pubs.acs.org/JAFC Published on Web 12/07/2009
© 2009 American Chemical Society
DOI:10.1021/jf903139x
Identification of the
mokH Gene Encoding Transcription Factor
for the Upregulation of Monacolin K Biosynthesis in
Monascus
pilosus
Y
I-P
EIC
HEN,
†G
WO-F
ANGY
UAN,
‡S
UNG-Y
UANH
SIEH,
‡Y
U-S
HANL
IN,
‡W
EI-Y
IW
ANG,
‡L
I-L
INGL
IAW,
‡ANDC
HING-P
INGT
SENG*
,† †Department of Biological Science and Technology, National Chiao Tung University, HsinChu, Taiwan and‡Bioresource Collection and Research Center, Food Industry Research and Development Institute,
HsinChu, Taiwan
Monacolin K is a secondary metabolite synthesized by polyketide synthases (PKS) from Monascus. The monacolin K biosynthetic gene cluster, mokA-mokI, has been characterized in Monascus pilosus. The mokH gene encoding Zn(II)2Cys6 binuclear DNA binding protein is assumed to be an activator for monacolin K production. In this study, the mokH gene was cloned and driven by the glyceraldehyde-3-phosphate dehydrogenase (gpd) promoter for overexpression in M. pilosus. The transformants containing an extra copy of the mokH gene were obtained and verified by PCR and Southern hybridization. The transcripts of mokH in the transformants were expressed significantly higher than those of the wild-type strain. The transformants were stably inherited through the next generation, as determined by observation of the enhanced green fluorescent protein (EGFP). The transformant T-mokH1 also showed a 1.7-fold higher production of monacolin K than the wild-type strain in a time course analysis. Analysis of the RT-PCR products demonstrated that the monacolin K biosynthetic genes in the transformant were expressed to a greater extent than those in the wild-type strain. These results indicated that mokH upregulated the transcription of monacolin K biosynthetic genes and increased monacolin K production.
KEYWORDS: Monacolin K; Monascus pilosus; transcription factor; glyceraldehyde-3-phosphate dehy-drogenase
INTRODUCTION
Monascusspp. are filamentous fungi that produce secondary metabolites with polyketide structures and are known as as monacolin K, J, L, M, and X, all of which belong to the cholesterol synthesis inhibitor group (1-4). Dimerumic acid (antioxidant) and γ-aminobutyric acid (GABA) (hypotensive agent) are also found in Monascus-fermented product (5, 6). In addition, the red pigments produced by Monascus species have been applied to various foods as natural colorants. Therefore, Monascusrice products are usually used as healthy foods in Asia. Monacolin K, or lovastatin, differs slightly in structure from compactin. Monacolin K contains a methyl group derived from S-adenosyl-L-methionine (SAM) at the C-6 position of the non-aketide-derived backbone that is absent in compactin (7). In our previous study, the monacolin K biosynthetic gene cluster in Monascus pilosus contains nine putative open reading frames involved in monacolin K biosynthesis (8). These nine genes, mokA-mokI, were highly homologous to the genes of the lovastatin biosynthetic gene cluster of Aspergillus terreus and
the compactin biosynthetic gene cluster of Penicillium citri-num(7, 9). They include two polyketide synthase genes thought to be responsible for the synthesis of nonaketide and diketide. Functional inactivation of the nonaketide synthase gene, mokA, demonstrates that it is essential for monacolin K biosynthesis (8). The mokH gene encoding the transcription factor shares 54% and 49% similarity with the lovE gene of the lovastatin gene cluster and the mlcR gene of the compactin gene cluster, respectively (7-9). These transcription factors all exhibit a Zn(II)2Cys6-type zinc finger nucleotide binding domain, which is thought to be an activator of lovastatin and compactin production (10, 11). Transformation of an extra copy of the lovE gene into the wild-type A. terreus results in a 7- to 10-fold overproduction of lovastatin (10). Likewise, an additional copy of the mlcR gene, fused to the promoter and terminator of Aspergillus nidulans3-phosphoglycerate kinase (pgkA), can up-regulate the expression of the compactin biosynthetic genes in P. citrinum (11). The transformant, pgkA(P)::mlcR, produces 10-15% more compactin in comparison to the parent strain. In this study, we characterized the function of the mokH gene in the transcription of the mokA-mokI genes and its productivity in monacolin K biosynthesis. An extra copy of the mokH gene driven by the glyceraldehyde-3-phosphate dehydrogenase (gpd) promoter of M. pilosus was integrated into the chromosome of
*Corresponding author. Mailing address: College of Biological Science and Technology, NCTU, 75 Bo-Ai Street, Hsin-Chu, Taiwan. E-mail: [email protected]. Phone: þ886-3-5712121 ext. 56908. Fax:þ886-3-5729288.
M. pilosus. Polymerase chain reaction (PCR) and Southern hybridization were used to confirm the fusion of gpd(P)::mokH and the copy numbers of transformants. Monacolin K expression and the productivity of its biosynthesis were also analyzed by reverse-transcription PCR and HPLC, respectively. Our results revealed that the mokH gene is a positive regulator of monacolin K biosynthesis.
