Purification, characterization, and molecular cloning of gonadotropin subunits of silver carp (Hypophthalmichthys molitrix)

(1)

Purification,

Characterization,

and Molecular Cloning of

Gonadotropin

Subunits of Silver Carp (Hypophthalmichthys

molitrix)

Y.

S. CHANG,~.

J.

HUANG,

F. L.

HUANG,

C.

S.

LIU,

AND

T. B. Lo

Institute of Biological Chemistry, Academia Sinica and Znstitute of Biochemical Science, National Taiwan University, P.O. Box 23-106, Taipei, Taiwan

Accepted May 17, 1989

The a and i3 subunit of silver carp gonadotropin (scGTH-a and scGTH-g) were isolated by high-performance liquid chromatography. Heterogeneity of N-terminal amino acid sequence was observed in scGTH-a but not in scGTH-g. For determining the complete primary structures of scGTH-a and scGTH-g, their cDNAs were cloned. Combiig the data of N- and C-terminal sequences determined from proteins and the amino acid sequences deduced from cDNAs, we infer that scGTH-a consists of 95 and/or 93 residues and scGTH+ consists of 115 residues. Both scGTH-a and scGTH-g are glycoprotein. Their carbohydrate content is about 20 g per 100 g protein. The molecular weights of scGTH-a and scGTH-g were calculated to be 12,700 and 15,700 Da, respectively. The amino acid sequences of scGTH-a and scGTH-l3 are very similar to those of the corresponding subunit of carp GTH, diierent in only 2 and 4 residues, respectively. In addition, a high extent of homology (70%) was also observed between the CL subunits of fish and mammalian GTHs. In the case of g subunit, homology among various species of fish (75 to 98%) is much higher than that between fish and mammal (40%). These data suggest that the u subunit is conserved while the f3 subunit is diversified during the molecular evolution of vertebrate GTH. o 1990 Academic press, ~nc.

Mammalian

anterior pituitary gland syn-

thesizes and secretes three glycoprotein

hormones.

They are luteinizing

hormone

(LH), follicle-stimulating

hormone (FSH),

and thyroid-stimulating

hormone

(TSH).

The former two are collectively

designated

as gonadotropin

(GTH). All of them consist

of two nonidentical

subunits, the tx and l3

subunit. Upon nonconvalent

association of

these two subunits, hormonal

function

is

achieved.

Within

a given species, all of

these glycoprotein

hormones

share the

same a subunit while the p subunit is hor-

mone specific (see review of Pierce and

Parsons, 1981). Like mammalian

GTH, te-

leostean GTH is also synthesized and se-

creted from anterior

pituitary

gland and

composed

of two nonidentical

subunits.

The function of teleostean GTH on game-

togenesis and steroidogenesis has been well

documented

(see review of Idler and Ng,

1983).

The primary

structures of the a and l3

subunits of mammalian

GTHs from several

species had been reported (see review of

Pierce and Parsons, 1981). Comparison

of

known sequences of a subunits indicates

that they are highly conserved from species

to species. Similarly,

homology between l3

subunit is also apparent. There are regions

of striking conservation,

not only for the

same hormone

between species, but also

between hormones.

The a and p subunits of GTH from sev-

eral species of teleost have been purified

and characterized

(Burzawa-Gerard,

1974;

Chang et

al.,

1988b; Huang et

al.,

1982;

Itoh et

al.,

1988; Suzuki et

al.,

1988; Trinh

et al.,

1986). Compared to those of mamma-

lian GTHs, the primary structures of the a

and p subunits of fish GTH are not so ex-

tensively studied. Up to now, only the com-

plete sequence of the

a

subunit of carp

GTH (cGTH-a)

and the p subunit of cGTH

23

0016-64W9O $1.50

Copyri&t 8 1990 by Academic Press. Inc. All rights of npmduction in any form reserved.

(2)

24 CHANG ET AL.

(cGTH+)

(Chang et al., 1988b) and salmon

GTH (sGTH+)

(Itoh et al., 1988; Trinh et

al., 1986) have been determined or deduced

from the nucleotide

sequence of cDNA.

The comparative

data show that there is a

high extent of homology

(70%) in amino

acid sequence existing among the cx subunit

of carp and mammalian

GTHs. As for the l3

subunit, the homology

between cGTH and

sGTH is high (75%) while that between fish

GTH and mammalian

GTH is low (40%).

Such findings suggest that the OL subunit is

conserved while the p subunit is diversified

during the molecular

evolution

of verte-

brate GTH.

The above findings are only based on the

data of two species of fish. In order to pro-

vide a wider basis for comparative

study,

we are attempting

to determine the primary

structures of the o and p subunit of GTHs

from more species of fish. This paper is one

of a series of such studies. Here, we report

the purification

and characterization

of the

[Y and /3 subunit of GTH (scGTH-(Y and

scGTH+)

from silver carp (Hypophthal-

michthys molitrix)

and the determination

of

their primary structures by molecular clon-

ing.

MATERIALS

AND METHODS

Purification of scGTH-a and scGTH+. The scGTH was purified as previously described (Chang et al., 1988a). Purillcation of scGTH-a and scGTH-8 was performed by high-performance liquid chromatography (HPLC). The scGTH was dissolved in H,O and chromatographed through a Nucleosil C,, column (4.6 X 250 mm, 7 pm) equilibrated with solvent A (22.5% acetonitrile-0.07% trifluoroacetic acid, TFA) and eluted by a linear gradient of solvent B (40% acetonitrile-O.07% TFA) in which 70% of solvent B was achieved at 60 min. The flow rate was 1 ml/mm. Operation of HPLC was performed at 40”. Individual peak was collected and recovered by lyophilization.

