Multiple rearrangements of mitochondrial
DNA in unfertilized human oocytes
Rong-Hong Hsieh, Ph.D.,a,bNu-Man Tsai, M.S.,aHeng-Kien Au, M.D.,b Shu-Ju Chang, B.S.,bYau-Huei Wei, Ph.D.,cand Chii-Ruey Tzeng, M.D.a,b Taipei Medical University, Taipei, Taiwan
Objective: To determine the rearrangement of mitochondrial DNA (mtDNA) in unfertilized human oocytes and compromised embryos to evaluate the fertilization capacity of oocytes.
Design: Prospective laboratory research. Setting: IVF laboratory in a university hospital.
Patient(s): One hundred twenty-four unfertilized oocytes, 98 arrested embryos, and 45 tripronucleate (3PN) embryos from 65 female patients undergoing in vitro fertilization (IVF).
Intervention(s): Unfertilized oocytes and poor quality embryos were collected 48 hours after IVF. Main Outcome Measure(s): Comparison of the frequency of mtDNA deletions and fertilization rates of oocytes.
Result(s): Multiple deletions of mtDNA were found in unfertilized oocytes and arrested embryos obtained from IVF patients. A 4977-bp deletion was the most frequent deletion in human oocytes and embryos. About 66.1% of the unfertilized oocytes, 34.8% of the arrested or fragmented embryos, and 21.1% of the 3PN embryos harbored the 4977-bp deletion of mtDNA. There was a significant increase in the proportion of deleted mtDNA in unfertilized oocytes.
Conclusion(s): Accumulation of mtDNA deletions may contribute to mitochondrial dysfunction and im-paired ATP production. We conclude that the accumulation of rearranged mtDNA may interfere with fertilization of human oocytes and further embryonic development. (Fertil Steril威 2002;77:1012–7. ©2002 by American Society for Reproductive Medicine.)
Key Words: Embryo, infertility, mtDNA rearrangement, oocyte, tripronucleate
In eukaryotic cells, mitochondria are spe-cialized organelles that catalyze the formation of ATP. Two distinct genomes exist in all eukaryotic cells. One is located in the nucleus and is transmitted in a Mendelian fashion, whereas the other is located in mitochondria and is transmitted by maternal inheritance. Most human somatic cells contain about 1000 mitochondria, and each mitochondrion consists of 2 to 10 copies of mitochondrial DNA (mtDNA) (1). There is a higher copy number of mtDNA in mature oocytes but with just one mtDNA molecule per organelle (2). The mtDNA copy number of a bovine oocyte was estimated to be 260,000, which is about 100 times higher than that of somatic cells in ani-mals (3). The number of mtDNA in a mouse oocyte was approximately 92,000 (2), and that of the human oocyte was estimated to be about 100,000 (4).
Human mtDNA is a circular, histone-free molecule composed of 16.6 kb of DNA, present in one or more copies in every mito-chondrion. It encodes 13 protein subunits out of a total of about 80 constituting the oxidative phosphorylation system, the remainder being encoded by nuclear genes and imported into the mitochondrion. Human mtDNA also en-codes 2 ribosome RNAs and 22 transfer RNAs. The oxidative phosphorylation capacity of mi-tochondria is determined by the interplay
be-tween nuclear and mitochondrial genes.
Whereas mtDNA encodes 13 polypeptides that are the components of the respiratory system, nuclear DNA encodes the majority of the re-spiratory chain proteins and all of the proteins and enzymes that regulate replication and tran-scription of mtDNA (5).
First proposed by Harman (6), the free rad-ical theory is one of the most comprehensive Received August 3, 2001;
revised and accepted November 2, 2001. Presented at the 57th Annual Meeting of the American Society for Reproductive Medicine, Orlando, Florida, October 20 –25, 2001.
Supported by research grants from the National Science Council, Taiwan (NSC 90-2314-B-038-049) and the Taipei Medical University (A113 and TMC89-Y05-A110).