MATERIALS AND METHODS
Strain Used and Growth Conditions.M. pilosusBCRC38072, a monacolin K-producing strain isolated from red rice (anka) collected from a local traditional market, was used in this study. The strain was incubated on YM agar (DIFCO 271120, Detroit, Michigan) for one week, and spore suspensions were obtained by washing cultured YM agar plates with distilled water. Mycelium was harvested after incubation for 15 days at 25°C with constant agitation in liquid medium (7% glycerol, 3% glucose, 3% monosodium glutamate, 1.2% polypetone, 0.2% NaNO3, and 0.1% MgSO43 7H2O).
Nucleic Acid Manipulations.Fungal genomic DNA was isolated by liquid nitrogen treatment according to the method developed by Bingle et al. (12). Total RNA from M. pilosus was isolated with TRIzol reagent (Invitrogen, Carlsbad, CA) for Northern hybridizations and RT-PCR analyses. Southern and Northern hybridizations were performed using the DIG system (DIG wash and buffer set) (Roche Diagnostics, Mannheim, Germany). The manipulations of DNA and RNA transfer, immobiliza-tion, and hybridization were carried out as described by Sambrook et al. (13). The mokH gene probe was DIG-labeled by PCR amplification using the PCR DIG probe synthesis kit (Roche Diagnostics, Mannheim, Germany). The primer set used for the mokH gene was pmkHf: ACCTCATCGCTCCAGACCAT and pmkHr: CTGCGAGAGAAT-GAGAGTGC.
Construction of themokH Gene Expression Vector.The glycer-aldehyde-3-phosphate dehydrogenase (gpd) promoter from plasmid pAN7-1 (14) was replaced with a 1.1 kb BglII-SalI fragment of the gpd promoter using the primer set (gpd1: AGATCTGATCTGATATCAAT-GAGTACAAC and gpd2: GTCGACTTTTGATAGAGTGATAGA-TATTAG) from M. pilosus BCRC38072 (GenBank accession no. DQ984142) to obtain the plasmid pMS. The PCR-amplified product of the 1.5 kb mokH gene was introduced into the plasmid pMS by digestion of the SalI-BamHI site blunted by the End-It DNA End-repair kit (Epicenter, Madison, WI) to obtain the plasmid pMS-H. The PCR-amplified product of a 3.5 kb fragment containing the promoter, the mokH gene, and the terminator from pMS-H was introduced into the plasmid pMS-0.5hsp (15) by digestion of the ClaI site blunted with the End-It DNA End-repair kit to obtain the plasmid pMSmokH.
Transformation ofM. pilosus BCRC38072.The protoplast was prepared according to the method developed by Chen et al. (15 ). The conidia from a one-week culture of M. pilosus were incubated in 100 mL of Vogel medium at 30°C for 16-18 h. The mycelia were harvested on miracloth (Millipore, Bedford, USA) and washed in MA digestion solution (0.1 M maleic acid, pH 5.5, and 1.2 M (NH4)2SO4). The mycelia were digested for 4-5 h using 100 mg of Yatalase (Takara, Tokyo, Japan), 100 mg of lysing enzyme (Sigma, St. Louis, USA), and 100μL of β-glucuronidase (Sigma, St. Louis, USA) in 50 mL of MA digestion solution. To remove undigested mycelia, protoplasts were harvested by passing them through miracloth and by centrifugation at 1000 rpm for 10 min (Sorvall, Wilmington, USA). The protoplasts were maintained in 80% STC (1 M sorbitol, 50 mM Tris pH 8.0, 50 mM CaCl2) and 20% PTC (40% PEG 4000, 50 mM Tris pH 8.0, 50 mM CaCl2), and dimethylsulfoxide (DMSO) was added to a final concen-tration of 1%. For genetic transformation of M. pilosus, 100μL of protoplasts was mixed with 1 mM aurintricarboxylic acid (ATA) and 5μg of DNA. The mixtures were incubated on ice for 30 min. An amount of 1 mL of PTC was added, and the sample was mixed gently. Following incubation at room temperature for 20 min, the protoplast mixtures were added to 15 mL of SYP medium (1 M sorbitol, 0.1% yeast extract, 0.1% peptone, and 2% agar) containing 60 μg of hygromycin B/mL. Plates were incubated at 28°C, and transformants were detected by PCR and Southern hybridization.
Measurement of Red Pigment. To determine red pigment and monacolin K levels, the strains were incubated in 50 mL of liquid medium for 15 days at 25°C. The aliquots of M. pilosus and the transformant culture were cleared of cells and filtered with a 0.2 mm filter. The supernatants were analyzed at 500 nm with a spectrophotometer for the determination of red pigment levels.