Bioassay of scGTH-a and scGTH-p. The GTH activities of scGTH-a and scGTH-B and their recombinant were assayed by the method of androgen production by carp testis in vitro as previously described (Huang and Chang, 1980). Reassociation of scGTH-a and scGTH-B was performed by mixing them at a 1: 1 molar ratio (Iinal concentration, 1 mg/ml) in 50 mjl4

phosphate buffer, pH 7.4, and incubated at 25” for 2 hr. Chemical analyses. The amino acid composition was determined by the method as described by Chang and Liu (1988). The N-terminal amino acid sequence was determined by a 477A protein sequencer and an on-line 120A phenylthiohydantoin analyzer of Applied Biosystems, Foster City, California (Hewick et al., 1981). For determination of C-terminal amino acid sequence, scGTH-a and scGTH-B were digested with carboxypeptidase Y (Mill&e Corp., Bedford, MA) (substrate:enzyme, 30:1, w/w) in 50 n&f pyridine acetate, pH 5.4, at 37” for 0, 10, and 20 min by the method of Hayashi (1977). The enzymatic digestion was stopped by the addition of acetic acid. After dry- ing, released amino acids were converted to dimeth- ylaminoazobenzenesulfonyl(DABSYL)aminoacidand analyzed (Knecht and Chang, 1986). The carbohydrate content was estimated by using the thiobarbituric acid method for sialic acid (Warren, 1959), the orcinol reaction for neutral sugar (Winzler, 1955), and the p- dimethylaminobenzaldehyde reaction for amino sugar (Rondle and Morgan, 1955). The sodium dodecyl sul- fate (SDS)-polyacrylamide gel electrophoresis (PAGE) was performed as described by Laemmli (1970). The scGTH and its subunits were quantified by their protein content determined by the method of Lowry et al. (1951) with bovine serum albumin as ref- erence.

Radioimmunoassay. The scGTH-a and scGTH-$ were used as antigen to induce antisera in rabbit by multiple-site injection (Vaitukaitis et al., 1971). Iodin- ation of protein was performed by the &lot-amine-T method (Greenwoods et al., 1%3). For assay, 10,080 cpm of labeled antigen and a proper dilution of antiserum which bound 30% of labeled antigen in the ab- sence of unlabeled antigen were used. The assay con- ditions were essentially the same as those described by Roser et al. (1984).

Construction of cDNA library. The polyadenylated mRNA of silver carp pituitary glands was prepared from liquid nitrogen frozen tissue by the guanidinium/ CsCl method (Ulhich er al., 1977) followed by oligo- dT cellulose column chromatography. Double- stranded cDNA, synthesized by the method of Gubler and Hoffman (1983), was ligated with EcoRI linker and subsequently inserted into the EcoRI site of pUC 19. The Escherichia coli strain JM 101 was used as host.

Screening of cDNA library. The cDNAs encoding cGTH-a and cGTH-B (Chang et al., 1988b) were used as probes to screen the cDNA coding for scGTH-a and scGTH-8, respectively. The cDNAs used for probes were labeled with ‘*P-dATP by nick translation.

Bacteria containing recombinant plasmids were fust grown on nitrocellulose filter, lysed with NaOH, baked, and then hybridized by the method of Grun- stein and Hogness (1975). For further confirmation the plasmid DNAs of positive clones were extracted and

(3)

digested with EC&I, subsequently subjected to elec-

trophoresis in agarose, and then hybridized in situ with

two electrophoretic bands. As described

labeled probes (Ridd et al., 1983).

below, the N-terminal amino acid sequence

DNA sequence analysis. In order to analyze the

analysis indicated that peak 1 had a similar

complete nucleotide sequences of the cloned cDNAs,

sequence to that of cGTH-a while peaks 3

they were further subcloned. The cDNAs enconding

and 4 had a similar sequence to that of

scGTHa and scGTH-E were cleaved with PsrI and

_{cGTH-B (Table 1). Consequently, peak 1}

AvaII, respectively. After separation by electrophore-

sis in agarose and electroelution, the resulted DNA

was designated as scGTH-a and peaks 3

fragments were subcloned into pUC 19. The nucle-

and 4 were collectively designated as

otide sequences were determined by the dideoxynu-

scGTH-B.

cleotide chain termination method (Sanger et al.,

1977).

GTH Acitivity

of scGTH-a,

scGTH-P,

and

Their Recombinant

RESULTS

As shown in Fig. 2, either scGTH-a or

Isolation

of scGTH-a and scGTH+

_{scGTH+ expressed very low GTH activity}

By the HPLC system used in this study, while the recombinant of scGTH-a and

scGTH could be resolved into four major scGTH+ expressed high GTH activity

peaks (Fig. 1). When they were analyzed by fully comparable to native scGTH when as-

SDS-PAGE, peaks 1,3, and 4 showed one sayed by androgen production by carp tes-

electrophoretic band while peak 2 showed tis

in vitro.