Reprint requests: Chii-Ruey Tzeng, M.D., Department of Obstetrics and Gynecology, Taipei Medical University Hospital, 252, Wu Hsing Street, Taipei 110, Taiwan, Republic of China (FAX: 886-2-23774207; E-mail: tzengcr@ tmu.edu.tw).
aCenter for Reproductive
Medicine and Science.
bDepartment of Obstetrics
and Gynecology.
cDepartment of
Biochemistry and Center for Cellular and Molecular Biology, School of Life Science, National Yang-Ming University, Taipei, Taiwan.
REPRODUCTIVE BIOLOGY
FERTILITY AND STERILITYVOL. 77, NO. 5, MAY 2002威Copyright ©2002 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A.
0015-0282/02/$22.00 PII S0015-0282(02)02998-9
theories of aging. It suggests that living organisms age because of accumulation of oxygen radical–induced cellular damage and that mtDNA is a possible target of free radical attack during the aging process. In humans, germ-line cells are derived from primordial cells, which are conspicuous in the developing zygote by the third week after conception. Following sexual differentiation, the number of germ cells increases through mitotic division from a few hundred to several million, reaching its peak in humans at 20 weeks of gestational age (7). Quiescent primordial follicles might not enter meiotic division for a period of up to 40 years, and therefore they have been postulated to accumulate consider-able mtDNA mutations.
In recent years, an increasing number of reports have shown that mtDNA mutations are associated with human aging and mitochondrial diseases (8 –10). Large-scale dele-tions of mtDNA are responsible for specific neuromuscular diseases, the most common being Kearns-Sayre syndrome (KSS) or chronic progressive external ophthalmoplegia (CPEO) syndrome. A 4977-bp deletion occurs in a “hot spot” region, which is flanked by two 13-bp direct repeats beginning at positions 8470 and 13,447, respectively (11, 12). So far, more than 150 types of mtDNA rearrange-ments have been reported (13). Deleterious mtDNA rear-rangements cause cellular energy deficiencies and result in clinical disorders. In human oocytes, the mitochondria must produce and store all the energy required for the resumption of meiosis II, fertilization, and development (14, 15). Defi-ciencies in mitochondrial ATP production may be associated with the impairment of oocyte fertilization. In human in vitro fertilization (IVF), differences in the amount of ATP gener-ated by mature human oocytes may be relgener-ated to fertilization potential and developmental competence of an embryo (16). To detect and characterize rearrangements of mtDNA in human oocytes and embryos, the unfertilized oocytes and arrested and tripronucleate (3PN) embryos were collected with consent from infertile women of different age groups undergoing IVF. Total cellular DNA from all of these sam-ples were subjected to molecular analysis by polymerase chain reaction (PCR) and DNA sequencing.
MATERIALS AND METHODS
Human Oocytes and Embryo Collection
This study was approved by the institutional review board of Taipei Medical University Hospital. From 65 patients enrolled in an IVF program, 124 unfertilized oocytes were donated to our laboratory for research. In addition, 98 em-bryos that were abnormally arrested, and 45 3PN emem-bryos unsuitable for embryonic replacement or cryopreservation were also donated and used for the following experiments.
Polymerase Chain Reaction
Oocytes and embryos were stored in 20L of 1⫻ PCR
buffer containing 0.05 mg/mL of proteinase K, 20 mM of
dithiothreitol (DTT), and 1.7M of SDS. After digestion for 1 hour at 56°C and 10 minutes of heat-inactivation of pro-teinase K at 95°C, the total DNA in the solution was then used as template for the PCR assay. The sequences of the oligonucleotide primers used in this study are listed as fol-lows: H1 (np 8285– 8304, CTCTAGAGCCCACTGTAA AG), H2 (np 8781– 8800, CGGACTCCTGCCTCACTCAT), H3 (np 9207–9226, ATGACCCACCAATCACATGC), L1 (np 13650 –13631, GGGGAAGCGAGGTTGACCTG), and L2 (np 14145–14126, TGTGATTAGGAGTAGGGTTA), L3 (np 15896 –15877, TACAAGGACAGGCCCATTTG) and L4 (np 16410 –16391, GAGGATGGTGGTCAAGGGAC).