Measurement of Monacolin K.Aliquots of the M. pilosus culture were cleared of cells and filtered through a 0.2 mm filter. The supernatants were analyzed by high-performance liquid chromatography (HPLC) performed on a Waters system (Waters, Milford, MA) fitted with a reverse-phase C18column (LichroCART 250-4, Rp-18e, 5μm). The HPLC parameters were as follows: solvent A, 0.1% phosphorus acid in water; solvent B, acetonitrile; 35% A and 65% B in 30 min; flow rate, 1.5 mL min-1; and detection by UV spectroscopy (Waters 600 pump and 996 pgotodiode array detector). A standard monacolin K compound (Sigma, St. Louis, USA) was used to confirm the HPLC analysis.
Fluorescence Microscopy.EGFP expression in transformant hyphae were compared by fluorescence microscopy to that of the wild-type hyphae. Fluorescence photomicrography was conducted on the specimens using a fluorescence microscope (Leica RXA, Mannheim, Germany). The red filter (Chroma, VT, USA), with peak excitation at 450-490 nm and peak suppression at 525-575 nm, was used to detect EGFP.
Reverse-Transcription PCR. Total RNA from 0.2 g of mycelial powder was prepared using TRIzol reagent (Invitrogen, Carlsbad, CA) and treated with 2 U of RNase-free DNase for 1 h. The first strand cDNA was synthesized by SuperScript III Reverse Transcription with random hexamers (Invitrogen, Carlsbad, CA) at 50°C for 1 h with 5 μg of RNA and used as the template for PCR. The PCR amplification was carried out on a PCR system 2700 thermocycler (Applied Biosystems, Foster City, CA). The 50μL reaction mixture contained 1 μL of cDNA as template, 0.2 mM primers, 2 units of Taq DNA polymerase, and 800 mM dNTPs. The nine primer sets listed in Table 1 were used to carry out the mona-colin K biosynthetic gene amplification performed in this study. The reaction conditions included an initial denaturation for 5 min at 96°C, followed by 25 or 30 cycles for 1 min at 96°C, 1 min at 52 or 55 °C, and 1 min at 72°C with a final extension time of 7 min at 72 °C. The PCR products were confirmed by electrophoretic analysis in a 1.2% agarose gel. RESULTS
Sequence Analysis and Construction of the pMSmokH Expres-sion Vector. The biosynthesis of polyketide in fungi has many layers of regulation. Some layers are controlled by environmental factors, while others play a role in a genetic regulation of elements of secondary metabolism. The position of the transcription factor within a polyketide gene cluster has implications for its regula-tion (16). The monacolin K biosynthetic gene cluster contains the transcription factor mokH, which is similar to lovE and mlcR in lovastatin and compactin biosynthesis, respectively (Figure 1A). Analysis of the cDNA sequence revealed that the mokH gene includes one intron, which generally has a splicing junction at GU-AG, in contrast to the intron numbers of lovE and mlcR (Figure 1B). However, they all contain the cysteine-rich Zn(II)2Cys6-type zinc finger nucleotide-binding domain that shares the consensus sequence CX2CX6CX11CX2CX6C.
Glyceraldehyde-3-phosphate dehydrogenase (GPD), which catalyzes the reversible oxidation and phosphorylation of glycer-aldehyde-3-phosphate to produce 1,3-diphosphoglycerate, is one of the key enzymes in the Embden-Meyerhof-Parnas pathway, also known as the glycolytic pathway. The GPD protein com-prises 5% of all cellular protein in eukaryotes (17, 18). It is a well-known house-keeping gene that is considered to be highly and constitutively expressed. Construction of the expression vector using the gpd promoter from M. pilosus can increase the expres-sion of the mokH gene. The primer set used in this study, based on the Bacterial Artificial Chromosome (BAC) library constructed from M. pilosus BCRC38072 (19), was designed to amplify the promoter of the gpd gene (GenBank accession no. DQ984142).
This promoter triggers expression of mokH. The pMSmokH expression vector was constructed and included a fusion of the hygromycin B resistance gene (HPH) with enhanced green fluorescent protein (EGFP). pMSmokH was further utilized to achieve overexpression of mokH for the genetic transformation in M. pilosusBCRC38072.