These results further indicate

that scGTH-a and scGTH-B isolated by

HPLC are the two different subunits of

scGTH.

scGTH0 -

5

3 l;il”_

Itl

scGTH-a (AS-a) and that against scGTH$

E

(AS-g) were induced in rabbit. Both AS-a

tj .06- __-*

__---

30 t

and As-l3 reacted strongly to the homolo-

5

__--

_--- 2

5

gous antigen but weakly to the heterolo-

2 --

L

0 .04- 2

20 2

gous antigen. Calculated at

B/B0 = 50%,

AS-a

showed 3.7% cross-reactivity toward

u

_{scGTH-B while As-B showed 5.6% cross-}

.02- 10

_reactivity

_{toward scGTH-a (data not}

shown).

0 0

0 10 20

_{Chemical Properties}

_{of scGTH-a}

RETENTION TIME (mid

_{and scGTH$}

FIG. 1. Reverse-phase HPLC fractionation of the

subunits of silver carp GTH. Ten micrograms of

The amino acid composition, carbohy-

scGTH dissolved in HZ0 was loaded onto a Nucleosil

drate content, and N- and C-terminal amino

C,s column (4.6 x 250 mm, 7 pm) equilibrated with

acid sequence of scGTH-a and scGTH-B

solvent A (22.5% acetonitrile-0.07% trifluoroacetic

acid, TFA). The sample was eluted with a linear gra-

are presented in Table 1. Both scGTH-a

dient in which 70% of solvent B (40% acetoni-

and scGTH-B had high content of Asp/Asn,

trile-O.O7% TFA) was reached at 60 min at a flow rate

Glu/Gln, Pro, and half Cys. In comparison,

of 1 ml/mm. Operation of HPLC was performed at 40”.

the scGTH-a contains more basic but less

Radioimmunoassay

In order to further characterize scGTH-a

and scGTH+, an immunological approach

was also undertaken. Antiserum against

(4)

CHANG ET AL.

26

30 I-

DOSE (pg/tube)

FIG. 2. The GTH activities of native scGTH, its Q and p subunits, and the recombinant of u and p subunits. The method of androgen production by carp testis in vitro (Huang and Chang, 1980) was used for assay of GTH activity. Each point is the mean of three incubations. Vertical line indicates standard deviation.

acidic amino acid residues than scGTH-P.

In addition, scGTH-a had a lower carbohy-

drate content than scGTH-P,

mainly attrib-

utable to amino sugar.

The amino acid sequence analysis indi-

cated heterogeneity

in N-terminal

sequence

was observed

in scGTH-a

but not in

scGTH+.

Two forms of scGTH-a

were

found, one with Tyr-Pro-kg-Asn-Asp-

while the other one had Arg-Asn-Asp

as

their N-terminal

sequence. For scGTHj3,

the N-terminal

sequence was identified

to

be Ser-Phs-Leu-Pro-Pro-.

The C-terminal

sequences of scGTH-a and scGTH+

were

determined

to be -Lys-Ser

and -Phe-Pro,

respectively.

The molecular

weights of

scGTH-a and scGTH-P

estimated by SDS-

PAGE were 17,400 and 22,670 Da, respec-

tively. However, these values are different

from those calculated by summing up the

molecular

weights of constituting

amino

acid residues and carbohydrate

content of

the molecule,

which yielded 12,700 Da for

scGTH-a and 15,700 Da for scGTH+.

Nucleotide

Sequencing of cDNA

Encoding scGTH-a

From 548 recombinant

cDNA clones, 4

positive clones were obtained when cDNA

encoding cGTH-a was used as a probe. The

nucleotide sequence and the deduced ami-

no acid sequence of one cDNA encoding

scGTH-a are presented in Fig. 3. As shown

in Fig. 3, it has 869 base pairs (bp) in length,

consisting of 31 bp of the 5’ untranslated

region, 354 bp of the open reading frame,

and 481 bp of the 3’ untranslated

region.

The open reading frame encodes a polypep-

tide of 118 residues which contains a 95-

residue protein with the same N- and C-

terminal

sequences as those determined

from scGTH-a.

The amino acid composi-

tion predicted from cDNA is very close to

that determined

from scGTH-a

(Table 1).

(5)

TABLE 1

THECHEMICALPROPERTIESOF scGTH-a AND scGTH-B

a subunit B subunit

Protein” cDNAb Protein” cDNAb

Amino acid composition”

LYS 9.2 (9) 10 4.0 (4) 4 His 3.2 (3) 3 3.0 (3) 3 ‘b 3.9 (4) 4 4.1 (4) 4 Asx 10.2 (10) 10 9.1 (9) 9 Thr 6.6 (7) 7 10.3 (10) 11 Ser 5.8 (6) 6 7.6 (8) 9 Glx 6.3 (6) 6 11.6 (12) 12 pro 6.4 (6) 6 13.2 (13) 13 GUY 3.7 (4) 3 4.1 (4) 3 Ala 4.7 (5) 4 2.7 (3) 2 ll2Cys 9.6 (10) 10 12.1 (12) 12 Val 8.4 (8) 8 11.4 (11) 11 Met 1.9 (2) 2 2.0 (2) 2 Ile 2.9 (3) 3 3.2 (3) 3 Leu 5.4 (5) 5 7.1 (7) 7 ‘b 4.2 (4) 5 5.6 (6) 6 Phe 3.0 (3) 3 4.0 (4) 4 Total (95) 95 (115) 115

Amino acid sequence

N-terminal (Tyr-Pro)-Arg-Asn-Asp- Ser-Phe-Leu-Pr+Pr+

C-terminal -LysSer -Phe-Pro

Carbohydrate contentd

Neutral sugar 10.2 10.6

Amino sugar 6.6 11.2

Siahc acid 1.3 2.1

0 Determined from protein by amino acid analysis. b Predicted from nucleotide sequence of cDNA.

c Number of residues. The integrated number is shown in parentheses. d g per 100 g protein.

