• 沒有找到結果。

Cloning, Expression, and Characterization of Two β-Glucosidases from Isoflavone Glycoside-Hydrolyzing Bacillus subtilis natto

N/A
N/A
Protected

Academic year: 2021

Share "Cloning, Expression, and Characterization of Two β-Glucosidases from Isoflavone Glycoside-Hydrolyzing Bacillus subtilis natto"

Copied!
7
0
0

加載中.... (立即查看全文)

全文

(1)

Cloning, Expression, and Characterization of Two

β-Glucosidases from Isoflavone

Glycoside-Hydrolyzing Bacillus subtilis natto

L

UN

-C

HENG

K

UO AND

K

UNG

-T

A

L

EE

*

Institute of Microbiology and Biochemistry, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei, Taiwan, Republic of China

On the basis of the genomic sequence of Bacillus subtilis 168, two β-glucosidase genes (bglH and yckE) from B. subtilis natto, which has been reported to have high isoflavone glucoside-hydrolyzing activity, were cloned and overexpressed in E. coli M15. The temperature for the optimal p-nitrophenyl-β-D-glucoside hydrolyzing activity of both enzymes was between 37 and 45°C, but BglH had a higher thermal stability than YckE. Both showed high activity at pH 6.0, but YckE was stable over a wider pH range than BglH. Recombinant BglH was inhibited 73%, 63%, and 43% by 1.0 mM Cd2+, Fe2+, or Cu2+, respectively, while other divalent metal ions resulted in 0–23% inhibition, whereas YckE was inhibited by less than 20% by any of the divalent metal ions we tested. Among the substrate we used, BglH showed the highest affinity for genistin and YckE showed the highest affinity for p-nitrophenyl-β-D-fructopyranoside. Both BglH and YckE hydrolyzed genistin and daidzin into their isoflavone aglycones, genistein and daidzein, but BglH was more efficient than YckE in isoflavone glucoside hydrolysis (20-fold higher kcat). Our results suggest that recombinant BglH may be applicable

in the process of isoflavones deglycosylation.

KEYWORDS: Bacillus subtilis natto; isoflavone;β-glucosidases; BglH; YckE INTRODUCTION

Among the foods eaten by humans, soybeans contain the

highest concentration of isoflavones. These soy isoflavones (e.g.,

daidzein and genistein) are implicated in some health-enhancing

properties, such as prevention of certain cancers (1–3), lowering

the risk of cardiovascular diseases (4, 5), and improvement in

bone health (6, 7). In vitro studies of metabolites produced from

the total microflora of volunteers have shown that the

bioavail-ability of soybean isoflavonoids depends upon the bioavail-ability of the

gut microflora to metabolize these compounds (8, 9).

Numerous studies have shown that the biological effects of

isoflavones are not due to the glycoside form, but mainly to

their aglycones, such as daidzein and genistein (10, 11).

Aglycone isoflavones are highly bioactive due to their

unim-peded intestinal absorption, unlike their related glycosides, which

are not absorbed across enterocytes because of their higher

hydrophilicity and molecular weights (12–14). Isoflavone

ag-lycones are present in high amounts in soy products, such as

miso, natto, and tempeh, produced, respectively, by Aspergillus

oryzae (15), Bacillus subtilis natto (16, 17), and Rhizopus

oligosporus (18). Bifidobacteria

β-glucosidase can convert

isoflavone glucosides in soymilk to their aglycones (19), and

β-glucosidase from Saccharopolyspora erythraea can hydrolyze

genistin during fermentation of soy-based media (20). These

bacteria with

β-glucosidase activity are potentially important

in the production of compounds with higher estrogenicity and

better absorption, thus affecting their bioavailability and

phar-macokinetics.

β-Glucosidase (β-glucoside glucohydrolase, EC 3.2.1.21) is

the key enzyme for carbohydrate metabolism in bacteria that

are able to cleave the

β-glucosidic linkages of di- and/or

oligosaccharides or other glucose conjugates (21).

β-Glucosi-dases are widely distributed in living organisms and play pivotal

roles in many biological processes, such as the degradation of

cellulosic biomass (22), cyanogenesis (23), and the cleavage

of glucosylated flavonoids (24).

According to previous reports, the isoflavone

glycoside-hydrolyzing

β-glucosidases of B. subtilis natto (16, 25) or lactic

acid bacteria (26, 27) are cell-associated and difficult to purify;

as a result, there have been no reports of the biochemical

properties of these enzymes. In our previous study (25), a strain

of B. subtilis natto NTU-18 with high isoflavone

glycoside-hydrolyzing

β-glucosidase activity was selected from

com-mercial natto product (a traditional soy fermentation product

in Japan and eastern Asia), and a fermentation process for

deglucosylation of black soybean isoflavones was established.

In the present study, two

β-glucosidase genes (bglH and yckE)

were cloned from B. subtilis natto NTU-18 and the

character-istics of the recombinant enzymes expressed in E. coli were

investigated.

* Corresponding author. E-mail: [email protected]. Phone: +886-2-33664436. Fax: +886-2-23640961.

10.1021/jf072287q CCC: $40.75 2008 American Chemical Society Published on Web 12/11/2007

(2)

MATERIALS AND METHODS

Chemicals and Reagents. Genistein, daidzein,

genistein-7-O-glucoside (genistin), daidzein-7-O-genistein-7-O-glucoside (daidzin), p-nitrophenol,

p-nitrophenyl-β-D-glucoside (pNPG), o-nitrophenyl-β-D

-galactopyra-noside (pNPGal), p-nitrophenyl-β-D-fructopyranoside (pNPF), and

p-nitrophenyl-β-D-cellobioside were purchased from Sigma Chemical

Co. (St. Louis, MO). Liquid chromatography grade acetonitrile and reagent grade absolute alcohol were purchased from Merck (Darmstadt, Germany). Nutrient broth (NB) and Bacto-agar were purchased from Difco (Detroit, MI). Isopropyl-β-D-thiogalactopyranoside (IPTG) was

purchased from MDBio (Taipei, Taiwan).