Characterization of Transformants withmokH Overexpression. To assess the effects of mokH overexpression on the transcriptional regulation of monacolin K biosynthetic genes, three transformants of M. pilosus BCRC38072 were obtained following the transforma-tion of the plasmid pMSmokH containing the mokH gene under the transcriptional control of the gpd promoter. All of these
Table 1. Primers Used to Amplify Monacolin K-Related Genes Fragments by RT-PCR
primersa sequence positionb PCR product (bp)
mokA/F 50-CCTCAGCGGTGACATCGTGG (20-mer) 4115 to 4134 (mokA) 350
mokA/R 50-GGTGACGACCTTCGTGAGCGT (21-mer) 4444 to 4464 (mokA)
mokB/F 50-AAGCCAACTATGCGGCTGCA (20-mer) 7363 to 7382 (mokB) 321
mokB/R 50-CGTTTGTGAAGTGAGGGCCA (20-mer) 7664 to 7683 (mokB)
mokC/F 50-GGCCTGAGCCGAAGAAGTAC (20-mer) 1413 to 1432 (mokC) 305
mokC/R 50-TCAGAGATCTTCGTCCCGAC (20-mer) 1698 to 1717 (mokC)
mokD/F 50-CAGAACCCCAGCATCCCCAT (20-mer) 361 to 380 (mokD) 290
mokD/R 50-ACCATCTTCGAACCCGCCAG (20-mer) 631 to 650 (mokD)
mokE/F 50-AATGGTCACCGCCGACTGGA (20-mer) 961 to 980 (mokE) 246
mokE/R 50-TTCTCTCCCGACAACTGCCC (20-mer) 1187 to 1206 (mokE)
mokF/F 50-GAGTGGATCTACGGCGCCAA (20-mer) 796 to 815 (mokF) 354
mokF/R 50-CATCAAGTCCACGGTCTCGG (20-mer) 1130 to 1149 (mokF)
mokG/F 50-CCTCGCTCTGAATATGACCC (20-mer) 803 to 822 (mokG) 217
mokG/R 50-TCGGATCGGCTTCTCAAACC (20-mer) 1000 to 1019 (mokG)
mokH/F 50-CCTTCATGCACGCCCTATCC (20-mer) 1109 to 1128 (mokH) 334
mokH/R 50-CGGGCCAGGGAAAAGATCTC (20-mer) 1423 to 1442 (mokH)
mokI/F 50-GCACAATGCCTGCTCCCAGA (20-mer) 966 to 985 (mokI) 358
mokI/R 50-ACGTCCTTCACGGCCTGGAA (20-mer) 1304 to 1323 (mokI)
18SrRNA/F 50-TGCCAGCAGCCGCGGTAATT (20-mer) 332
18SrRNA/R 50-AGCTGAATACTGACGCCCCC (20-mer)
aF, forward primer; R, reverse primer.bSites corresponding to those of the M. pilosus BCRC38072 monacolin K gene cluster (GenBank accession no. DQ176595).
Figure 1. (A) Monacolin K biosynthetic gene cluster of M. pilosus BCRC38072. The small black bars indicate the sequences assayed by RT-PCR analyses. (B) The structures of the Zn(II)2Cys6-type transcription factors encoded by the mokH gene from M. pilosus, lovE from A. terreus, and mlcR from P. citrinum and the multiple alignment of the Zn(II)2Cys6 binuclear DNA binding domain of the mokH gene with related organisms. The abbreviation CYS represents the cysteine-rich region. The line indicates the intronic region. The following are the accession numbers for the comparisons of the cysteine-rich regions used: MokH (M. pilosus, DQ176595), LovE (A. terreus, AF141925), MlcR (P. citrinum, AB072893), AflR (Aspergillus pseudotamarii, AAM02990), Ctb8 (Cercospora nicotianae, ABK64185), Z (Trichoderma virens, ABV48713), Gal4 (Aspergillus fumigatus, XP_754932), Lac9 (Pichia stipitis, ABN67063), and Nit4 (Neurospora crassa, AAA33602).
transformants showed 2-fold greater monacolin K production than the wild-type strain after 14 days of cultivation. The three transfor-mants containing the complete gpd promoter, mokH gene, and trpC terminator were verified by PCR, nested-PCR (Figure 2A,B), and sequencing. Furthermore, the transcripts from the mokH gene in these transformants were expressed at a higher level than those of the wild-type strain, as verified by Northern blot analysis (Figure 2C).
The copy number of the mokH gene in the wild-type strain (BCRC38072) and three transformants (T-mokH1, T-mokH2, and T-mokH3) was determined by Southern hybridizations using the restriction enzymes SalI, XhoI, HindIII, and NarI (Figure 3A). SalI and XhoI cut at one site in the pMSmokH plasmid, whereas HindIII and NarI did not cut within the plasmid. The 3.2 kb SalI and 2.5-kb XhoI fragments corresponded to the single copy of mokHin the wild-type strain BCRC38072. The transformants contained two integration events (two copies of mokH) using SalI and XhoI restriction enzymes. The 3.4 kb HindIII and 5 kb NarI fragments corresponding to the single copy of mokH were found in the wild-type strain BCRC38072. Two transformants, T-mokH1 and T-mokH3, also showed two integration events when cut with the HindIII and NarI restriction enzymes. How-ever, only one fragment corresponding to the transformant T-mokH2 was detected. These results suggested that the plasmid (pMSmokH) integrated as a tandem repeat in T-mokH2 (Figure 3B), while it randomly integrated into the ectopic loca-tions of the chromosome in the transformants T-mokH1 and T-mokH3. These results indicate that all three of the transfor-mants contained two copies of mokH.
Expression of EGFP was detected by fluorescence microscopy and shown in Figure 3C,D. Fluorescence was clearly observed in these transformants when excited with a red filter. These results indicated that the EGFP protein was extensively expressed in the mycelia and spores. It was also stably inherited through the next generation after several rounds of cultivation.