Nucleotide

Sequencing of cDNA

Encoding scGTH+

There are three positive clones obtained

when cDNA encoding cGTH+

was used as

a probe for screening of the silver carp pi-

tuitary cDNA library. The nucleotide

and

deduced amino acid sequence of one cDNA

encoding scGTH+l

are presented in Fig. 4.

It has 554 bp in length, consisting of 18 bp

of the 5’ untranslated

region, 423 bp of the

open reading frame, and 110 bp of the 3’

untranslated

region.

The open reading

frame encodes a 115residue

protein with

the same N- and C-terminal

sequences as

those determined from scGTH-P.

The data

of Table 1 also indicated that the amino acid

composition

predicted from cDNA is very

close to that determined

from scGTH+.

DISCUSSION

The scGTH has been purified and char-

acterized (Chang et al., 1988a). In this pa-

per, we continued our previous work to pu-

rify and characterize the subunits of scGTH

for the purpose of getting a better under-

standing of scGTH and of providing a wider

basis for comparative

study of vertebrate

GTHs.

The two subunits of scGTH prepared in

this study seem to be highly purified,

as

(6)

28

CHANG ET AL.

CATCTCACTGGAAGTCAAGAACAAAGCCATC ATG TTT TGG ACA AGA TAT GCT GGA 55 Met Phe Trp Thr Arq Tyr Ala Gly

-23 -20

GCA AGT ATA TTA TTG TTT TTA ATG CTT ATT CAT CTT GGA CAA GTA TAT 103 Ala Ser Ile Leu Leu Phe Leu Met Leu Ile His Leu Gly Gin Val Tyr

-10 -1 1

CCA AGA AAT GAT ATT ACT AAC TTT GGA TGT GAG GAG TGC AAA CTC AAG 151 Pro Arg Asn Asp Ile Thr Asn Phe Gly Cys Glu Glu Cys Lys Leu Lys

10

GAG AAC AAC ATT TTC TCA AAA CCC GGC GCT CCC GTC TAT CAG TGT ATG 199 Glu Asn Am Ile Phe Ser Lys Pro Gly Ala Pro Val Tyr Gln Cys Met

20 30

GGA TGC TGC TTT TCC AGG GCT TAC CCC ACA CCC CTG AGG TCC AAG AAA 247 Gly Cys Cys Phe Ser Arg Ala Tyr Pro Thr Pro Leu Arq Ser Lys Lys

40

ACC ATG CT'I' GTT CCC AAA AAT ATC ACA TCA GAA GCT ACA TGC TGT GTA 295 Thr Met Leu Val Pro Lys Asn Ile Thr Ser Glu Ala Thr Cys Cys Val

50 60

GCC AAA GAA GTT AAA CGG GTA CTT GTC AAT GAT GTC AAA CTA GTG AAC 343 Ala Lys Glu Val Lys Arq Val Leu Val Asn Asp Val Lys Leu Val Asn

70 80

CAC ACA GAC TGC CAC TGT AGC ACC TGT TAC TAT CAC AAA TCT TAA AAA 391 His Thr Asp Cys His Cys Ser Thr Cys Tyr Tyr His Lys Ser ***

90 95 CACTATGACATTTCAAATTTACTTGTGTTTGCTTACTTACTTATATTCCTGTACCTATTTTTT 454 CTGCAGTGCTTATTTTCTGTTCTTGATTCACAATGACTTACATATTTAAAGTGAAAACATACT 517 GTTAGAAGTTTGCTATATACCCGTACTGTGCAAATTTTCTTCATACTGTCGATTGTTTTAAAC 580 AATTCTTTTTTAAAAGGTTGTCATAATTGTTGTAATTTGTGCCCTACTTCCATAAATAGCTTA 643 AAATGCAATATTTTATCATTTATAAAATGCAAGATAACTTCATTACTATGCTCTGCTTGGTAT 706 TATTTTAAACCCTCTTTTGTTGGTAATTGCTGACTTGTTTTGTCGTCGCTGCTATACGATTGT 769 TCAAATACATTAATTAAAAACAAGATTGCTTATGA (n=66) 869

FIG. 3. The nucleotide sequence and the deduced amino acid sequence of cDNA encoding scGTH-a.

evidenced

by the following

criteria:

(1)

Both scGTH-a and scGTH-B have only one

electrophoretic

band in SDS-PAGE;

(2) re-

association

of scGTH-a

and scGTH-B

could fully restore the hormonal

function

(Fig. 2); (3) the antiserum against scGTH-a

and that against scGTH+

had very low

cross-reactivity

toward their counterpart

subunits;

and (4) both

scGTH-a

and

scGTH-B have their own unique N- and C-

terminal

sequence (Table 1). However,

it

should be noted that heterogeneity

is found

in the N-terminal

sequence of scGTH-a.

Such phenomenon

was also observed in the

case of ovine LH-a (Liu et al., 1972).

Molecular

cloning has been widely used

to determine the primary structure of pro-

tein. Combining

the data of N- and C-

terminal

sequences determined

from pro-

tein and the amino acid sequence deduced

from cDNA, we infer that scGTH-a

has 95

and/or 93 residues while scGTH-B

has 115

residues.

