Advance Access publication April 15, 2008
Glypican-3-mediated oncogenesis involves the Insulin-like growth factor-signaling
pathway
Wei Cheng
1,2,y, Chia-Jen Tseng
3,4,y, Tom T.C.Lin
2,
I.Cheng
5, Hung-Wei Pan
6, Hey-Chi Hsu
1,6and Yu-May
Lee
3,4,1Graduate Institute of Pathology, College of Medicine, National Taiwan
University, Taipei 100, Taiwan,2Department of Pathology, Kee-Lung General Hospital, Department of Health, The Executive Yuan, Kee-Lung 200, Taiwan,
3
Institute of Biological Chemistry, Academia Sinica, Taipei 115, Taiwan,
4
Institute of Biochemical Sciences, National Taiwan University, Taipei 106, Taiwan,5Department of Pediatrics, Shin Kong Wu Ho-Su Memorial Hospital,
Taipei 111, Taiwan and6Department of Pathology, National Taiwan University Hospital, Taipei 100, Taiwan
To whom correspondence should be addressed. Tel:þ886 2 27855696
ext. 6120; Fax:þ886 2 27889759; Email: [email protected]
Correspondence may also be addressed to Hey-Chi Hsu. Tel:þ886 2 23562154; Fax: þ886 2 23934172; Email: [email protected]
Glypican-3 (gpc3) is the gene responsible for
Simpson-Golabi-Behmel overgrowth syndrome. Previously, we have shown that
GPC3 is overexpressed in hepatocellular carcinoma (HCC). In
this study, we demonstrated the mechanisms for GPC3-mediated
oncogenesis. Firstly, GPC3 overexpression in NIH3T3 cells gave
to cancer cell phenotypes including growing in serum-free
me-dium and forming colonies in soft agar, or on the other way,
GPC3 knockdown in HuH-7 cells decreased oncogenecity. We
further demonstrated that GPC3 bound specifically through its
N-terminal proline-rich region to both Insulin-like growth factor
(IGF)-II and IGF-1R. GPC3 stimulated the phosphorylation of
IGF-1R and the downstream signaling molecule extracellular
sig-nal-regulated kinase (ERK) in an IGF-II-dependent way. Also,
GPC3 knockdown in HCC cells decreased the phosphorylation
of both IGF-1R and ERK. Therefore, GPC3 confers oncogenecity
through the interaction between IGF-II and its receptor, and the
subsequent activation of the IGF-signaling pathway. This data are
novel to the current understanding of the role of GPC3 in HCC
and will be important in future developments of cancer therapy.
Introduction
Hepatocellular carcinoma (HCC) is the leading cause of death among
cancers in many countries especially in Asia, and the incidence of HCC
is rising in many other countries (1,2). The molecular mechanisms for
hepatocarcinogenesis are quite complex (3), and despites early
detec-tion and aggressive therapies, the outcome of HCC remains grave. We
previously discovered that glypican-3 (GPC3, also known as MXR7) is
overexpressed in HCC (4). gpc3 mRNA was detectable in 143 of 191
(74.8%) primary and recurrent HCCs, whereas only in 3.2% of the
non-tumor part of the livers. GPC3 overexpression correlates to high
alpha-fetoprotein, high tumor grade and high tumor aggressiveness in HCC
individuals (4), and GPC3 stimulates in vitro and in vivo growth of
HCC (5). Overexpression of gpc3 mRNA is also observed in metastatic
colorectal carcinomas (6), alpha-fetoprotein-producing gastric
carci-noma (7), hepatoblastoma, Wilms’ tumor (8), malignant melacarci-noma
(9), yolk sac tumor, choriocarcinoma (10), ovarian carcinoma (11)
and in cell lines derived from breast cancer (12) and ovarian cancer
(13). These findings suggest that GPC3 plays a role in oncogenesis.
GPC3 is a glycosyl-phosphatidylinositol-anchoring heparan sulfate
proteoglycan (14). It functions as a ‘coreceptor’ for heparin-binding
proteins like growth factors or adhesion molecules (15,16), and the
binding of coreceptors facilitate interactions between the
heparin-binding factors and their corresponding receptors (17,18). GPC3 is
first processed to the 65 kDa core protein, which can be further
cleaved by a furin-like convertase into a 40 kDa protein. GPC3
mod-ulates Wnt signaling and stimmod-ulates the growth of HCC cells in a
gly-cosaminoglycan-independent way (5). GPC3 has also been reported
to bind Insulin-like growth factor-II (19,20). The IGF-signaling
path-way plays a pivotal role in cell proliferation (21), G
1cell cycle
pro-gression (22), prevention of apoptosis (23) and the initiation and
maintenance of oncogenesis (24–26). Increase in IGF-II expression
has been observed in liver cancers including HCC (27–29), and
in-sulin receptor substrate-1, an adapter molecule for IGF-II signaling, is
overexpressed in HCC (30,31). GPC3 is also involved in the
pathogen-esis of Simpson-Golabi-Behmel overgrowth syndrome (19,20).