Analysis of Monacolin K Production. In a time course study, the transformant T-mokH1 was used for further determination of monacolin K production and for RT-PCR analyses. In previous studies, monacolin K production in Monascus gradually increased with the duration of cultivation (20). The amounts of monacolin K produced from the wild-type strain and transformant were deter-mined by HPLC after 15 days of cultivation without the addition of the antibiotic hygromycin B. Although the initiation of mona-colin K yield was not altered, the constitutive overexpression of mokHled to a higher accumulation of monacolin K after 8 days of cultivation (Figure 4A). Monacolin K production in the T-mokH1 transformant was 1.7-fold higher than the corresponding values
for the wild-type strain, while the cultured cell mass revealed no difference from wild type (Figure 4B). The amount of red pigment
Figure 2. (A) Electrophoretic analysis of the PCR product for the mokH gene containing the gpd promoter and the trpC terminator with the primer set pgpdF and ptrpR (pgpdF: 50-GAAGATCTGATATCAATGAGTACAACTATATC and ptrpR: 50-TCGAGTGGAGATGTGGAGTGGG). Lane 1: expression vector, pMSmokH. Lane 2: wild-type strain, M. pilosus BCRC38072. Lane 3: T-mokH1. Lane 4: T-mokH2. Lane 5: T-mokH3. The abbreviation “M” indicates the 1 kb ladder marker. (B) Electrophoretic analysis of the nested-PCR product obtained for the mokH gene with the pmHF and pmHR primer set (pmHF: 50 -CTCGCTCACAAACAATGCAC and pmHR: 50-AAGGGCCTTGACCGTAGCAT). Lane 1: expression vector, pMSmokH. Lane 2: T-mokH1. Lane 3: T-mokH2. Lane 4: T-mokH3. (C) Northern hybridization analysis of the mokH gene present in DNA from the wild-type strain (Lane 1), T-mokH1 (Lane 2), T-mokH2 (Lane 3), and T-mokH3 (Lane 4) hybridized with the mokH probe.
Figure 3. (A) Southern hybridization analyses of mokH copy number in M. pilosus BCRC38072 (Lane 1) and the transformant genomes of T-mokH1 (Lane 2), T-mokH2 (Lane 3), and T-mokH3 (Lane 4). Chromo-some DNAs extracted from the wild-type strain and transformants were digested with SalI, XhoI, HindIII, and NarI, separated by electrophoresis gel and hybridized to the mokH probe. (B) Extra copy of mokH inserted into the monacolin K gene cluster in the transformant T-mokH2. S: SalI restriction enzyme. X: XhoI restriction enzyme. H: HindIII restriction enzyme. N: NarI restriction enzyme. Enhanced green fluorescent protein (EGFP) in trans-formed M. pilosus was analyzed by bright field (C) and fluorescence (D) microscopy. The arrows “H” and “C” indicate the hyphae and conidia of the transformant, respectively. The photograph was taken at a magnification of 1000. The exposure time was 1-2 s.
was also determined as a measure of the effect of mokH transcrip-tion factor overexpression. The results showed that the productranscrip-tion of red pigment in T-mokH1 was similar to that in the parent strain, suggesting that the altered mokH expression does not affect the production of red pigment (Figure 4C).
Transcription of Monacolin K Biosynthesis Genes. To confirm the effect of mokH overexpression on the transcriptional regulation of the monacolin K biosynthetic genes, several sets of oligonucleo-tide primers were designed to analyze the expression of the nine genes (mokA-mokI) by RT-PCR (Table 1). The expression of the mokHgene was higher in the transformant T-mokH1 than that in the wild-type strain BCRC38072. Monacolin K biosynthetic gene expression in the transformant T-mokH1 appeared earlier than that in the wild-type strain (Figure 5). These results were consistent with the monacolin K productivities of the transformant described above and demonstrated that mokH upregulated the transcription of the monacolin K biosynthetic genes.
DISCUSSION
Monacolin K synthesized by the polyketide gene clusters from Monascusis used to reduce serum cholesterol levels in humans.
Thus, there is enormous value in increasing the production of monacolin K (20). A great deal of effort has been directed at optimization of the nutrient parameters for monacolin K produc-tion in Monascus species (20-25). Previous studies have shown that the mediation of the pH value and ethanol addition can increase the monacolin K level by 47% and decrease the citrinin level by 54% (21). In addition, carbon and nitrogen sources regulate monacolin K biosynthesis in Monascus (23-25). How-ever, no study has yet tried to improve monacolin K production by genetic regulation in Monascus. Our previous study revealed that monacolin K is synthesized by polyketide synthase in M. pilosusBCRC38072 (8). This study identified the transcription factor Zn(II)2Cys6 binuclear DNA binding protein as a mon-acolin K biosynthesis contributor (Figure 1A). The functional analysis of mokH, a regulatory gene for monacolin K biosynth-esis, was further explored.