The C-terminal

residue

of

scGTH-a is the same one just preceding the

stop codon while that of scGTH-B

is the

one which is two residues ahead of the stop

(7)

AGAGGGACACCTGTCAAG ATG TTA GCT GTT CGA AAC AAC ATC CTC CTT CTC 51

Met Leu Ala Val Arg Asn Am Ile Leu Leu Leu

-24 -20

TTA TTC TGT TTA GTT GTT CTG CTA GTC TTT GCT CAA AGC TCT TTT CTT 99 Leu Phe Cys Leu Val Val Leu Leu Val Phe Ala Gln Ser Ser Phe Leu

-10 -1 1

CCA CCA TGT GAG CCA GTT AAT GAG ACT GTT GCA GTG GAG AAA GAG GGC 147 Pro Pro Cys Glu Pro Val Asn Glu Thr Val Ala Val Glu Lys Glu Gly

10

TGT CCA AAA TGT CTG GTG TTT CAG ACC ACC ATC TGC AGT GGC CAC TGC 795 Cys Pro Lys Cys Leu Val Phe Gln Thr Thr Ile Cys Ser Gly His Cys

20 30

CTA ACA AAG GAG CCT GTA TAC AAG AGC CCA TTT TCC ACT GTC TAC CAA 243 Leu Thr Lys Glu Pro*Val Tyr Lys Ser Pro Phe Ser Thr Val Tyr Gln

40 50

CAC GTG TGC ACT TAC CGG GAC GTC CGC TAT GAG ACA GTC CGC TTG CCA 291 His Val Cys Thr Tyr Arg Asp Val Arg Tyr Glu Thr Val Arg Leu Pro

60

GAC TGT CCT CCC GGG GTG GAC CCC CAT ATC ACT TAC CCG GTG GCT CTC 339 Asp Cys Pro Pro Gly Val Asp Pro His Ile Thr Tyr Pro Val Ala Leu

70 80

AGC TGC GAC TGC AGC CTC TGC ACC ATG GAC ACG TCC GAC TGT ACC ATC 387 Ser Cys Asp Cys Ser Leu Cys Thr Met Asp Thr Ser Asp Cys Thr Ile

90

GAA AGC CTG CAG CCT GAT TAC TGC ATG TCT CAG AGG GAG GAT TTC CCT 435 Glu Ser Leu Gin Pro Asp Tyr Cys Met Ser Gln Arg Glu Asp Phe Pro

100 110

GTG TAT TAG CCTACAGGAGTACTGTCCTGTCATCAAACCACAAAGCCCACTCTAAATCAG 494 Val Tyr ***

117

ATAAATGTCACATAGATGTATATCAATAAAAAACTACATACTTCATA~n=,3~ 554

FIG. 4. The nucleotide sequence and the deduced amino acid sequence of cDNA encoding scGTH-8.

codon. Consequently,

there must be a post-

translational

modification

of scGTH-8

by

proteolytic

cleavage of two residues (-Va&

Tyr) from the precursor. Post-translational

modification

at the C-terminal

part is also

observed in cGTH-8

(Chang ef al., 1988b)

and mammalian

LH-B (Maurer,

1985) and

TSH-l3 (Maurer

et al., 1984), but not in

sGTH-B

(Itoh er al., 1988; Trinh et al.,

1986) and mammalian

FSH-8 (Esch et al.,

1986).

Recently, two distinct GTHs, designated

as GTH I and II, from chum salmon pitu-

itary glands were isolated by Suzuki et al.

(1988). They share a common OL subunit but

have a different B subunit. The homology of

the amino acid sequence between these two

subunits is very low, only about 30% (Itoh

et al., 1988). Therefore,

duality

of GTH

was hypothesized.

However, only one type

of GTH was isolated

and characterized

from other species of fish, including

silver

carp (Burzawa-Gerard,

1974; Chang et al.,

1988a,b; Donaldson

er al., 1972; Farmer

and Papkoff,

1977; Huang et al., 1981;

Pierce et al., 1976). Such discrepancy may

be due to either species differences or differ-

ent methods used for GTH extraction

and

purification.

If two types of B subunits of

GTH are present in silver carp, then two

types of corresponding

cDNAs should be

expected. Because the probe we used for

(8)

30

CHANG ET AL.

screening scGTHj3

was the cDNA encod-

ing cGTH+,

which is highly homologous to

the p subunit of salmon GTH II, therefore

only one type of cDNA encoding scGTH-P

was obtained.

In order to investigate

whether duality of GTH is also present in

silver carp or not, we are currently

re-

screening the cDNA library of silver carp

with other probes.

The amino acid sequence of scGTH-cr is

very similar to that of cGTH-ol, with a dif-

ference of 2 residues. In addition, scGTH-ol

bears a high extent of homology

(72%) to

that of the (Y subunit of mammalian

glyco-

protein hormones (Tables 2 and 4). The ex-

tent of homology between the cx subunit of

fish and mammalian

GTH is close to that

between the OL subunit of pituitary

glyco-

protein hormones from different species of

mammal.