The desired mtDNA fragment was amplified in a 100-L reaction mixture containing a final concentration of 1.5 mM of MgCl2, 1 mM of dNTPs, 20 pmol of each primer, and 1.5 IU of Taq polymerase (Life Technologies, Grand Island, NY). The following amplification profile was used: 1 cycle of 95°C for 5 minutes; 35 cycles of 95°C for 40 seconds, 58°C for 40 seconds, 72°C for 6 minutes, and 1 cycle of 72°C for 7 minutes, then it was kept at 4°C. For nested PCR, 5L of the first PCR product was used as a template. The strategy of second-round PCR was developed to amplify products only when mtDNA rearrangements were present. The procedure was carried out using the same PCR condi-tions as mentioned above. The PCR products were examined
by agarose gel electrophoresis, in which 8 L of PCR
products was separated on a 1.5% agarose gel and stained with ethidium bromide.
DNA Sequencing
The PCR products were cloned into a pGEM-T vector (Promega, Madison, WI). DNA sequencing was performed using the Dye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA). Sequencing reactions were read on an ABI Prism Model 377 cycle sequencer (Applied Biosystems).
Statistical Analysis
Chi-square analysis was used to determine statistically significant differences (P⬍.05) between experimental groups.
RESULTS
To clarify the relationship between mitochondrial defect and the fertilization potential of oocytes, we collected 124 unfertilized oocytes, 98 compromised embryos, and 45 3PN embryos. Total cellular DNA was extracted from these donated samples and examined for mtDNA mutations with PCR using nested primers. Multiple PCR fragments with lengths shorter than expected were observed after PCR amplification of deleted mtDNA with specific primer sets (Table 1). Thirteen mtDNA rearrangements were identified, and the deletion junction was determined by direct sequencing of the PCR products. Table 1 shows the length of deletions, deletion junctions, and primers used to characterize the 13 established mtDNA deletions.
These deletions may be grouped into two classes: type I deletion, which is the dominant one bearing the same nucleotide sequences flanking the breakpoints at the 5⬘ and 3⬘ ends of the deletion; and type II deletion which does not harbor such direct repeat sequences. Nine of the 13 deleted mtDNA molecules belong to type I dele-tion, whose direct repeat sequences are shown in Table 1. The occurrence of multiple mtDNA deletions was 77.9% for unfertilized oocytes, 38.2% for arrested and frag-mented embryos, and 26.3% for 3PN embryos (Table 2). The proportions of increased deleted mtDNA are signifi-cant in unfertilized oocytes compared to arrested embryos or 3PN embryos. However, there is no statistically signif-icant difference between arrested embryos and 3PN embryos.
The 4977-bp deletion was the most common one ob-served in this study. We also determined the frequency of occurrence of such rearranged mtDNA in three groups of
samples. The incidence was 66.1% in unfertilized oocytes, 34.8% in arrested embryos, and 21.1% in 3PN embryos (Table 3). Therefore, there was a significant increase in the proportion of deleted mtDNA in unfertilized oocytes (P⬍.001). These data suggest that deleted mtDNA may interfere with oocyte fertilization, especially if the 4977-bp mtDNA deletion occurs.
The samples were grouped into three different cohorts according to maternal age: younger than 32 years old, be-tween 32 and 37 years old, and older than 37 years. The frequencies of occurrence of the 4977-bp deletion and mul-tiple deletion of mtDNA in embryos and oocytes by different age cohorts are presented in Table 4. Although there was a slight increase of mtDNA with 4977 bp and multiple dele-tions of unfertilized oocytes in patients aged over 37 as compared with those aged less than 32, there was no statis-tical correlation between patient age and the frequency of occurrence of the 4977 bp mtDNA deletion.