Bacterial Strains, Plasmids, and Media. A strain of B. subtilis

natto NTU-18 with high β-glucosidase activity (with pNPG as the

substrate) was previously obtained from commercial natto product (25). The strain was maintained on nutrient broth (NB) (Difco, Detroit, MI)

slants at 4 °C. Escherichia coli JM109 (Yeastern Biotech, Taiwan) containing the pGEM-T Easy vector (Promega, USA) was used for plasmid preparation and gene cloning, and the E. coli M15 strain (QIAGEN, Hilden, Germany) containing the pQE-30Xa vector (QIAGEN, Hilden, Germany) was used to express 6× His-tagged recombinant proteins. All E. coli cells containing plasmids were grown aerobically in Luria–Bertani (LB) medium (DIFCO, USA) or on LB agar plates at 37°C, supplemented with ampicillin (100µg/mL) and (or) kanamycin

(25µg/mL) when necessary.

Construction of the Expression System. Genomic DNA of B. subtilis

natto NTU-18 was isolated according to Sambrook et al. (28) and used as the polymerase chain reaction (PCR) template. To amplify the DNA fragment encoding bglH, PCR was performed using the forward primer

bglH-F (5

′GCAGGATCCATGAGTTCAAATGAAAAACGATTTCC-AGAAGG) and reverse primer bglH-R (5′CTACTGCAGTCAGA-GACTCTCTCCGTTTGTGGCG), which introduce BamHI and PstI sites, respectively, at the 5′and 3′-termini of the bglH gene. To amplify the DNA fragment encoding yckE, PCR was performed using the forward primer yckE-F (5′CTGAGGCCTATGATCCACCAGCATCCAGAATC) and reverse primer yckE-R (5′CTAGGATCCTTATAAACTTTCTC-CGTTTCTCTTG), which introduce StuI and BamHI sites, respectively, at the 5′and 3′-termini of the yckE gene (the enzyme sites are shown in bold). Amplification was carried out in a thermo Px2 thermal cycler machine using the conditions of 5 min of denaturation at 95°C, 30 cycles for 1 min at 94°C and 1 min at 55°C, and a final extension phase at 72 °C for 1 min and 40 s. The PCR products were ligated into the pGEM-T Easy Vector System (Promega, USA), the ligation products were trans-formed into E. coli strain JM109, and the recovered plasmids were confirmed as correct by restriction analysis and DNA sequencing. The

Figure 1. Putative catalytic regions of BglH and YckE. The arrows indicate the conserved catalytic residues.

Table 1. Purification of Recombinant BglH and YckE Expressed in E. coli

M15a name purification step total protein (mg) total activity (U) specific activity (U/mg) purification (fold) yield (%) BglH crude extractb 358.0 623.0 1.74 1.0 100.0 His-binding columnc 170.8 450.8 2.64 1.5 72.4 YckE crude extractb 421.4 573.2 1.36 1.0 100.0

His-binding columnc

168.3 333.0 1.98 1.5 58.1

aOne unit of enzyme activity was defined as the amount of enzyme which released 1 µmol of p-nitrophenol per minute.bThe recombinant strain was grown in LB medium with 25 kanamycin µg/mL and 100 amplicillin µg/mL at 37°C to OD6001.0 and was incubated further with IPTG at a final concentration of 0.05 mM for 12 h at 25°C. The cells of 700 mL cultures were harvested by centrifugation at 10 000g for 10 min at 4°C, resuspended in 50 mL lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0), and then disrupted by sonication.cThe resulting supernatants were loaded onto an Ni-NTA affinity column equilibrated with the binding buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0), and the bound proteins were eluted with elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 8.0). The fractions exhibiting enzyme activity were pooled and dialyzed against 100 mM sodium phosphate buffer, pH 6.0.

Figure 2. SDS-PAGE analysis of purified recombinant BglH and YckE: BglH (1 or 2 µg; lanes 2 and 3), YckE (1 or 2 µg; lanes 4 and 5), and molecular markers (lane 1) stained with Coomassie Blue.

Figure 3. Effect of pH on the activity of recombinant BglH and YckE: (A) BglH, (B) YckE. The buffers used were the following: pH 3.0–6.0, 100 mM citric acid-citrate buffer (O); pH 6.0–8.0, 100 mM sodium phosphate buffer (9); pH 7.0–9.0, 50 mM Tris-HCl buffer (2). The optimal pH was determined at 37°C for 10 min in the 100 mM citric acid-citrate buffer at pH 3.0–6.0, 100 mM sodium phosphate buffer at pH 6.0–8.0, or Tris-HCl buffer at pH 7.0–9.0 with pNPG as a substrate.

(3)

nucleotide and amino acid sequences were compared to the sequences in the GeneBank at the National Center for Biotechnology Information (Bethesda, MD) using the BLAST network server. Plasmid DNA in the clones was extracted using a QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany), digested appropriately, and ligated into pQE30-Xa (Qiagen, Hilden, Germany) which provides high-level expression in E. coli of proteins containing a 6× His affinity tag at the N-terminus of the protein; then, the ligation products were transformed into E. coli strain M15, and the recovered plasmids were confirmed as correct by restriction analysis and DNA sequencing. The resulting plasmids were named pQE-30Xa-BglH and pQE-30Xa-YckE, respectively. DNA manipulations, including digestion with restriction enzymes, purification of DNA fragments, ligation with T4 ligase, and transformation, were performed as described by Sambrook et al. (28).