The regulation of clustered secondary metabolite genes is complex (26, 27). According to the model of sterigmatocystin polyketide (ST, the penultimate precursor to aflatoxin) or afla-toxin in A. nidulans, the biosynthesis signal transduction pathway G-protein, a methyltransferase (LaeA) and a transcription factor (AflR) are involved in fungal secondary metabolism (26-28). Over the past few years, several attempts have been made to demonstrate that the transcription factor within the polyketide biosynthetic gene cluster plays an important role as an activator for the production of polyketide (28). The aflR gene, which encodes a Zn(II)2Cys6 binuclear DNA binding protein, appears to be a transcriptional regulator of aflatoxin pathway genes. Disruption of af lR results in the loss of aflatoxin production,
Figure 4. Submerged cultures of the wild-type strain BCRC38072 (2) and the transformant T-mokH1 (9) were incubated on a 200 rpm rotary shaker for 15 days at 25°C for the analyses of monacolin K (A), cell mass (B), and red pigment (C).
Figure 5. Time course of monacolin K biosynthetic gene expression profiles in the wild-type strain BCRC38072 and the transformant T-mokH1 determined by RT-PCR analysis. The primer sets used are listed in Table 1.
whereas aflR overexpression leads to increased aflatoxin produc-tion in Aspergillus (29, 30). Likewise, ctnA, which encodes a Zn(II)2Cys6 binuclear DNA binding protein, is a major activator of citrinin biosynthesis in Monascus purpureus. A strain of M. purpureusin which ctnA has been disrupted also exhibits a decrease in citrinin production (31), whereas heterologous ex-pression of an additional copy of ctnA in Aspergillus oryzae results in 400-fold higher citrinin production than that of the parental transformant (32). In the present study, we found that the mokH gene shared 54% and 49% similarity with the lovE gene of the lovastatin gene cluster in A. terreus and the mlcR gene of the compactin gene cluster in P. citrinum, respectively. Transfor-mants containing two copies of the mokH gene-encoded tran-scription factor were obtained. After several rounds of cultivation without addition of the antibiotic hygromycin B, the ectopic mokHgene of the transformants was stably inherited through the next generation, as shown in the conidia (Figure 3C,D). More-over, increased monacolin K was observed in the transformant (Figure 4A). This finding was more consistent with the earlier expression of monacolin K biosynthetic genes in the transformant than in the wild-type strain (Figure 5). These results were in agreement with the findings of Kennedy et al. (9, 10), who demonstrated that an extra copy of the regulatory lovE gene can improve the lovastatin yield. A similar regulation effect on compactin biosynthesis was found in P. citrinum, with increases of 10-15% (11).
The sequence alignment of mokH showed homology with the lovEand mlcR genes (Figure 1B). This alignment showed that they are all Zn(II)2Cys6 binuclear cluster proteins and possess DNA-binding and activation domains typical of the Gal4 family of positive regulatory proteins (33). The N-terminal conserved region was CX2CX6CX11CX2CX6C, which represents a common arrangement of cysteines observed in mokH, lovE, and mlcR (Figure 1B). Furthermore, regulatory proteins, including AflR, Ctb8, Z, Gal4, Lac9, and Nit4, contained the consensus sequence, CX2CX6CXnCX2CXnC, with a variable-length spacer between the cysteines. The Gal4-type transcription factor binds to a palindromic consensus sequence, such as 50-CGGNxCCG-30or 50-CCGNxCGG-30, where Nx represents variable spacing (34). In contrast to the nucleotide-binding sequence of Gal4, AflR binds to the partially palindromic consensus sequence 50-TCGN5 -CGR-30. Here, within the region of the monacolin K biosynthetic gene cluster in M. pilosus BCRC38072, several consensus sequences, 50-TCGN5CGR-30, were also found in the promoter regions of different genes. Thus, it was suggested that the expression levels of monacolin K biosynthetic genes were influ-enced by the regulatory gene, mokH, which contains the same nucleotide-binding sequence. In addition, the results demon-strated that the mokH gene was required for increasing monacolin K production. Further study of the transcription factor binding sequence, including the electrophoretic mobility shift assay (EMSA) and footprinting, will clarify the individual regulation of each gene in monacolin K biosynthesis.
Overexpression of af lR using the fusion gpd(P)::af lR in Aspergillus flavusincreases the high production of aflatoxin which was not altered in the initial time (29). In this study, the transformant T-mokH1 harboring gpd(P)::mokH exhibited an initial monacolin K accumulation profile similar to that of the wild-type strain (Figure 4A). Nevertheless, the monacolin K yield in the transformant T-mokH1 contributed to the increase, exhibiting a trend different from that observed for the wild-type strain. It is known that monacolin K production by Monascus species is dependent on the culture conditions (24, 25). In this study, the profile of monacolin K production was consistent with the finding that modulating the pH value significantly increases
monacolin K production in later days but not during the initial days of the measurement (20, 21). This result suggested that the regulation of monacolin K production may occur in the deceler-ated growth phase. Moreover, rather than increasing the produc-tion of the red pigment (Figure 4C), MokH represented a point of direct regulation of monacolin K biosynthesis. It is well docu-mented that the biosynthesis of a polyketide usually contains a specific transcription factor within the gene cluster (16). The monacolin K biosynthetic genes of M. pilosus and the lovastatin biosynthetic genes of A. terreus are othologs. They are related to compactin biosynthesis in Penicillium citrinum. Although the efficiencies of lovastatin, monacolin K, or compactin production through the overexpression of transcription factor are quite different, this disparity might have been caused by the genetic divergence and the complex regulation of each transcription factor due to the lower amino acid similarities and different growth rates of the fungal species (8, 10, 11).
