-7-34.
26. Corbel M. 2006. Brucellosis in humans and animals. Geneva
(Switzerland): World Health Organisation.
27. Gwida M, Al Dahouk S, Melzer F, Rosler U, Neubauer H, Tomaso H.
2010. Brucellosis - regionally emerging zoonotic disease? Croat Med J
51:289-295.
28. Vaidya SA, Citron DM, Fine MB, Murakami G, Goldstein EJC. 2006.
Pelvic Abscess Due to Ochrobactrum anthropi in an Immunocompetent Host: Case Report and Review of the Literature. Journal of clinical microbiology 44:1184-1186.
29. Velasco J, Romero C, Lopez-Goni I, Leiva J, Diaz R, Moriyon I.
1998. Evaluation of the relatedness of Brucella spp. and Ochrobactrum anthropi and description of Ochrobactrum intermedium sp. nov., a new species with a closer relationship to Brucella spp. Int J Syst Bacteriol
48 Pt 3:759-768.
30. Wilson GS. 1933. The Classification of the Brucella Group: A
Systematic Study. J Hyg (Lond) 33:516-541. 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506