Expression and Purification of the Recombinantβ-Glucosidases. E. coli M15 harboring the recombinant plasmid pQE-30Xa-BglH or

pQE-30Xa-YckE were grown to an A600 of 1.0 in LB medium supplemented with 25µg/mL kanamycin and 100 µg/mL ampicillin at

37°C, then induced to produce a target protein by adding IPTG at a final concentration of 0.05 mM, followed by incubation for 12 h at 25 °C. All subsequent steps were at 4°C. The cells were harvested by centrifugation, washed twice with lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0), and the cell pellet resuspended in the same buffer and lysed by sonication. The cell lysate was centrifuged at 10 000g for 20 min to remove cell debris, and the supernatant was applied to an Ni-NTA affinity column (Qiagen, Hilden, Germany) equilibrated with 1× binding buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0). The recombinant proteins were eluted with Elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 8.0). Fractions containing enzyme activity were pooled and dialyzed against 100 mM sodium phosphate buffer, pH 6.0, and the enzyme preparation was stored at -80°C. The protein concentration was determined using a Bio-Rad protein assay kit, with bovine serum albumin as the standard.

Electrophoresis Analyses and Protein Assay. The apparent

mo-lecular weights of the purified enzymes were determined using 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were stained with Coomassie Brilliant Blue R-250.

Enzyme Assay. Theβ-glucosidase assay was modified from the

work of Choi et al. (26). The activity of the purifiedβ-glucosidases

was estimated by mixing 50µL of enzyme with 50 µL of 5 mM pNPG

in 100 mM sodium phosphate buffer, pH 6.0, incubating the mixture for 10 min at 37°C, adding 100µL of 2 M Na2CO3to stop the reaction, measuring the absorbance at 405 nm, and comparing it to a standard curve prepared by measuring the A405 of various concentrations of

p-nitrophenol. One unit of enzyme activity was defined as the amount

of enzyme that liberates 1µmol of p-nitrophenol per minute.

times and, then, assaying the remaining activity under the standard conditions.

Effect of pH on Enzyme Activity. To determine the optimum pH

for the enzyme, activities were measured over a pH range of 3.0–9.0 in increments of 1.0 pH unit using the standard assay conditions. The buffers used were a 100 mM citric acid-citrate buffer (pH 3.0–6.0), 100 mM sodium phosphate buffer (pH 6.0–8.0), and 50 mM Tris-HCl buffer (pH 7.0–9.0).

Substrate Specificity and Kinetic Studies. Substrate specificity was

determined by incubating the enzyme at 37°C for 10 min in 100 mM sodium phosphate buffer, pH 6.0, containing a 0–2.5 mM final concentration of different nitrophenyl substrates or isoflavone glucosides and the Michaelis–Menten kinetic parameters for the purified enzyme determined from substrate saturation assays. The substrates used were

pNPG, pNPGal, pNPF, p-nitrophenyl-β-D-cellobioside, daidzin, and genistin. The values for the maximum velocity and half-saturation coefficient (Km) were determined by plotting the substrate concentration vs the initial velocity for each reaction and subjecting the data to nonlinear regression analysis. Kinetic analyses by curve fitting were performed using SigmaPlot software. Values shown are the mean of duplicate experiments with each substrate, and the variation about the mean was below 5%.

HPLC Analyses. HPLC analysis of isoflavones was based on the

work of Wang and Murphy (29). The HPLC system consisted of a Shimadzu SCL-10Avp system controller, two Shimadzu LC-10ATvp liquid chromatograph pumps, and a Shimadzu SPD-M10Avp photo-diode array detector. A Develosil ODS-5 column (250 mm with 4.6 mm packing) was used. The solutions used to generate the gradient were 0.1% (v/v) glacial acetic acid in H2O (solvent A) and 80% (v/v) acetonitrile (Merck, Darmstadt, Germany) in solvent A (solvent B). Following injection of 20µL of sample, solvent B was increased linearly

from 15% to 70% over 30 min and, then, returned to 15% for 10 min The solvent flow rate was 1.0 mL/min. Elution was monitored by UV absorbance at 262 nm, and the spectral data from 190 to 800 nm of the peaks were recorded to confirm their identity. Peak areas were integrated for quantification. Daidzin, genistin, daidzein, and genistein were identified by comparison with the HPLC retention time and UV spectra of the authentic compounds. The isoflavone concentration of the samples was calculated using calibration curves prepared using various concentrations of the isoflavone standards.

Statistical Analysis. The data of the significantly altered expression

in each enzyme assay mean value (from triplicate experiments) with the corresponding mean value of the control and the test expression change using student’s t test. P values < 0.05 were considered statistically significant.

RESULTS

Gene Cloning of Two

β-Glucosidases from B. subtilis

natto. The B. subtilis natto NTU-18 strain was chosen for this

β-glucosidase gene cloning study because it efficiently

hydro-lyzes isoflavone glucosides into isoflavone aglycones (25), and

this reaction is known to be catalyzed by

β-glycosidase (16).

Two

β-glycosidase genes (bglH and yckE) in B. subtilis 168

were identified by searching the NCBI genome database and

were amplified from the genome of B. subtilis natto NTU-18

by PCR (30). The sizes of these two genes were 1410 base

pairs (bglH) and 1434 base pairs (yckE). The BglH contained

470 amino acids, with a calculated molecular weight of 53 kDa.