LITERATURE CITED
(1) Endo, A. Monacolin K, a new hypocholesterolemic agent pro-duced by a Monascus species. J. Antibiot. (Tokyo) 1979, 32, 852– 854.
(2) Endo, A.; Hasumi, K.; Nakamura, T.; Kunishima, M.; Masuda, M. Dihydromonacolin L and monacolin X, new metabolites which inhibit cholesterol biosynthesis. J. Antibiot. (Tokyo) 1985, 38, 321-327.
(3) Endo, A.; Hasumi, K.; Negishi, S. Monacolins J and L, new inhibitors of cholesterol biosynthesis produced by Monascus ruber. J. Antibiot.(Tokyo) 1985, 38, 420–422.
(4) Endo, A.; Komagata, D.; Shimada, H. Monacolin M, a new inhibitor of cholesterol biosynthesis. J. Antibiot. (Tokyo) 1986, 39, 1670–1673.
(5) Aniya, Y.; Ohtani, I. I.; Higa, T.; Miyagi, C.; Gibo, H.; Shimabukuro, M.; Nakanish, H.; Taira, J. Dimerumic acid as an antioxidant of the mold, Monascus anka. Free Radical Biol. Med. 1999, 286, 999–1004.
(6) Su, Y. C.; Wang, J. J.; Lin, T. T.; Pan, T. M. Production of the secondary metabolitesγ-aminobutyric acid and monacolin K by Monascus. J. Ind. Microbiol. Biotechnol. 2003, 30, 40–46.
(7) Abe, Y.; Suzuki, T.; Ono, C.; Iwamoto, K.; Hosobuchi, M.; Yoshikawa, H. Molecular cloning and characterization of an ML-236B (compactin) biosynthetic gene cluster in Penicillium citrinum. Mol. Genet. Genomics 2002, 267, 636–646.
(8) Chen, Y.-P.; Tseng, C.-P.; Liaw, L.-L.; Wang, C.-L.; Chen, I.-C.; Wu, W.-J.; Wu, M.-D; Yuan, G.-F. Cloning and characterization of monacolin K biosynthetic gene cluster from Monascus pilosus. J. Agric. Food Chem. 2008, 56, 5639–5646.
(9) Kennedy, J.; Auclair, K.; Kendrew, S. G.; Park, C.; Vederas, J. C.; Hutchinson, C. R. Modulation of polyketide synthase activity by accessory proteins during lovastatin biosynthesis. Science 1999, 284, 1368–72.
(10) Hutchinson, C. R.; Kennedy, J.; Park, C.; Kendrew, S.; Auclair, K.; Vederas, J. Aspects of the biosynthesis of non-aromatic fungal polyketides by iterative polyketide synthases. Antonie Van Leeuwen-hoek 2000, 78, 287–295.
(11) Abe, Y.; Ono, C.; Hosobuchi, M.; Yoshikawa, H. Functional analysis of mlcR, a regulatory gene for ML-236B (compactin) biosynthesis in Penicillium citrinum. Mol. Genet. Genomics 2002, 268, 352–361.
(12) Bingle, L. E. H.; Simpson, T. J.; Lazarus, C. M. Ketosynthase domain probes identify two subclasses of fungal polyketide synthase genes. Fungal Genet. Biol. 1999, 26, 209–223.
(13) Sambrook, J., Fritsch, E., Maniatis, T. Molecular cloning: a labora-tory manual; Cold Spring Harbor, Cold Spring Harbor Laboralabora-tory Press: New York, 1989; Vol. 1, p 7.39.
(14) Punt, P. J.; Oliver, R. P.; Dingemanse, M. A.; Pouwels, P. H.; van den Hondel, C. A. Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli. Gene 1987, 56, 117–124.
(15) Chen, Y.-P.; Chen, I.-C.; Hwang, I.-E.; Yuan, G.-F.; Liaw, L.-L.; Tseng, C.-P. Selection of an effective red-pigment producing Mon-ascus pilosusby efficient transformation with aurintricarboxylic acid. Biosci. Biotechnol. Biochem. 2008, 72, 3021–3024.
(16) Georgianna, D. R.; Payne, G. A. Genetic regulation of aflatoxin biosynthesis: from gene to genome. Fungal Genet. Biol. 2009, 46, 113–125.