Like the (Y subunit, homology

of

amino acid sequences between scGTH-P

and cGTH+

is extremely high, only differ-

ent in 4 residues. When scGTH$

is com-

pared with sGTH-l3,

the homology

in the

amino acid sequence decreased to 75% (Ta-

ble 4). The p subunit of Cyprinidae

GTH

(scGTH and cGTH) and Salmonidae

GTH

(sGTH) share a long homologous

region in

the middle part of the molecule

(Table 3).

However,

their N- and C-terminal

se-

quences are different

from each other.

These results reveal the phylogenetic

rela-

TABLE 2

THE AMINO ACID SEQUENCES OF THE a SUBUNIT OF SILVER CARP AND CARP GTH AND HUMAN AND BOVINE LH

scGTH cGTH hLH bLH scGTH cGTH hLH bLH scGTH cGTH hLH bLH scGTH cGTH hLH bLH scGTH cGTH hLH bLH scGTH cGTH hLH bLH scGTH cGTH hLH bLH Tyr-Pro-Arg-Asn-Asp- Be -Thr-Asn-Phe-Gly-Cys-Glu-Glu-Cys- - - - - _ Met Asn - - _ _ _ _ _ Val Gln Asp - Pro - - Phe - Asp Gly Glx Phe - Met Glu - - Pro Gin - Lys-Leu-Lys-Glu-Asn-Asn- Ile -Phe-Ser-Lys-Pro-Gly-Ala-Pro-

---

Thr - Gin - - Pro Phe - - Gin - - - - - - - Lys Tyr - - - - Asp - - Val-Tyr-Gln-Cys-Met-Gly-Cys-Cys-Phe-Ser-Arg-Ala-Tyr-Pro- -_-_--- Ile -L.g _ - - _ _ - - _ _ _ _ _ Ile _ - _ _ - - - _ - - - Thr-Pro-Leu-Arg-Ser-Lys-Lys-Thr-Met-Leu-Val-Pro-Lys-Asn- ---_--- --- Gln - - - - ~a--- Ile -Thr-Ser-Glu-Ala-Thr-Cys-Cys-Val-Ala-Lys-Glu-Val-Lys- ---

Val - - - Ser - - - Ser Tyr Asn - - - Glx - - - Ala Phe Thr Arg-Val-Leu-Val-Asn-Asp-Val-Lys-Leu-Val- X -Asn-His-Thr-

---

- - Thr - Met Gly Gly Phe Lys - Glu - - - Lys Ala Thr - Met Gly Asn Val Arg - Glx - - - Asp-Cys-His-Cys-Ser-Thr-Cys-Tyr-Tyr-His-Lys-Ser

---_-_-___

&a _-__ -___--_ Glx---e-m

Note. SC, silver carp; c, carp; h, human; b, bovine; -, residue identical to that of scGTH; X, gap insertion for half cystine alignment. References: cGTH from Chang et al. (19t38b); hLH from Fiddes and Talmadge (1984); bLH from Cornell and Pierce (1974).

(9)

TABLE 3

THE AMINO ACID SEQUENCES OF THE /3 SUBUNIT OF SILVER CARP, CARP, AND SALMON GTH AND BOVINE LH AND FSH

scGTH cGTH SGTH bLH bFSH scGTH cGTH sGTH bLH bFSH scGTH cGTH sGTH bLH bFSH scGTH cGTH sGTH bLH bFSH scGTH cGTH sGTH bLH bFSH scGTH cGTH sGTH bLH bFSH scGTH cGTH sGTH bLH bFSH scGTH cGTH sGTH bLH bFSH scGTH cGTH sGTH bLH bFSH Ser-Phe-Leu-Pro-Pro-Cys-Glu-Pro-Val-Asn-Glu- - Tyr - _ - _ - - - - _

- Leu Met Gln - - Gln - Ile - Gln Ser-Arg-Gly-Pro Leu Arg - Leu - Gln - Ile - Ala - - Leu Thr - Be Thr-Val-Ala-Val-Glu-Lys-Glu-Gly-Cys-Pro-Lys-Cys-Leu-Val-

---_---

- - Ser Leu - _ - _ - _ ti _ _ - - Leu - Ala - - - Ala - - Val - Be Thr - Ile Thr - - - - Glu - Gly Phe - Ile Ser Phe-Gln-Thr-Thr- Ile -Cys-Ser-Gly-His-Cys-Leu-Thr-Lys-Glu-

Leu---

Be Arg Ala Pro - - - Val - - - - Thr - Ser - - Ala - Tyr - Pro Ser Met Lys Ile Asn - - Trp - Ala - Tyr - Tyr - Arg Asp Pro-Val-Tyr-Lys-Ser-Pro-Phe-Ser-Thr-Val-Tyr-Gln-His-Val-

---

- _ phe _ - - - -

kc - Leu Pro Val Ile Leu Pro Pro Met Pro - Arg - Leu - - Arg Asp - Ala Arg Pro Asn Ile - Lys Thr Cys-Thr-Tyr-Arg-Asp-Val-Arg-Tyr-Glu-Thr-V~-~g-Leu-~o-

---

- - - Met Ile - - -

- - - _{His Glu Leu} _- _{Phe Ala} _Ser _- _- _- _- - _- _{Phe Lys Glu Leu Val} _- _- _- _- _{Lys Val} _- Asp-Cys-Pro-Pro-Gly-Val-Asp-Pro-His- Ile -Thr-Tyr-Pro-Val-

---

- - - - Trp Ser - - - Val - - - -

Gly - - - Met Val Ser Phe - - Gly - Ala His His Ala - Ser Leu Tyr - - - - Ala-Leu-Ser-Cys-Asp-Cys-Ser-Leu-Cys-Thr-Met-Asp-Thr-Ser-