T A B L E 1
Types of mitochondrial DNA rearrangements in human unfertilized oocytes, arrested embryos, and 3PN embryos.
Deletion type Deleted length (bp) Primer pairs PCR product (bp) Deletion junction Direct repeat sequence I (13/13)a 4977 H1⫹L1 389 8470–13446 ACCTCCCTCACCA I (12/12) 7436 H1⫹L4 690 8637–16072 CATCAACAACCG I (12/12) 4237 H3⫹L2 702 9486–13722 TTCGCAGGATTT I (10/10) 4642 H3⫹L2 297 9431–14072 CCAAAAAGGC I (9/9) 4365 H3⫹L2 574 9579–13943 AATCCCCTA I (7/7) 7150 H1⫹L3 462 8581–15730 GCCGCAG I (7/7) 5228 H1⫹L2 633 8771–13998 CTAACCT I (6/7)b 6130 H2⫹L3 986 9189–15318 CCT(A)GCA I (6/7) 5007 H1⫹L2 854 8987–13993 TAG(C)CCT II 4921 H1⫹L1 445 8503–13423 II 7276 H1⫹L4 850 8712–15987 II 6827 H2⫹L3 289 8810–15636 II 4036 H3⫹L2 903 9697–13732
Note: Type I deletions bear direct repeats flanking the breakpoints at the 5⬘ and 3⬘ ends of the deletion. Type II deletions do not exhibit such a feature.
aNucleotide number of the direct repeat.
bSix out of seven nucleotides are direct repeat sequence.
Hsieh. mtDNA rearrangements in unfertilized oocytes. Fertil Steril 2002.
T A B L E 2
Frequency of occurrence of mtDNA deletions in human unfertilized oocytes, arrested embryos, and 3PN embryos by nested PCR.
No. analyzed No. amplified No. deletions Frequency (%)
Unfertilized oocytes 124 109 85 77.9a
Arrested embryos 98 89 34 38.2a
3PN embryos 42 38 10 26.3a
Note: The occurrence of any one or more than one of the 13 deletions was considered as positive when counting the frequency of occurrence of mtDNA
deletions.
aStatistically significant difference (P⬍.001) by2analysis.
DISCUSSION
The results obtained in this study show that both human oocytes and embryos harbor multiple rearrangements of mtDNA. The primordial oocyte is formed during fetal de-velopment and remains in a dyctiate state of meiotic prophase until it resumes meiosis later in life (17). Thus, an oocyte can stay in this resting phase for more than 40 years. It has been suggested that the production of reactive oxygen species (ROS) during such a long period can lead to a decline in oocyte quality (18). It is unclear whether damage caused by ROS occurs during the long primordial follicle stage or during follicular growth. Primordial oocytes may have a low oxygen demand, possibly further reflecting the low number of mtDNA copies (19, 20).
The environment is anaerobic in primordial oocytes, and this further reduces the chance of ROS formation. However, oocyte growth is accompanied by a 100-fold increase in the copy numbers of mtDNA, indicating an increase in oxygen-mediated metabolism and ROS formation (19, 20). Thus, mutant mtDNAs may accumulate in oocytes during the long period of oogenesis. The occurrence of rearranged mtDNA is significantly reduced if the oocytes are capable of fertiliza-tion.
Two plausible mechanisms elucidate the tendency for a
higher proportion of mtDNA deletions in unfertilized oo-cytes. One, accumulation of mtDNA rearrangements in the process of oogenesis, causes mitochondrial dysfunction. In-adequate amounts of ATP are produced via oxidative phos-phorylation of defective mitochondria, which will result in an insufficient energy supply for efficient completion of meiosis I of an oocyte into a mature oocyte and for fertili-zation. Second, defective mitochondria may lose membrane potential and then release cytochrome c or other mitochon-dria-associated apoptosis-inducing factors, which in turn trigger germ cells into the apoptotic pathway.