In order to study the mechanism for GPC3-mediated oncogenesis,
we expressed GPC3 in GPC-null NIH3T3 cells and also knocked down
GPC3 in GPC3-expressing HCC cells. We demonstrated specific
interactions both between GPC3 and IGF-II and between GPC3 and
IGF-IR, and we also showed GPC3- and IGF-II-dependent
phosphor-ylation of IGFI-R and extracellular signal-regulated kinase (ERK).
Therefore, GPC3 confers oncogenecity through interacting with
IGF-II and its receptor and the activation of the IGF-signaling pathway.
Materials and methods
Cell linesHEK293, HEK293T, HeLa, PLC-PRF-5 (American Tissue Cell Collection), NIH3T3 (Biosources Collection and Research Center, National Health Re-search Institute, Taiwan), HA22T/VGH (32) and HuH-7 (33) cells were cul-tured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum. All cell lines were maintained at 37°C in a humidified atmo-sphere with 5% CO2. Serum starvation was done in 0.5% serum for the
HA22T/VGH cells and was in 0% serum for all other cells. Plasmids
The wild-type GPC3 expression vector pcDNA-gpc3 was constructed by inserting gpc3 complementary DNA into pcDNA3.1 (þ) myc-his vector (Invitrogen, San Diego, CA) (4). The C-terminal green fluorescence protein (GFP)-tagged GPC3 (GPC3-GFP) expression vector pgpc3-GFP was constructed by replacing the stop codon with an EcoRI site (using primer T3 and GTGCTTCT-TCTTCCTGGTGAAGGCTGGTGAATTCT, with the EcoRI site underlined), and transferred into pcDNA3.1. KpnI/EcoRV fragment of the insert was trans-ferred into KpnI and SmaI site of pEGFP-N1 vector (Clontech, Mountain View, CA). Arginine residues 355 and 358 of the GPC3 protein were mutated to alanine by site-directed mutagenesis to express GPC3 mutant RR / AA (RR / AA) (34); and proline residues 25–29 were mutated to alanine in GPC3 mutant P25-29A (P25-P25-29A). All constructs were confirmed by DNA sequencing. Transfection and selection for stable lines
Transient transfection was done with Lipofectamine 2000 according to the manufacturer’s instruction (Invitrogen). To generate NIH3T3, PLC-PRF-5 Abbreviations:ERK, extracellular signal-regulated kinase; GFP, green
fluo-rescence protein; GPC3, glypican-3; GST, glutathione S-transferase; HCC, hepatocellular carcinoma; IGF, insulin-like growth factor; shRNA, small hairpin RNA; siRNA, small interfering RNA; mRNA, messenger RNA.
yThese authors contributed equally to this work.
Ó The Author 2008. Published by Oxford University Press. All rights reserved. For Permissions, please email: [email protected] The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press are attributed as the original place of publication with the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but
and HA22T/VGH stable lines, selection was performed with 800 lg/ml G418 (Invitrogen). Surviving cells were isolated and expanded.
Reverse transcription-polymerase chain reaction
Total RNA was extracted by the Trizol reagent (Invitrogen) and was reverse transcribed according to the manufacturer’s instruction (Invitrogen). Semiquan-titative reverse transcription–polymerase chain reaction was used to measure gpc3 mRNA levels using primers GPC3-974-F (TGCTCTTACTGCCAGG-GACT) and GPC3-1671-R (TCAAACCCTTCCTCATCCAG). For checking hu-man IGF-1 mRNA, hIGF-1-F (ATGGGAAAAATCAGCAGTCT) and hIGF-1-R (CATCCTGTAGTTCTTGTTTCC) were used. For checking murine IGF-1 mRNA, mIGF-1-F (CATGTCGTCTTCACACCTCTT) and mIGF-1-R (CTTGT-GTTCTTCAAATGTA) were used. For checking human IGF-II mRNA, hIGF-II-F (ATGGGAATCCCAATGGGGAA) and hIGF-II-R (CTCGGACTTGGCGG-GGGTA) were used. For checking murine IGF-II mRNA, mIGF-II-1255-F (CGC TTAGTTTGTCTGTTCG) and mIGF-II-1597-R (CGTTTGGCCTCTCTGAA-CTC) were used.