- - - -

- - - - His -

- Thr Glu - His - Asp-Cys-Thr- Ile -Glu-Ser

- - - - _ - - - - - - - Gly Gly Pro Arg - - _- _{Val Arg Gly} Gln - Arg - Glu -Asp- Phe - Pro

- - - Asn - - - -

Gly Pro - Arg Leu Ser Ser Thr - Lys - Asp Ser Asp Ser Thr -Leu-Gln-Pro-Asp-Tyr-Cys-Met-Ser-

- _ - - _Phe _- _- _- - - - - Phe - Ile Thr Thr - - Leu Ala - Asp His - Gly - Ser Tyr - Ser Phe

- - - Leu

- - Val Leu Thr Asp-Gly-Asp-Met-Trp Pro Pro Leu Pro Asp Ile Leu Arg Glu Ile Lys Glu

Note. SC, silver carp; c, carp; s, salmon; b, bovine; -, residue identical to that of scGTH. References: cGTH from Chang et al. (1988b); sGTH from Trinh et al. (1986); bLH from Maurer (1985); bFSH from Esch et al. (1986).

(10)

32

CHANG ET AL.

TABLE 4

HOMOLOGY ANALYSIS OF VERTEBRATE GTHs Subunit Type of GTH a scGTH vs cGTH scGTH vs bLH bLH vs hLH B scGTH vs cGTH scGTH vs sGTH scGTH vs bLH scGTH vs bFSH sGTH vs bLH sGTH vs bFSH bLH vs bFSH Homology (%) 98 72 74 97 75 42 40 41 35 38 Note. References: cGTH-a and cGTH+ from Chang et al. (1988b); bLH-a from Cornell and Pierce (1974); bLH+ from Maurer (1985); hLH-a from Fid- des and Tahnadge (1984); sGTH-B from Trinh et al. (1986); bFSH-B from Esch et al. (1986).

tionship of the (3 subunit of fish GTH. The

data of Tables 3 and 4 indicate that homol-

ogy between the (3 subunit of fish and mam-

malian GTH is around 40%, which is close

to that between the p subunit of LH and

FSH of a given species of mammal.

Al-

though the amino acid sequences of the p

subunit of fish and mammalian

GTHs are

diversified,

all of them contain

12 half-

cystines and these residues can be aligned

at the same positions.

The homology

analyses of the OL and /3

subunit between fish and mammalian

GTH

are summarized

in Table 4. These compar-

ative data gave further indication that the CY

subunit is conserved while the p subunit is

diversified

during the molecular

evolution

of vertebrate GTH.

ACKNOWLEDGMENTS

We express our particular appreciation to Mr. C. S. Chang for his invaluable amino acid determination. This work was supported by the National Science Council, ROC (NSC 77-0203-BOOl-07).

REFERENCES

Burzawa-Gerard, E. (1974). Purifcation d’une hormone gonadotrope hypophysaire de poisson tele- osteen, la carpe (Cyprinus carpio L.). Biochimie 53.545-552.

Chang, C. S., and Liu, C. S. (1988). A picomole-level amino acid analysis by means of gas-phase hydrolysis and DABS-CYHPLC method. J. Chin. Biochem. Sot. 17, 12-19.

Chang, Y. S., Huang, F. L., Chen, C. T., and Lo, T. B. (1988a). Isolation and properties of the pituitary gonadotropin from silver carp (Hypoph- thalmichthys molitrir). Znt. J. Pept. Protein Res. 31, 150-156.

Chang, Y. S., Huang, C. J., Huang, F. L., and Lo, T. B. (198813). The primary structures of carp gonadotropin subunits deduced from cDNA nucleotide sequences. Znt. J. Pept. Protein Res. 32, 5X-564.

Cornell, J. S., and Pierce, J. G. (1974). Studies on the disulfide bonds of glycoprotein hormones. .Z. Biol. Chem. 249,4166-4174.

Donaldson, E. M., Yamazaki, F., Dye, H. M., and Philleo, W. W. (1972). Preparation of gonadotropin from salmon (Oncorhynchus tshawytscha) pituitary glands. Gen. Comp. Endocrinol. 18, 469- 481.

Esch, F. S., Mason, A. J., Cooksey, K., Nercads, M., and Shimasaki, S. (1986). Cloning and DNA sequence analysis of the cDNA for the precusor of the g chain of bovine follicle stimulating hormone. Proc. Natl. Acad. Sci. USA 83, 6618-6621. Farmer, S. W., and Papkoff, H. (1977). A teleost (Ti-

lapia mossambica) gonadotropin that resembles luteinizing hormone. Life Sci. 20, 1227-1232. Fiddes, J. C., and Talmadge, K. (1984). Structure, ex-

pression and evolution of the genes for the human glycoprotein hormones. Recent Prog. Horm. Res. 40,43-78.

Greenwoods, F. C., Hunter, W. M., and Glover, J. S. (1963). The preparation of ‘311-labelled human growth hormone of high specific radioactivity. Biochem. J. 89, 116123.

Grunstein, M., and Hogness, D. (1975). Colony hy- bridization: A method for the isolation of cloned DNAs that contain a specific gene. Proc. Nutl. Acad. Sci. USA 12, 3%1-3%5.