In females of many species, over half of the oocyte population dies by apoptosis before birth (21). Krakauer et al. (22) have reported this death of germ cells as a develop-mental solution to the accumulation of mutations in mito-chondria, proposing that the prenatal oocyte apoptosis effec-tively removes oocytes carrying mutant mitochondria. Moreover, mitochondria influencing the fate of oocytes has also been proven by microinjecting small numbers of mito-chondria into mouse oocytes, which prevents these oocytes with inherently high rates of apoptosis from undergoing programmed cell death (23).
The 4977-bp deletion is the most common mtDNA dele-tion in human oocytes and embryos, with frequencies of
T A B L E 3
Frequency of occurrence of the 4977 bp deleted mtDNA in human unfertilized oocytes, arrested embryos, and 3PN embryos by nested PCR.
No. analyzed No. amplified No. deletions Frequency (%)
Unfertilized oocytes 124 109 72 66.1a
Arrested embryos 98 89 31 34.8a
3PN embryos 42 38 8 21.1a
aStatistically significant difference (P⬍.001) by2analysis.
Hsieh. mtDNA rearrangements in unfertilized oocytes. Fertil Steril 2002.
T A B L E 4
Frequency of occurrence of mtDNA deletions in human unfertilized oocytes, arrested embryos, and 3PN embryos of different age cohorts.
Sample
Type of rearranged mtDNA
Percentage of rearranged mtDNA (%)
⬍32a 32–37a ⬎37a Unfertilized oocytes 4977 bp 56.3 (27/48) 74.3 (26/35) 73.0 (19/26) multiple 68.8 (33/48) 82.9 (29/35) 88.5 (23/26) Arrested embryos 4977 bp 42.9 (9/21) 36.2 (17/47) 23.8 (5/21) multiple 47.6 (10/21) 36.2 (17/47) 33.3 (7/21) 3PN embryos 4977 bp 9.1 (1/11) 23.5 (4/17) 30.0 (3/10) multiple 27.3 (3/11) 23.5 (4/17) 30.0 (3/10)
aMaternal age (year).
66.1% in unfertilized oocytes, 34.8% in arrested embryos, and 21.1% in 3PN embryos. Additionally, several investiga-tors have already analyzed the 4977-bp deletion commonly found in the affected tissues of patients of mitochondrial myopathy and aging-associated tissues (11, 24 –26). The 4977-bp deletion causes the removal of major structural genes containing Fo-F1-ATPase (ATPase 6 and 8), cyto-chrome oxidase (CO III), and NADH-CoQ oxidoreductase (ND3, ND4, ND4L, and ND5). This deletion also creates a chimeric gene, which fuses the 5⬘-proportion of ATPase 8 and 3⬘-proportion of ND5 genes of mtDNA. Therefore, the deleted or truncated genes in this rearranged mtDNA may result in impaired gene expression by decreasing expression of the deleted genes or by producing transcripts of fused genes.
No evidence has been shown to indicate that such kinds of deletions will interfere with amplification and stability of new truncated mtDNA. Adversely, Shoffner et al. (27) pro-posed that the faster replication of deleted mtDNA (it is shorter than a normal mtDNA) might give it a selective advantage in propagation. However, no replicative advan-tage for the smaller deleted molecules has been reported in other studies (28). We suggested that the deleted mtDNA accumulated in oocytes might interfere with the fertilization ability. Therefore, the deletion rate appears higher in eggs than embryos.
Thirteen different mtDNA deletions were identified in human oocytes and embryos in this study. Nine of the 13 harbored direct repeats in the junction of mtDNA deletions. These deletions may be grouped into two types: one bearing direct repeats flanking the breakpoints at the 5⬘ and 3⬘ ends of the mtDNA deletion (type I), and the others contain no such feature (type II). It seems that more than one mecha-nism of deletion is operating in causing these mtDNA dele-tions. As previously proposed, deletions with direct repeats are probably caused by slippage mispairing at the direct repeats during mtDNA replication (27). Oocytes often con-tain deleted mtDNA other than the 4977-bp deletion, which demonstrates the presence of heteroplasmy of mtDNA. The frequency of deletions in human embryos is lower than that in oocytes, suggesting that superior oocytes with fewer mtDNA deletions have been selected by nature for fertiliza-tion during IVF or intracytoplasmic sperm injecfertiliza-tion (ICSI) procedures.