Antibodies and immunoprecipitation assay
Antibodies used included anti-GPC3 (1G12, BioMosaics, Burlington, VT), anti-GFP (Clontech), anti-tubulin, anti-actin (Sigma–Aldrich, St Louis, MO), anti-phosphotyrosine (PY20) (Upstate Cell Signaling Solutions, Lake Placid, NY), anti-IGF-1Rb, anti-phospho-ERK1/2, anti-phospho-IGF-1Rb (Tyr1135/ 1136) (Cell Signaling Technology, Danvers, MA), ERK1/2 and anti-glutathione S-transferase (Santa Cruz Biotechnology, Santa Cruz, CA). The anti-CC3 antibody was raised in rabbit with a peptide corresponding to resi-dues 291–301 of the GPC3 protein. To determine IGF-1R phosphorylation, 600 lg of cell extract was immunoprecipitated with anti-IGF-1Rb and then blotted with PY20 or blotted with anti-phospho-IGF-1Rb.
Intact cell IGF-1R phosphorylation
Subconfluent cells in 24-well plates were serum starved in serum-free medium for 24 h and then incubated either with or without IGF-II (20 ng/ml) for 5, 15, 30 or 60 min at 37°C. The cells were washed rapidly with ice-cold phosphate-buffered saline then lysed in the lysis buffer (20 mM HEPES N-(Hydroxye-thyl)piperazine-N’-(2-ethanesulfonic acid), pH 7.5, NP40 1%, NaCl 150 mM, NaF 10 mM, glycerol 10%, Na4P2O7 10 mM, sodium vanadate 0.1 mM,
b-glycerol phosphate 2 mM and protease inhibitor cocktail). The amount of phospho-IGF-1 receptor was determined by immunoblotting with anti-phos-pho-IGF-1Rb and then reprobed by anti-IGF-1Rb.
Heparitinase digestion
Cell extract was first immunoprecipitated with anti-CC3. The precipitates were washed for three times with digestion buffer [50 mM HEPES, pH 7.0, 100 mM NaCl, 1 mM CaCl2, 50 lg human albumin, 2 mM phenylmethylsulfonyl fluoride,
5 mM ethylenediaminetetraacetic acid and protease inhibitor cocktail (Roche, Basel, Switzerland)] and treated with 2.5 mU of heparitinase (Seikagaku, Tokyo, Japan) for 2.5 h at 37°C. Western blot analysis was then done using 1G12. RNA interference
For the gpc3 RNA interference, HuH-7 cells were transfected with 1 lg of gpc3 small hairpin RNA (shRNA) (TGCTGTTGACAGTGAGCGACCCAA- CATGCTGCTCAAGAAATAGTGAAGCCACAGATGTATTTCTTGAGCAG-CATGTTGGGCTGCCTACTGCCTCGGA) or an enhanced green fluorescent proteins shRNA (control) in pSM2c vector (purchased from Open Biosystems, Huntsville, AL). For IGF-II RNA interference, chemically synthesized, double-stranded small interfering RNA (siRNA)s, with 19 nt duplex RNA and 2 nt dTdT overhangs were purchased from Ambion. The sequence was sense primer, GGUUCCAUCCCGAAAAUCUtt and antisense primer, AGAUUUUCGGGAUGGAACCtg. The action of IGF-II siRNA was first proved in HEK293 cells. The effect of IGF-II knockdown was done by experi-ments of HuH-7 cell transfection.
Determination of cell growth and colony formation
NIH3T3 cells (1 104) or PLC-PRF-5 stable cells were plated in 35 mm
dishes or 12-well plates in regular medium. On the next day, the cultures were changed to serum-free medium. Viable cells were counted at 48 h intervals. shRNA to gpc3 was performed in HuH-7. HuH-7 cells (1 105) were
trans-fected and plated in six-well plates and then selected with 1 lg/ml puromycin for 14 days. Colonies were visualized by Giemsa stain in HuH-7. For IGF-II interference, chemically synthesized double-stranded siRNA to IGF-II were transfected into 4 104HuH-7 cells according to the manufacturer’s
instruc-tion. On the next day, the cultures were changed to serum-free medium. Cells were counted at 48 h intervals for 6 days.