And, the YckE contained 478 amino acids, with a calculated

molecular weight of 54 kDa. Alignment of the two nucleotide

sequences with the NCBI database, the nucleotide sequence of

bglH showed 98% and 78% homology with the gene of B.

subtilis 168 and B. licheniformis, respectively, and the nucleotide

sequence of yckE showed 98% and 78% homology with the

Figure 4. Effect of temperature on the activity of recombinant BglH and YckE: BglH (b), YckE (O). The optimal temperature for the enzyme activity was determined by assay at 20-50°C in 100 mM sodium phosphate buffer, pH 6.0, with pNPG as a substrate.

(4)

gene of B. subtilis 168 and B. amyloliquefaciens, respectively.

The deduced amino acid sequence of BglH and YckE were used

to compare with other amino acid sequences deposed in the

NCBI database. The BglH exhibits the highest identity score

with B. subtilis 168 BglH (99% identity), followed by B.

licheniformis BglH (87%) and B. amyloliquefaciens BglH

(85%). In the case of YckE, the highest score was also obtained

with B. subtilis 168 YckE (98% identity), followed by B.

licheniformis YckE (86%) and B. amyloliquefaciens YckE

(84%). By comparison of bglH and yckE in B. subtilis natto

NTU-18, it showed 56.2% similarity in nucleotide sequence and

43.7% identical in amino acid sequences. For the found catalytic

domain of BglH and YckE, we using the SIM-Alignment tool

to compare the amino acid sequence of the putative catalytic

domain with other

β-glucosidases. BglH and YckE were found

to contain histidine and glutamate residues in the catalytic

domain (Figure 1).

Overexpression and Purification of the Two

Recombi-nant

β-Glucosidases. To investigate the biochemical

proper-ties of BglH and YckE, we expressed the six-histidine N

terminal-tagged proteins in E. coli M15. Bacteria were

transformed with the expression vector and induced with

IPTG which expressed the histidine-tagged protein. After

treatment of the His-binding column, recombinant BglH was

purified 1.5-fold with a 72.4% yield and YckE was purified

1.5-fold with a 58.1% yield (Table 1). The apparent

molecular weights, determined by SDS-PAGE (12.5% gel),

were about 57 and 58 kDa, respectively (Figure 2). Using

the pQE30-Xa expression system, the N-terminal of the

expression protein contains a six-histidine tag and a factor

Xa recognition site, resulting in a 4 kDa increase in the

molecular weight of the expressed protein. Thus, the actual

molecular weight of BglH was 53 kDa and that of YckE was

54 kDa, corresponding to the expected molecular weights.

Figure 5. Thermal stability of recombinant BglH and YckE: (A) BglH, (B) YckE. The purified enzyme in 100 mM sodium phosphate buffer, pH 6.0, was preincubated for various times at 30 (b), 37 (O), 45 (1), or 50°C (3) in the absence of substrate and, then, was assayed under standard conditions with pNPG as a substrate. The activity of the enzyme without preincubation is taken as 100%.

(5)

Biochemical Characterization of the Two Recombinant

β-Glucosidases. To determine the optimal pH for recombinant

BglH and YckE, we measured the enzyme activity at 37

°

C

and various pH values (pH 3.0–9.0), using pNPG as substrate.

As shown in Figure 3, both enzymes showed the highest activity

at pH 6.0, but YckE was active over a wider pH range.

Meanwhile, precipitation was observed for both the recombinant

BglH and YckE treated at pH 4 and 5, and no enzyme activity

was detected in this pH range. To determine the optimal

temperature, enzyme activity was determined over the range of

20–50

°

C. As shown in Figure 4, in the temperature range of

35–45

°

C, recombinant BglH exhibited more than 95% of its

maximal activity, with a sharp decrease above 45

°

C, while

YckE exhibited about 70–100% of its maximal activity over

the same range. To examine the thermal stability of recombinant

BglH and YckE, we incubated the enzymes at different

temperatures (30, 37, 45, and 50

°

C) and measured the residual

activity under standard assay conditions. As shown in Figure

5, recombinant BglH and YckE were fairly stable up to 45

°

C,

but the thermal stability profiles of the two recombinant enzymes

were very different. Recombinant BglH retained 80% of its

activity when incubated at 45

°

C for 2 h, but was completely

inactivated by incubation at 50

°

C for 1 h, whereas recombinant

YckE retained 60% of its activity when incubated at 45

°

C for

2 h or at 50

°

C for 1 h.

The effects of different metal ions (Na

+

, Li

+

, Fe

2+

, Mn

2+

,

Mg

2+

, Cu

2+

, Cd

2+

, Ca

2+

, and Fe

3+

) on enzyme activity were

investigated by addition of the test ions to the reaction mixture

at a final concentration of 1 mM. The activity was then measured

under standard assay conditions and expressed as a percentage

of the activity obtained in the absence of the added ion. As

shown in Table 2, recombinant BglH was inhibited 73%, 63%,

and 43% by 1.0 mM Cd

2+

, Fe

2+

, or Cu

2+

, respectively, while

other divalent metal ions resulted in 0–23% inhibition, whereas

YckE was inhibited by less than 20% by any of the divalent

metal ions.

Kinetic Properties of the Two Recombinant

β-Glucosi-dases. To determine the kinetic properties, the enzyme activity

of the two recombinant

β-glucosidases was assayed by

monitor-ing the hydrolysis of

β-glucosides over different substrates and

a range of concentrations of these substrates. The substrate

specificities of the two recombinant

β-glucosidases are

sum-marized in Table 3. Recombinant BglH showed a lower

Michaelis constant (K

m

) and higher k

cat

for daidzin and genistin

than for the other substrates. Comparison of the K

m

and k

cat

Km

) of the enzyme for different substrates was considered a

measurement of the enzyme’s specificity (specificity constant).