Using a nested PCR strategy, our results show a higher frequency of the 4977-bp deleted mtDNA in oocytes (66.1%, n ⫽ 109) when compared with results of Chen et al. (4)
(49%, n ⫽ 104), Keefe et al. (29) (43%, n ⫽ 51), and
Brenner et al. (30) (32.8%, n⫽ 74). In this study there was no correlation between the 4977-bp deletion in human oo-cytes and embryos with the age of the patient. However, only one report showed a significant association between patient age and this deletion (29). It suggests that this deletion is not a suitable indicator for reproductive senescence. The
plausi-ble explanation may be that the previous three studies in-cluding this study were all qualitative rather than quantita-tive studies. Therefore, further quantitaquantita-tive study is mandatory and is undergoing in our laboratory to clarify the association between maternal age and deleted mtDNA in human oocytes and embryos.
Many factors cause fertilization failure after in vitro in-semination (31, 32); one of the reasons is chromosomal abnormalities (33, 34). Numerous chromosomal disorders and structural defects arise during meiotic metaphase, there-fore predisposing a fertilized oocyte to developmental failure (35, 36). These chromosomal nondisjunctions may result from defective mitochondrial function at the stage of chro-mosomal segregation (37, 38). A wide range of ATP con-tents has been detected in meiotically mature oocytes from the same and different patients. However, a higher potential for continued embryogenesis and further implantation is correlated with oocytes with higher ATP concentrations (16). The efficiency of mitochondrial respiration in oocytes and preimplantation embryos is closely correlated with the programmed rate of embryo development (39). A deficiency in mitochondrial ATP production may be associated with various cellular and chromosomal disorders and the failure of oocyte fertilization and embryo development.
The ICSI procedure assumes that only a single sperma-tozoon is microinjected in each oocyte, but sometimes some zygotes show three pronuclei (3PN) instead of the expected two by 16 to 18 hours after ICSI (40, 41). The most probable hypothesis to explain the existence of 3PN would be normal fertilization by a single injected spermatozoon along with the nonextrusion of a second polar body (40, 42). There were no reports implying that cytoplasmic or mitochondrial dysfunc-tion would cause formadysfunc-tion of 3PN zygotes. Decreased ATPase 6 gene expression was found in unfertilized oocytes compared with 3PN embryos (43). Injection of the cyto-plasm of 3PN embryos may enhance the clinical pregnancy rate in patients with repeated implantation failure (44). Our findings about decreased proportions of multiple deleted mtDNA (26.3%) and the 4977 deletion (21.1%) in 3PN embryos may also indicate the normal growth rates of 3PN embryos. In conclusion, our results imply that oocytes with mutant mtDNA exist among mature oocytes, being espe-cially higher in unfertilized oocytes, and that the decrease in energy supply may interfere with oocyte fertilization and embryo development.
References
1. Giles RE, Blanc H, Cann HM, Wallace DC. Maternal inheritance of human mitochondrial DNA. Proc Natl Acad Sci USA 1980;77:6715–9. 2. Piko L, Taylor KD. Amounts of mitochondrial DNA and abundance of some mitochondrial gene transcripts in early mouse embryos. Dev Biol 1987;123:364 –74.
3. Michaels GS, Hauswirth WW, Laipis PJ. Mitochondrial DNA copy number in bovine oocytes and somatic cells. Dev Biol 1982;94:246 –51. 4. Chen X, Prosser R, Simonetti S, Sadlock J, Jagiello G, Schon EA. Rearranged mitochondrial genomes are present in human oocytes. Am J Hum Genet 1995;57:239 – 47.