Soft agar assay
Anchorage-independent growth assay was done on three-layer soft agar in six-well flat-bottomed plates for 30 days. Colonies were then stained with 0.05% p-iodonitrotetrazolium violet and counted by inverted microscopy.
Glutathione S-transferase pull-down assay
The IGF-II complementary DNA, cloned by primers IGF-II-F (CGGGATC-CATGGGAATCCCAATGGGGAA) and IGF-II-ls-R (GGAATTCCTTCC-GATTGCTGGCCATCTCT), was inserted into pGEX4T1 vector for the production of GST-fusion protein. GST-IGF-II was expressed in Escherichia coli and purified. For the pull-down assay, cell extract from pcDNA-gpc3-transfected HEK293T cells was prepared in lysis buffer (10 mM Tris–HCl, pH7.4, 100 mM NaCl and 2.5 mM MgCl2) with 0.1% Triton X-100 and then
incubated with GST-IGF-II at 4°C for 1 h. Proteins bound to the GST beads were analyzed by western blot.
Coimmunoprecipitation detection of the GPC3–IGF-1R complex
HEK293T cells were transfected with pcDNA-gpc3. The transfected cells were lysed in HNTG buffer (20mM Hepes, 100mM sodium chloride, 0.05% triton X-100, 10% glycerol) (35) and precleaned. Immunoprecipitation (IP) was done with anti-CC3, and western blot analysis was done with either anti-IGF-1Rb or 1G12.
Results
Establishment of GPC3-expressing NIH3T3 cell lines
NIH3T3 cells do not have intrinsic GPC3 expression and therefore we
expressed GPC3 in these cells to see if GPC3 could confer additional
phenotypes (36). For the detection of GPC3 and to trace its
posttrans-lational modification, a GFP tag was added to the C-terminus of GPC3
(GPC3-GFP). GPC3 is a glycosyl-phosphatidylinositol-linked heparan
sulfate proteoglycan, and its C-terminal signal sequence will be
re-moved when glycosyl-phosphatidylinositol is added, resulting in a 65
kDa core protein which will be glycanated. The 65 kDa core protein
can be further cleaved by a furin-like convertase into a 40 kDa protein.
After transient transfection with pgpc3-GFP, nascent GPC3 could
be detected by anti-GFP, 1G12, and anti-CC3 (Figure 1A, lanes 2, 4
and 6, arrow), whereas the 65 kDa core protein (arrowhead) and the
glycanated forms (bracket) could be detected by 1G12 and anti-CC3
(lanes 4 and 6). The 40 kDa protein (asterisk) could be detected only
by anti-CC3 (lane 6) (14). Membrane anchoring of the expressed
GPC3 protein was also evident (supplementary Figure, panel B is
available at Carcinogenesis Online). Therefore, the GFP tag did not
interfere with the C-terminal processing of GPC3. After selection with
G418, two stable clones GPC3-60 and GPC3-65 were isolated. gpc3
mRNA was expressed in these positive clones (Figure 1B), and the
expression of GPC3 protein could be detected by IP and heparitinase
digestion (Figure 1C). Since pEGFP-N1 is toxic to the cells, cells
trans-fected with pcDNA3.1 (þ) myc-his were used as vector control (37).
Oncogenecity of the GPC3-expressing NIH3T3 cells
Compared with the parental NIH3T3 cells, GPC3-60 and GPC3-65
cells exhibited large nuclei with frequent multinucleation (Figure 1Da
and b), but grew at a normal speed in regular medium. However, when
cells were grown in serum-free medium, these GPC3-expressing cells
kept on proliferating while the control cells died gradually (Figure
1E). Both GPC3-60 and GPC3-65 cells formed colonies on soft agar
after 30 days of culture (Figure 1F), but the parental NIH3T3 cells or
the vector control cells could not (Table I). Therefore, NIH3T3 cells
gain oncogenecity after the expression of GPC3.
Role of GPC3 in HCC cell oncogenecity
To explore the role of GPC3 in HCC cell oncogenecity, we first
over-expressed GPC3 in GPC3-low-expressing PLC-PRF-5 cells (Figure 2A).
After gaining the expression of GPC3, PLC-PRF-5 cells grew faster
than the parental cells in serum-free medium (Figure 2B). On the
other way, we knocked down GPC3 with shRNA in
GPC3-high-expressing HuH-7 cells (Figure 2C). The results revealed that HuH-7
cells transfected with gpc3 shRNA showed poorer colony formation
than cells transfected with the control shRNA (Figure 2D). These
results indicate that the expression of GPC3 increases the
oncogenec-ity of HCC cells.