The catalytic efficiency (k

cat

/K

m

) values of recombinant BglH

for genistin, daidzin, p-NPG, p-NPGal, and p-NPF were 147.20,

49.19, 3.01, 1.76, and 0.90 1/(mM s), respectively. Among the

substrates we tested, recombinant BglH showed the highest

catalytic efficiency toward genistin. These results indicated that

genistin was clearly the preferred substrate. The catalytic

efficiency (k

cat

/K

m

) values of recombinant YckE for genistin,

daidzin, p-NPG, p-NPGal, and p-NPF were 19.45, 17.93, 2.44,

1.23 and 306.57 1/(mM s), respectively. The preferred substrate

for recombinant YckE was pNPF, the catalytic efficiency for

pNPF being about 150 times that for pNPG and 16 times that

for genistin. Recombinant YckE also had isoflavone glucoside

deglycosylation activity, but its main activity was against pNPF.

To compare these two recombinant

β-glucosidases, YckE had

lower K

m

values for daidzin and genistin, but BglH’s k

cat

values

for daidzin and genistin were 20 times higher; the catalytic

efficiency of recombinant BglH for genistin was about 7.7 times

higher than that of YckE. BglH therefore hydrolyzed soybean

isoflavone glucosides more efficiently than YckE.

DISCUSSION

Two

β-glucosidase genes (bglH and yckE) were cloned from

B. subtilis natto NTU-18 and expressed in an E. coli system

for enzyme characterization.

β-Glucosidases BglH and YckE

of B. subtilis natto showed high nucleotide sequence similarity

and amino acid sequence identity with the relative genes of B.

subtilis 168.

β-Glucosidases belong to the cellulose family BG

and form two subfamilies, BGA and BGB (31). The BGA

subfamily contains mainly bacterial

β-glucosidases with

mo-lecular weights of about 50 kDa. BGA subfamily

β-glucosidases

have a putative catalytic domain containing histidine and

glutamate residues (32, 33) which has been suggested to be

involved in the cleavage of

β-glucosidic bonds. The sequence

homology with the

β-glucosidases of the BGA subfamily (31–34)

seen using the SIM-Alignment tool suggests that BglH and

YckE of B. subtilis natto should be classified as members of

the BGA subfamily. Activity characterization revealed that the

optimal pH values for recombinant BglH and YckE are similar

to BglA

β-glucosidase, an enzyme discovered in Bacillus sp.

GL1, which acts on the gellan degradation, was classified as

belonging to the BGA subfamily, and has its highest activity at

pH 6.0 (34). This pH range is not unexpected, as most

β-glucosidases from bacterial sources show a pH optimum in

slightly acidic or neutral pH ranges (35). The recombinant BglH

enzyme showed a significant difference in activity between citric

acid-citrate buffer and sodium phosphate buffer at pH 6.0 and

between sodium phosphate buffer and Tris-HCl buffer at pH

7.0. This phenomenon is similar to the result of the intracellular

β-glucosidase of B. circulan subsp. Alkalophilus which showed

that the buffers affected strongly the observed activity and the

optimal pH was 6.0 in phosphate buffer (36). Inhibition of

enzyme activity by Tris has been observed for several

glucosi-dases and has been though to be attributed to changes in

conformation or charge distribution (37). In addition, the

enzymes were completely inactive at pH 4 and 5, while, at pH

3, both enzymes retained 35–40% activity (Figure 3). This

means that the

β-glucosidase activity of the recombinant

control 100 100 FeSO4 36.8 90.5 NaF 76.8 93.4 MnCl2 99.5 85.6 LiCl 76.8 92.7 MgCl2 84.3 95.5 FeCl3 100 81.9 CuCl2 56.8 84.1 CdCl2 26.6 80.7 CaCl2 77.9 92.6

aThe compound was added into the reaction mixture at the final concentration of 1 mM. The purified enzymes were incubated with each reagent for 10 min before the addition of the pNPG substrate solution to initiate the enzyme reaction. The reaction was determined at 37°C for 10 min in 100 mM sodium phosphate buffer, pH 6.0. The activity without the added reagent was taken as 100%.

(6)

enzymes of BglH and YckE were lost between pH 4 and 5. We

used the ExPASy Proteomics tool to estimate the pI value of

the two enzymes and found that the theoretical pI values of the

two enzymes are both about pH 4.5. This suggests that this

phenomenon was caused by conformation change of the two

enzymes in this pH range. Both recombinant BglH and YckE

showed that the activities were inhibited by divalent metal ions.

Similarly, Hashimoto et al. (34) reported that divalent metal

ions were 15–20% inhibited on BglA

β-glucosidase from

Bacillus sp. GL1.

In B. subtilis, the real function of YckE is still unknown.

Meanwhile, the bglH gene has been tentatively identified as a

β-glucosidase, but the activity of the corresponding gene product

has not been directly demonstrated (38–40). In this study, the

recombinant BglH showed the higher specificity constant for

the isoflavone conjugates than that for the chromogenic substrate

p-NPG. Similarly, the

β-glucosidases purified from

Pseudomo-nas ZD-8 (41), soybean [Glycine max] roots (42), and Cicer

arietinum L (43) also showed a higher specificity constant for

isoflavone conjugates over the generic chromogenic substrate,

p-NPG. Setlow et al. (44) reported that, in B. subtilis, bglH is

induced by

β-glucosides and expressed during the

late-exponential or stationary phase, while yckE is expressed at a

low and constant level during growth, sporulation, and spore

germination and is not induced by

β-glucosides. In our previous

study (25), the isoflavone glycoside-hydrolyzing

β-glucosidases

of B. subtilis natto were induced by isoflavone glycosides and

expressed during the late-exponential phase in black soybean

medium. According to these results, BglH may play a more

important role than YckE in the deglycosylation of isoflavone

glucosides in B. subtilis natto during fermentation.