5. Taanman JW. The mitochondrial genome: structure, transcription, translation and replication. Biochim Biophys Acta 1999;1410:103–23.
6. Harman D. The biologic clock: the mitochondria? J Am Geriatr Soc 1972;20:145–7.
7. Baker TG. A quantitative and cytological study of germ cells in human ovaries. Proc Roy Soc (London) B Biol Med 1963;158:417–33. 8. Wei YH. Mitochondrial DNA alterations as ageing-associated
molec-ular events. Mutat Res 1992;275:145–55.
9. Wallace DC. Mitochondrial genetics: a paradigm for aging and degen-erative diseases? Science 1992;256:628 –32.
10. Hsieh RH, Li JY, Pang CY, Wei YH. A novel mutation in the mito-chondrial 16S rRNA gene in a patient with MELAS syndrome, diabetes mellitus, hyperthyroidism and cardiomyopathy. J Biomed Sci 2001;8: 328 –35.
11. Moraes CT, DiMauro S, Zeviani M, Lombes A, Shanske S, Miranda AF, et al. Mitochondrial DNA deletions in progressive external oph-thalmoplegia and Kearns-Sayre syndrome. N Engl J Med 1989;320: 1293–9.
12. Rotig A, Cormier V, Koll F, Mize CE, Saudubray JM, Veerman A, et al. Site-specific deletions of the mitochondrial genome in the Pearson marrow-pancreas syndrome. Genomics 1991;10:502– 4.
13. Wallace DC. Mitochondrial diseases: genotype versus phenotype. Trends Genet 1993;9:128 –33.
14. Ebert KM, Liem H, Hecht NB. Mitochodrial DNA in the mouse preimplantation embryo. J Reprod Fertil 1988;1:145–9.
15. Meirelles FV, Smith LC. Mitochondrial genotype segregation during preimplantation development in mouse heteroplasmic embryos. Genet-ics 1998;148:877– 83.
16. van Blerkom J, Davis PW, Lee J. ATP content of human oocytes and developmental potential and outcome after in-vitro fertilization and embryo transfer. Hum Reprod 1995;10:415–24.
17. Byskov AG. Differentiation of mammalian embryonic gonad. Physiol Rev 1986;66:71–117.
18. Tarin JJ. Potential effects of age-associated oxidative stress on mam-malian oocytes/embryos. Mol Hum Reprod 1996;2:717–24.
19. Jenuth JP, Peterson AC, Fu K, Shoubridge EA. Random genetic drift in the female germline explains the rapid segregation of mammalian mitochondrial DNA. Nat Genet 1996;14:146 –51.
20. Jansen RP, de Boer K. The bottleneck: mitochondrial imperatives in oogenesis and ovarian follicular fate. Mol Cell Endocrinol 1998;145: 81– 8.
21. Morita Y, Tilly JL. Oocyte apoptosis: like sand through an hourglass. Dev Biol 1999;213:1–17.
22. Krakauer DC, Mira A. Mitochondria and germ-cell death. Nature 1999;400:125– 6.
23. Perez GI, Trbovich AM, Gosden RG, Tilly JL. Mitochondria and the death of oocytes. Nature 2000;403:500 –1.
24. Hsieh RH, Hou JH, Hsu HS, Wei YH. Age-dependent respiratory function decline and DNA deletions in human muscle mitochondria. Biochem Mol Biol Int 1994;32:1009 –22.
25. Kao SH, Chao HT, Wei YH. Multiple deletions of mitochondrial DNA are associated with the decline of motility and fertility of human spermatozoa. Mol Hum Reprod 1998;4:657– 66.
26. Fahn HJ, Wang LS, Hsieh RH, Chang SC, Kao SH, Huang MH, et al. Age-related 4,977 bp deletion in human lung mitochondrial DNA. Am J Respir Crit Care Med 1996;154:1141–5.