GPC3 is associated with IGF-II and IGF-1R through its proline-rich
region
It has been reported that GPC3 binds to IGF-II (19,20). Both NIH3T3
cells and hepatoma cell lines HuH-7 have been shown to produce
IGF-II (38,39). Using reverse transcription–polymerase chain reaction
method, we found that IGF-II expression was high in cell lines
in-cluding NIH3T3 and HuH-7 and was low in the HA22T/VGH cells
(Figure 3A). Therefore, we tested the interactions between GPC3,
IGF-II and IGF-1R (Insulin-like growth factor 1 receptor, one kind
of receptor for IGF-II). In GST pull-down assay, GPC3 expressed in
HEK293T cells could be pulled down by GST-IGF-II (Figure 3B, lane
6). GPC3 contains a proline-rich region located at residues 25–30,
Fig. 1. GPC3 promotes cell growth in NIH3T3 cells. (A) Transient expression of GPC3 in HEK293T cells. Cells were transfected with pgpc3-GFP, and 48 h later, cytosolic extracts were analyzed by western blot using anti-GFP (lanes 1 and 2), 1G12 (lanes 3 and 4) or anti-CC3 (lanes 5 and 6). Molecular weight markers are indicated on the left. The bracket indicates glycanated GPC3 proteins; the arrow indicates the nascent GPC3 protein; the arrowhead indicates the 65 kDa core protein and the asterisk indicates the 40 kDa convertase-cleaved fragment. (B) Reverse transcription–polymerase chain reaction analysis of gpc3 mRNA in stable lines. Lane 1, the parental NIH3T3 cells; lane 2, vector control cells; lane 3, GPC3-60 cells; lane 4, GPC3-65 cells and lane 5, positive control (þ). Mouse actin was served as the RNA loading control. (C) Expression of GPC3 protein in stable lines. Six hundred micrograms of cytosolic extracts were immunoprecipitated with anti-CC3, digested by heparitinase and then blotted with 1G12. Lane 1, the parental cells; lane 2, GPC3-60 cells and lane 3, GPC3-65 cells. The open arrow indicates the GPC3 core protein, and the black arrow indicates the antibody heavy chain. (D) Morphology of the cells. GPC3-60 and GPC3-65 cells revealed increased nucleus-to-cytoplasm (N/C) ratio and multinucleation in Papanicolaou stain (a and b). Parental and vector control cells were shown as a comparison (c and d). (E) Growth rate of the GPC3-expressing cells in serum-free medium. Cells were seeded in 35 mm plates in triplicate and cultured in Dulbecco’s modified Eagle’s medium without serum. Cells were harvested at 48 h intervals and were counted in triplicates. (F) Colony formation in soft agar was observed for GPC3-expressing line GPC3-60 and GPC3-65 (a and b), but not for the parental or vector control cells (c and d).Table I. Anchorage-independent growth of GPC3-expressing NIH3T3 cells
Lines Number of colonies
per platea Sizes of colonies (lm) GPC3-60 46 ± 9b 40 GPC3-65 55 ± 6b 100 NIH3T3 0 — Vector control 0 —
aColonies in soft agar were counted directly using an inverted microscope on
day 30.
which might be important for protein–protein interaction. GPC3
mutated in these prolines (P25-29A), when expressed in cells, could
be localized to the cell surface (supplementary Figure, panel D is
available at Carcinogenesis Online) and glycanated (Figure 3B, lane
4). However, P25-29A did not possess the ability to bind IGF-II
(Figure 3B, lane 8). We next tested the requirement of convertase
digestion for GPC3 interaction with IGF-II. The convertase-resistant
mutant RR / AA revealed cell membrane anchorage (supplementary
Figure, panel C is available at Carcinogenesis Online) and
glycana-tion (Figure 3B, lane 3) (34), but had very low affinity to GST-IGF-II
(Figure 3B, lane 7). Therefore, convertase digestion is required for
GPC3 to interact with IGF-II.
The interaction between GPC3 and IGF-1R was investigated by
co-IP. HEK293T cells were first transfected with pcDNA-gpc3 or
P25-29A and serum starved. IP was performed with anti-CC3. The results
revealed that IGF-1R could be brought down by anti-CC3 (Figure
3C), whereas P25-29A lost the ability to interact with IGF-1R (Figure
3C, lane 4). Therefore, these results indicate that GPC3 has specific
interaction with both IGF-II and IGF-1R.