In addition to being applied in cellulose degradation,

β-glu-cosidases could also be used to hydrolyze the phenolic

compounds (e.g., phloridzin, arbutin, and salicin) and

phy-toestrogen glucosides to improve their biological activity, with

several uses in the field of medicine, in general biomedical

research, and in the food industry (45). For example, the

hydrolysis of phloridzin by

β-glucosidase could liberate the

aglycone moiety, which is a precursor of melanin, and the

melanin is known to have the functions of reducing the risk of

skin cancer and promoting a dark color of hair (46). Similarly,

the deglycosylation of oleuropein by

β-glucosidase could release

a pharmacologically active compound hydroxytyrosol, which

is used in the prevention of coronary heart disease and cancer

(47). In order to effectively prepare the valuable

drug-materials-free aglycones, it is necessary to isolate and screen new

β-glucosidase producing microorganisms (20). In this study, we

revealed the enzyme properties of recombinant BglH and YckE.

Our data show the possibility that these

β-glucosidases could

be applied in the formation of aglycone of bioactive compounds.

These aglycones then might alter the type of sugar attached to

them via enzymes such as glycosyltrasferases, to change their

bioactivity.

LITERATURE CITED

(1) Cappelletti, V.; Fioravanti, L.; Miodini, P.; Di Fronzo, G. Genistein blocks breast cancer cells in the G(2)M phase of the cell cycle.

J. Cell Biochem. 2000, 14, 594–600.

(2) Miura, T.; Yuan, L.; Sun, B.; Fujii, H.; Yoshida, M.; Wakame, K.; Kosuna, K. Isoflavone aglycon produced by culture of soybean extracts with basidiomycetes and its anti-angiogenic activity.

Biosci. Biotechnol. Biochem. 2002, 66, 2626–2631.

(3) Ravindranath, M. H.; Muthugounder, S.; Presser, N.; Viswanathan, S. Anticancer therapeutic potential of soy isoflavone, genistein.

AdV. Exp. Med. Biol. 2004, 546, 121–165.

(4) Anthony, M. S.; Clarkson, T. B.; Hughes, C. L.; Morgan, T. M.; Burke, G. L. Soybean isoflavones improve cardiovascular risk factors without affecting the reproductive system of peripubertal rhesus monkeys. J. Nutr. 1996, 126, 43–50.

(5) Goodman-Gruen, D.; Kritz-Silverstein, D. Usual dietary isoflavone intake is associated with cardiovascular disease risk factors in postmenopausal women. J. Nutr. 2001, 131, 1202–1206. (6) Cotter, A.; Cashman, K. D. Genistein appears to prevent early

postmenopausal bone loss as effectively as hormone replacement therapy. Nutr. ReV. 2003, 61, 346–351.

(7) Weaver, C. M.; Cheong, J. M. Soy isoflavones and bone health: the relationship is still unclear. J. Nutr. 2005, 135, 1243–1247. (8) Joannou, G. E.; Kelly, G. E.; Reeder, A. Y.; Waring, M.; Nelson, C. A urinary profile study of dietary phytoestrogens. The identification and mode of metabolism of new isoflavonoids. J.

Steroid Biochem. Mol. Biol. 1995, 54, 167–184.

(9) Kelly, G. E.; Joannou, G. E.; Reeder, A. Y.; Nelson, C.; Waring, M. A. The variable metabolic response to dietary isoflavones in humans. Proc. Soc. Exp. Biol. Med. 1995, 208, 40–43. (10) Kawakami, Y.; Tsurugasaki, W.; Nakamura, S.; Osada, K.

Comparison of regulative functions between dietary soy isofla-vones aglycone and glucoside on lipid metabolism in rats fed cholesterol. J. Nutr. Biochem. 2005, 16, 205–212.

(11) Hendrich, S. Bioavailability of isoflavones. J. Chromatogr., B

Analyt. Technol. Biomed. Life Sci. 2002, 777, 203–210.

(12) Setchell, K. D.; Brown, N. M.; Zimmer-Nechemias, L.; Brashear, W. T.; Wolfe, B. E.; Kirschner, A. S.; Heubi, J. E. Evidence for lack of absorption of soy isoflavone glycosides in humans, supporting the crucial role of intestinal metabolism for bioavail-ability. Am. J. Clin. Nutr. 2002, 76, 447–453.

(13) Brown, J. P. Hydrolysis of glycosides and esters. In Role of the

gut flora in toxicity and cancer; Rowland, I. R., Ed.; Academic:

San Diego, 1998; pp 109–144.

(14) Xu, X.; Harris, K. S.; Wang, H. J.; Murphy, P. A.; Hendrich, S. Bioavailability of soybean isoflavones depends upon gut micro-flora in women. J. Nutr. 1995, 125, 2307–2315.