Gubler, U., and Hoffman, B. J. (1983). A simple and very efficient method for generating cDNA library. Gene 25, 263-269.

Hayashi, R. (1974). Carboxypeptidase Y in sequence determination of peptide. In “Methods in Enzy- mology” (C. H. W. Hirs and S. N. Timo- sheff, Eds.), Vol. 47, pp. 8+93. Academic Press, New York.

Hewick, R. M., Hunkapillar, M. W., Hood, L. E., and Dreyer, W. J. (1981). A gas-liquid solid phase peptide and protein sequenator. J. Biol. Chem. 256,799&7997.

Hunag, F. L., and Chang, Y. S. (1980). The gonado- tropic stimulation of androgen production on carp

(11)

testis in vitro. Proc. Natl. Sci. Count. Repub. China 4, 392400.

Huang, F. L., Huang, C. J., Lin, S. H., Lo, T. B., and Papkoff, H. (1981). Isolation and characterization of gonadotropin isohormones from the pituitary gland of pike eel (Muraenesox cinereus). Int. J. Pept. Protein Res. 18, 69-78.

Huang, F. L., Chang, Y. S., Chang, G. D., and Lo, T. B. (1982). Properties of subunits of pike eel gonadotropin. Proc. Natl. Sci. Count. Repub. China 6, 3&36.

Idler, D. R., and Ng, T. B. (1983). Teleost gonadotropins: Isolation, biochemistry and function. In “Fish Physiology” (W. S. Hoar and D. J. Ran- dell, Eds.), Vol. 9A, pp. 187-221. Academic Press, New York.

Itoh, H., Suzuki, K., and Kawauchi, H. (1988). The complete amino acid sequences of B-subunits of two distinct chum salmon GTHs. Gen. Camp. En- docrinol. 71,438-451.

Kidd, V. J., Wallace, R. B., Hakura, K., and Woo, S. L. C. (1983). a,-Antitrypsin deficiency detec- tion by direct analysis of the mutation in the gene. Nature (London) 304, 230-234.

Knecht, R., and Chang, J. Y. (1986). Liquid chro- matographic determination of amino acids after gas-phase hydrolysis and derivatization with (dimethylamino)azobenzenesulfonyl chloride. Anal. Chem. 58, 2375-2379.

Laemmli, U. K. (1970). Cleavage of structural protein during the assembly of the head of bacteriophage T+ Nature (London) 227, 68-5.

Liu, W. K., Nahm, S. H., Sweeney, C. M., Lamkin, W. M., Baker, H. N., and Ward, D. N. (1972). The primary structure of ovine luteinizing hormone. I. The amino acid sequence of the reduced and S-aminoethylated S-subunit (LH-a). J. Biol. Chem. 247, 43516364.

Lowry, 0. H., Rosebrough, N. J., Far, A. L., and Rondall, R. J. (1951). Protein measurement with the phenol reagent. J. Biol. Chem. 193, 265-275. Maurer, R. A. (1985). Analysis of several bovine lutropin B subunit cDNAs reveals heterogeneity in nucleotide sequence. J. Biol. Chem. 260,4684- 4687.

Maurer, R. A., Croyle, M. L., and Donelson, J. E. (1984). The sequence of a cloned cDNA for the B subunit of bovine thyrotropin predicts a protein containing both NH,- and COOH-terminal exten- sions. J. Biol. Chem. 259, 502&5027.

Pierce, J. G., Faith, M. R., and Donaldson, E. M. (1976). Antibodies to reduced S-carboxymeth- ylated alpha subunit of bovine luteinizing hormone and their application to study of the puriii- cation of gonadotropin from salmon (Onchohyn- thus tshawytscha) pituitary glands. Gen. Camp. Endocrinol. 30, 47-60.

Pierce, J. G., and Parsons, T. F. (1981). Glycoprotein hormones: Structure and function. Annu. Rev. Biochem. 50,465-495.

Rondle, C. J. M., and Morgan, W. T. J. (1955). The determination of glucosamine and galactosamine. Biochem. J. 61, 586-589.

Roser, J. F., Chang, Y. S., Papkoff, H., and Li, C. H. (1984). Development and characterization of a homologous radioimmunoassay for equine prolactin. Proc. Exp. Biol. Med. 475, 510-517.

Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibi- tors. Proc. Natl. Acad. Sci. USA 14, 5463-5467. Suzuki, K., Kawauchi, H., and Nagahama, Y. (1988).

Isolation and characterization of subunits from two distinct salmon gonadotropins. Gen. Camp. Endocrinol. 71, 302-306.

Trinh, K. Y., Wong, N. C., Hew, C. L., and Crim, L. W. (1986). Molecular cloning and sequencing of salmon gonadotropin B subunit. Eur. J. Bio- them. 159, 619-624.

Vaitukaitis, J. L., Roffms, J. B., Nieschlag, E., and Ross, G. T. (1971). A method of producing spe- chic antisera with small dose of hnmunogen. J. Clin. Endocrinol. Metab. 33, 988-991.

Ullrich, A., Shine, J., Chirgwin, J., Pictet, R., Tis- cher, E., Rutter, W. J., and Goodman, H. M. (1977). Rat insulin genes: Construction of plasmids containing the coding sequences. Science

l%, 1313-1319.

Warren, L. (1959). The thiobarbituric acid assay of sialic acid. J. Biol. Chem. 234, 1971-1975. Winzler, R. J. (1955). Determination of serum glyco-