(17) Punt, P. J.; Dingemanse, M. A.; Kuyvenhoven, A.; Soede, R. D.; Pouwels, P. H.; van den Hondel, C. A. Functional elements in the promoter region of the Aspergillus nidulans gpdA gene encoding glyceraldehyde-3-phosphate dehydrogenase. Gene 1990, 93, 101–109. (18) Van Bogaert, I. N.; De Maeseneire, S. L.; Develter, D.; Soetaert, W.;
Vandamme, E. J. Cloning and characterisation of the glyceraldehyde 3-phosphate dehydrogenase gene of Candida bombicola and use of its promoter. J. Ind. Microbiol. Biotechnol. 2008, 35, 1085–1092. (19) Chen, Y.-P.; Tseng, C.-P.; Liaw, L.-L.; Wang, C.-L.; Yuan, G.-F.
Characterization of MRT, a new non-LTR retrotransposon in Monascus spp. Bot. Bull. Acad. Sin. 2007, 48, 377–385.
(20) Lee, C.-L.; Wang, J.-J.; Kuo, S.-L.; Pan, T.-M. Monascus fermenta-tion of dioscorea for increasing the producfermenta-tion of cholesterol-low-ering agent--monacolin K and antiinflammation agent--monascin. Appl. Microbiol. Biotechnol. 2006, 72, 1254–1262.
(21) Lee, C.-L.; Hung, H.-K.; Wang, J.-J.; Pan, T.-M. Improving the ratio of monacolin K to citrinin production of Monascus purpureus NTU 568 under dioscorea medium through the mediation of pH value and ethanol addition. J. Agric. Food Chem. 2007, 55, 6493–6502. (22) Hajjaj, H.; Niederberger, P.; Duboc, P. Lovastatin biosynthesis by
Aspergillus terreusin a chemically defined medium. Appl. Environ. Microbiol. 2001, 67, 2596–2602.
(23) Casas Lopez, J. L.; Sanchez Perez, J. A.; Fernandez Sevilla, J. M.; Acien Fernandez, F. G.; Molina Grima, E.; Chisti, Y. Production of lovastatin by Aspergillus terreus: effects of the C:N ratio and the principal nutrients on growth and metabolite production. Enzyme Microb. Technol. 2003, 33, 270–277.
(24) Miyake, T.; Uchitomi, K.; Zhang, M. Y.; Kono, I.; Nozaki, N.; Sammoto, H.; Inagaki, K. Effects of the principal nutrients on lovastatin production by Monascus pilosus. Biosci. Biotechnol. Bio-chem. 2006, 70, 1154–1159.
(25) Sayyad, S. A.; Panda, B. P.; Javed, S.; Ali, M. Optimization of nutrient parameters for lovastatin production by Monascus purpur-eus MTCC 369 under submerged fermentation using response surface methodology. Appl. Microbiol. Biotechnol. 2007, 73, 1054– 1058.
(26) Shimizu, K.; Hicks, J. K.; Huang, T.-P.; Keller, N. P. Pka, Ras and RGS protein interactions regulate activity of AflR, a Zn(II)2Cys6 transcription factor in Aspergillus nidulans. Genetics 2003, 165, 1095– 1104.
(27) Bok, J. W.; Keller, N. P. LaeA, a regulator of secondary metabolism in Aspergillus spp. Eukaryotic Cell 2004, 3, 527–535.
(28) Yu, J.; Chang, P.-K.; Ehrlich, K. C.; Cary, J. W.; Bhatnagar, D.; Cleveland, T. E.; Payne, G. A.; Linz, J. E.; Woloshuk, C. P.; Bennett, J. W. Clustered pathway genes in aflatoxin biosynthesis. Appl. Environ. Microbiol. 2004, 70, 1253–1262.
(29) Flaherty, J. E.; Payne, G. A. Overexpression of aflR Leads to Upregulation of Pathway Gene Transcription and Increased Afla-toxin Production in Aspergillus flavus. Appl. Environ. Microbiol. 1997, 63, 3995–4000.
(30) Cary, J. W.; Ehrlich, K. C.; Wright, M.; Chang, P. K.; Bhatnagar, D. Generation of aflR disruption mutants of Aspergillus parasiticus. Appl. Microbiol. Biotechnol. 2000, 53, 680–684.
(31) Shimizu, T.; Kinoshita, H.; Nihira, T. Identification and in vivo functional analysis by gene disruption of ctnA, an activator gene involved in citrinin biosynthesis in Monascus purpureus. Appl. Environ. Microbiol. 2007, 73, 5097–5103.
(32) Sakai, K.; Kinoshita, H.; Shimizu, T.; Nihira, T. Construction of a citrinin gene cluster expression system in heterologous Aspergillus oryzae. J. Biosci. Bioeng. 2008, 106, 466–472.
(33) Marzluf, G. A. Genetic regulation of nitrogen metabolism in the fungi. Microbiol. Mol. Biol. Rev. 1997, 61, 17–32.
(34) Ehrlich, K. C.; Montalbano, B. G.; Cotty, P. J. Sequence comparison of aflR from different Aspergillus species provides evidence for variability in regulation of aflatoxin production. Fungal Genet. Biol. 2003, 38, 63–74.
Received for review September 6, 2009. Revised manuscript received November 16, 2009. Accepted November 17, 2009.