Table 3. Kinetic Properties of Recombinant BglH and YckEa

BglHb YckEc

substrate Km(mM) kcat(1/s) kcat/Km(1/(mM s)) Km(mM) kcat(1/s) kcat/Km(1/(mM s))

daidzein-7-O-glucoside (daidzin) 1.00 49.19 49.19 0.27 4.84 17.93 genistein-7-O-glucoside (genistin) 0.15 22.08 147.20 0.11 2.14 19.45 p-nitrophenyl-β-D-glucopyranoside 2.35 7.08 3.01 2.00 4.87 2.44 o-nitrophenyl-β-D-galactopyranoside 1.59 2.80 1.76 2.22 2.73 1.23 p-nitrophenyl-β-D-fructopyranoside 1.75 1.57 0.90 0.17 50.89 306.57 p-nitrophenyl-β-D-cellobioside 0 0 0 0 0 0

aValues shown are the mean of duplicate experiments with each substrate, and the variation about the mean was below 5%.bThe purified recombinant BglH (1 mg/mL; 50 µL) was incubated with 50 µL of different nitrophenyl substrates (0–5 mM) at 37°C for 10 min or isoflavone glucosides (0–5 mM) at 37°C for 30 min in 100 mM sodium phosphate buffer, pH 6.0. To stop the reaction, to the mixture of enzyme and nitrophenyl substrates was added 100 µL of 2 M Na2CO3buffer. Finally, the absorbance was measured at 405 nm and analyzed by HPLC after adding 100 µL EtOH.cThe reaction condition of purified recombinant YckE with the above substrates other than pNPF was the same as BglH, and it took only 2 min for YckE to react with it.

(7)

which contains a high level of isoflavone aglycons. Nippon

Shofuhin Kagaku Kogaku Kaishi 2001, 48, 27–34.

(17) Toda, T.; Uesugi, T.; Hirai, K.; Nukaya, H.; Tauji, K.; Ishida, H. New 6-O-acyl isoflavone glycosides from soybeans fermented with Bacillus subtilis (natto). I. 6-O-succinylated isoflavone glycosides and their preventive effects on bone loss in ovariectomized rats fed a calcium-deficient diet. Biol. Pharm. Bull. 1999, 22, 1193– 1201.

(18) Slavin, J. L.; Karr, S. C.; Hutchins, A. M.; Lampe, J. W. Influence of soybean processing, habitual diet, and soy dose on urinary isoflavonoid excretion. Am. J. Clin. Nutr. 1998, 68, 1492–1495. (19) Tsangalis, D.; Ashton, J. F.; McGill, A. E.; Shah, N. P. Enzymic transformation of isoflavone phytoestrogens in soymilk by

β-glu-cosidase-producing bifidobacteria. J. Food Sci. 2002, 67, 3104– 3113.

(20) Hessler, P. E.; Larsen, P. E.; Constantinou, A. I.; Schram, K. H.; Weber, J. M. Isolation of isoflavones from soy-based fermentations of the erythromycin-producing bacterium Saccharopolyspora erythraea. Appl. Microbiol. Biotechnol. 1997, 47, 398–404. (21) Esen, A.β-Glucosidase, overview. In β-Glucosidase: Biochemistry

and Molecular Biology. Esen A., Ed.; American Chemical Society:

Washinton, DC, 1993; pp 1–13.

(22) Ghosh, P.; Pamment, N. B.; Martin, W. R. B. Simultaneous saccharification and fermentation of cellulose: Effect of beta-D-glucosidase activity and ethanol inhibition of cellulases. Enzyme

Microb. Technol. 1982, 4, 425–430.

(23) Lei, V.; Amoa-Awua, W. K.; Brimer, L. Degradation of cyano-genic glycosides by Lactobacillus plantarum strains from spon-taneous cassava fermentation and other microorganisms. Int. J.

Food Microbiol. 1999, 53, 169–184.

(24) Marotti, I.; Bonetti, A.; Biavati, B.; Catizone, P.; Dinelli, G. Biotransformation of common bean (Phaseolus vulgaris L.) flavonoid glycosides by bifidobacterium species from human intestinal origin. J. Agric. Food Chem. 2007, 55, 3913–3919. (25) Kuo, L. C.; Cheng, W. Y.; Wu, R. Y.; Huang, C. J.; Lee, K. T.

Hydrolysis of black soybean isoflavone glycosides by Bacillus subtilis natto. Appl. Microbiol. Biotechnol. 2006, 73, 314–320. (26) Choi, Y. B.; Kim, K. S.; Rhee, J. S. Hydrolysis of soybean isoflavone glucosides by lactic acid bacteria. Biotechnol. Lett.

2002, 24, 2113–2116.

(27) Matsuda, S.; Norimoto, F.; Matsumoto, Y.; Ohba, R.; Teramoto, Y.; Ohta, N.; Ueda, S. Solubilization of a novel isoflavone glycosidehydrolyzing β-glucosidase from Lactobacillus casei

subsp. rhamnosus. J. Ferment. Bioeng. 1994, 77, 439–441. (28) Sambrook, J.; Fritsch, E. F.; Maniatis, T. Molecular cloning; a

laboratory manual, 2nd ed.; Cold Spring Harbor Laboratory Press:

Cold Spring Harbor, NY, 1989.

(29) Wang, H. J.; Murphy, P. A. Isoflavone content in commercial soybean foods. J. Agric. Food Chem. 1994, 42, 1666–1673. (30) Kunst, F.; Ogasawara, N.; Moszer, I.; Albertini, A. M.; Alloni,

G.; Azevedo, V.; Bertero, M. G.; Bessières, P.; Bolotin, A.; Borchert, S.; Borriss, R.; Boursier, L.; Brans, A.; Braun, M.; Brignell, S. C.; Bron, S.; Brouillet, S.; Bruschi, C. V.; Caldwell, B.; Capuano, V.; Carter, N. M.; Choi, S. K.; Codani, J. J.; Connerton, I. F.; Danchin, A.; et al. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature

1997, 390, 249–256.

beta-glucosidases. Mol. Gen. Genet. 1989, 217, 70–76. (33) Baird, S. D.; Hefford, M. A.; Johnson, D. A.; Sung, W. L.;

Yaguchi, M.; Seligy, V. L. The Glu residue in the conserved Asn-Glu-Pro sequence of two highly divergent endo-beta-1,4-gluca-nases is essential for enzymatic activity. Biochem. Biophys. Res.