27. Shoffner JM, Lott, MT, Voljavec AS, Soueidan SA, Costigan DA,
Wallace DC. Spontaneous Kearns-Sayre/chronic external ophthalmo-plegia plus syndrome associated with a mitochondrial DNA deletion: a slip-replication model and metabolic therapy. Proc Natl Acad Sci USA 1989;86:7952– 6.
28. Tang Y, Manfredi G, Hirano M, Schon EA. Maintenance of human rearranged mitochondrial DNAs in long-term cultured transmitochon-drial cell lines. Mol Biol Cell 2000;11:2349 –58.
29. Keefe DL, Niven-Fairchild T, Powell S, Buradagunta S. Mitochondrial deoxyribonucleic acid deletions in oocytes and reproductive aging in women. Fertil Steril 1995;64:577– 83.
30. Brenner CA, Wolny YM, Barritt JA, Matt DW, Munne S, Cohen J. Mitochondrial DNA deletion in human oocytes and embryos. Mol Hum Reprod 1998;4:887–92.
31. Tesarik J. Sex chromosome abnormalities after intracytoplasmic sperm injection. Lancet 1995;346:1096.
32. Tomas C, Orava M, Tuomivaara L, Martikainen H. Low pregnancy rate is achieved in patients treated with intracytoplasmic sperm injection due to previous low or failed fertilization in in-vitro fertilization. Hum Reprod 1998;13:65–70.
33. Djalali M, Rosenbusch B, Wolf M, Sterzik K. Cytogenetics of unfer-tilized human oocytes. J Reprod Fertil 1988;84:647–52.
34. Almeida PA, Bolton VN. The relationship between chromosomal ab-normalities in the human oocyte and fertilization in vitro. Hum Reprod 1994;9:343– 6.
35. Lim AS, Ho AT, Tsakok MF. Chromosomes of oocytes failing in-vitro fertilization. Hum Reprod 1995;10:2570 –5.
36. Nakaoka Y, Okamoto E, Miharu N, Ohama K. Chromosome analysis in human oocytes remaining unfertilized after in-vitro insemination: effect of maternal age and fertilization rate. Hum Reprod 1998;13:419 –24. 37. Jansen RP, de Boer K. The bottleneck: mitochondrial imperatives in
oogenesis and ovarian follicular fate. Mol Cell Endocrinol 1998;145: 81– 8.
38. van Blerkom J, Sinclair J, Davis P. Mitochondrial transfer between oocytes: potential applications of mitochondrial donation and the issue of heteroplasmy. Hum Reprod 1998;13:2857– 68.
39. Wilding M, Dale B, Marino M, di Matteo L, Alviggi C, Pisaturo ML, et al. Mitochondrial aggregation patterns and activity in human oocytes and preimplantation embryos. Hum Reprod 2001;16:909 –17. 40. van Steirteghem AC, Nagy Z, Joris H, Liu J, Staessen C, Smitz J, et al.
High fertilization and implantation rates after intracytoplasmic sperm injection. Hum Reprod 1993;8:1061– 6.
41. Macas E, Imthurn B, Rosselli M, Keller PJ. The chromosomal com-plements of multipronuclear human zygotes resulting from intracyto-plasmic sperm injection. Hum Reprod 1996;11:2496 –501.
42. Grossmann M, Calafell JM, Brandy N, Vanrell JA, Rubio C, Pellicer A, et al. Origin of tripronucleate zygotes after intracytoplasmic sperm injection. Hum Reprod 1997;12:2762–5.
43. Lee SH, Han JH, Cho SW, Cha KE, Park SE, Cha KY. Mitochondrial ATPase 6 gene expression in unfertilized oocytes and cleavage-stage embryos. Fertil Steril 2000;73:1001–5.
44. Huang CC, Cheng TC, Chang HH, Chang CC, Chen CI, Liu J, et al. Birth after the injection of sperm and the cytoplasm of tripronucleate zygotes into metaphase II oocytes in patients with repeated implanta-tion failure after assisted fertilizaimplanta-tion procedures. Fertil Steril 1999;72:702– 6.