Commun. 1990, 169, 1035–1039.

(34) Hashimoto, W.; Miki, H.; Nankai, H.; Sato, N.; Kawai, S.; Murata, K. Molecular cloning of two genes forβ-D-glucosidase in Bacillus

sp. GL1 and identification of one as a gellan-degrading enzyme.

Arch. Biochem. Biophys. 1998, 360, 1–9.

(35) Gekas, V.; Lopez-Levia, M. H. Hydrolysis of lactose. Process

Biochem. 1985, 20, 2–12.

(36) Paavilainen, S.; Hellman, J.; Korpela, T. Purification, characteriza-tion, gene cloning, and sequencing of a new beta-glucosidase from Bacillus circulans subsp. alkalophilus. Appl. EnViron. Microbiol.

1993, 59, 927–32.

(37) Patchett, M. L.; Daniel, R. M.; Morgan, H. W. Purification and properties of a stableβ-glucosidase from an extremely

thermo-philic anaerobic bacterium. Biochem. J. 1987, 243, 779–787. (38) Krüger, S.; Hecker, M. Regulation of the putative bglPH operon

for aryl-β-glucoside utilization in Bacillus subtilis. J. Bacteriol. 1995, 177, 5590–5597.

(39) Krüger, S.; Gertz, S.; Hecker, M. Transcriptional analysis of bglPH expression in Bacillus subtilis: evidence for two distinct pathways mediating catabolite repression. J. Bacteriol. 1996, 178, 2637– 2644.

(40) Minami, Y.; Kanafuji, T.; Miura, K. Purification and characteriza-tion of a β-glucosidase from Polygonum tinctorium, which

catalyzes preferentially the hydrolysis of indican. Biosci.

Bio-technol. Biochem. 1996, 60, 147–149.

(41) Yang, L.; Ning, Z. S.; Shi, C. Z.; Chang, Z. Y.; Huan, L. Y. Purification and characterization of an isoflavone-conjugates-hydrolyzingβ-glucosidase from endophytic bacterium. J. Agric. Food Chem. 2004, 52, 1940–1944.

(42) Hsieh, M. C.; Graham, T. L. Partial purification and characteriza-tion of a soybeanβ-glucosidase with high specific activity towards

isoflavone conjugates. Phytochemistry 2001, 58, 995–1005. (43) Hósel, W.; Barz, W. β-glucosidase from Cicer Arietinum L.:

purification and properties of isoflavone 7-O-glucoside-specific

β-glucosidases. Eur. J. Biochem. 1975, 57, 607–616.

(44) Setlow, B.; Cabrera-Hernandez, A.; Cabrera-Martinez, R. M.; Setlow, P. Identification of aryl-phospho-β-D-glucosidases in Bacillus subtilis. Arch. Microbiol. 2004, 181, 60–67.

(45) Bhatia, Y.; Mishra, S.; Bisaria, V. S. Micorbialβ-glucosidasees:

cloning, properties and applications. Crit. ReV. Biotechnol. 2002,

22, 375–407.

(46) Ridgway, T. J.; Tucker, G. A. Prospects for the production and use of new improved dietary oestrogens for cardioprotection.

Biochem. Soc. Trans. 1997, 25, 59–63.

(47) Briante, R.; Patumi, M.; Febbraio, F.; Nucci, R. Production of highly purified hydroxytyrosol from Olea europaea leaf extract biotransformed by hyperthermophilic beta-glycosidase. J.

Bio-technol. 2004, 111, 67–77.

Received for review July 30, 2007. Revised manuscript received October 19, 2007. Accepted October 26, 2007.

數據

Table 1. Purification of Recombinant BglH and YckE Expressed in E. coli M15 a name purificationstep total protein(mg) total activity(U) specificactivity(U/mg) purification(fold) yield(%) BglH crude extract b 358.0 623.0 1.74 1.0 100.0 His-binding column c
Figure 5. Thermal stability of recombinant BglH and YckE: (A) BglH, (B) YckE. The purified enzyme in 100 mM sodium phosphate buffer, pH 6.0, was preincubated for various times at 30 (b), 37 (O), 45 (1), or 50 ° C (3) in the absence of substrate and, then,
Table 3. Kinetic Properties of Recombinant BglH and YckE a

參考文獻

相關文件

INFORMAÇÃO GLOBAL SOBRE AS ASSOCIAÇÕES DE SOLIDARIEDADE SOCIAL E OS SERVIÇOS SUBSIDIADOS REGULARMENTE PELO INSTITUTO DE ACÇÃO SOCIAL. STATISTICS ON SOCIAL SOLIDARITY ASSOCIATIONS

Valor acrescentado bruto : Receitas mais variação de existências, menos compras de bens e serviços para revenda, menos comissões pagas, menos despesas de exploração. Excedente

The resulting color at a spot reveals the relative levels of expression of a particular gene in the two samples, which may be from different tissues or the same tissue under

External evidence, as discussed above, presents us with two main candidates for translatorship (or authorship 5 ) of the Ekottarik gama: Zhu Fonian, and Sa ghadeva. 6 In

Now given the volume fraction for the interface cell C i , we seek a reconstruction that mimics the sub-grid structure of the jump between 0 and 1 in the volume fraction

Second, we replicate the AN+MM and use European options sampling at exercise as control variates (CV-at-exercise). Last, we also replicate the AN+MM and use

A Boolean function described by an algebraic expression consists of binary variables, the constant 0 and 1, and the logic operation symbols.. For a given value of the binary

– The futures price at time 0 is (p. 275), the expected value of S at time ∆t in a risk-neutral economy is..