Phosphorylated IGF-1R interacts with GPC3
Phosphorylation of IGF-1R occurs upon ligation by growth
fac-tors. We then checked if IGF-1R phosphorylation could be
acti-vated by GPC3. In GPC3-expressing NIH3T3 cells, IGF-1R
immunoprecipitated by anti-IGF-1Rb could be detected by PY20
(Figure 4A). It was noted that GPC3 overexpression also
upregu-lated the unphosphoryupregu-lated IGF-1R. Since phosphoryupregu-lated IGF-1R
was present in HuH-7 cells, we checked the status of IGF-1R in
these cells after GPC3 knockdown. The results revealed that both total
and phosphorylated IGF-1R proteins decreased in amount when cells
were treated with gpc3 shRNA (Figure 4B). The mechanism for the
downregulation of total IGF-IR by GPC3 knockdown is not known,
but this phenomenon suggests both the importance and the complexity
of the regulation of the IGF-1R pathway by GPC3.
We next looked for evidence if GPC3 enhances IGF-II-mediated
IGF-1R activation. We transfected GPC3 or its mutants in HEK293
cells and then treated the cells with IGF-II. IGF-II induced IGF-1R
phosphorylation, which peaked at the 30th min in control cells, and the
phosphorylation declined thereafter (Figure 4C, vector). In
pcDNA-gpc3-transfected cells, IGF-II triggered a faster and stronger
phosphor-ylation of IGF-1R and the phosphorphosphor-ylation also sustained longer.
RR / AA or P25-29A either demonstrated a later (RR / AA)
and/or weaker (RR / AA and P25-29A) responses (Figure 4C).
Therefore, GPC3 activates the IGF-signaling pathway in a specific way.
Phosphorylation of ERK by GPC3
Lastly, we checked if GPC3 could activate the downstream
mito-genic pathway. In western blot analysis, the levels of total ERK in
the parental NIH3T3 cells, 12-O-tetradecanoylphorbol 13-acetate
treatment HEK293 cells or GPC3 expression NIH3T3 cells were
equal (Figure 5A). 12-O-tetradecanoylphorbol 13-acetate induced
prominent ERK phosphorylation in HEK293 cells (Figure 5A, lane
2). Phospho-ERK was barely visible in the parental NIH3T3 cells,
but was abundant in GPC3-expressing cell lines GPC3-60 and
Fig. 2. Role of GPC3 in HCC cell oncogenecity. (A) GPC3 expression in PLC-PRF-5 cells. Mixed cultures of stable cell line were obtained by transfecting pgpc3-GFP or vector control into PLC-PRF-5 cells. Cell lysates were analyzed by western blot with 1G12. The bracket indicates glycanated GPC3 proteins; the arrow indicates the nascent GPC3 protein and the arrowhead indicates the 65 kDa core protein. (B) Growth rate of the PLC-PRF-5 stable cells. Cells (1 104) wereseeded in 12-well plates in triplicate and cultured in Dulbecco’s modified Eagle’s medium without serum. Cells were harvested at 48 h intervals and were counted in triplicates. (C) GPC3 knockdown in HuH-7 cells. Cells were transfected with gpc3 shRNA or control vector (shRNA-EGFP), and 48 h later, cell extracts were analyzed by western blot with 1G12. The bracket indicates glycanated GPC3 proteins, and the arrowhead indicates the 65 kDa core protein. (D) Colony-forming assays for HuH-7 cells. Cells were transfected with either shRNA-EGFP (control) or shRNA-GPC3 cells.
GPC3-65 (Figure 5A, lanes 3 and 4). In the GPC3-high-expressing
HuH-7 cells, ERK phosphorylation was high, but phospho-ERK
de-creased when GPC3 was knocked down by gpc3 shRNA (Figure
5B). In the GPC3-low-expressing PLC-PRF-5 and HA22T/VGH
cells, stable expression of GPC3 caused the elevation of
phospho-ERK, but mutants RR / AA or P25-29A had much less effects
(Figure 5C and D). Serum starvation for the HA22T/VGH cells
was done in 0.5% serum because in 0% serum no ERK
phosphory-lation could be seen. This could be due to the low IGF-II expression
in HA22T/VGH cells (Figure 3A).
We further demonstrated that ERK phosphorylation was dependent
on the presence of IGF-II. We first selected a proper IGF-II siRNA by
Fig. 3. GPC3 interacts with IGF-II and IGF-1R. (A) Reverse transcription–polymerase chain reaction analysis of IGF-I and IGF-II gene expressions in different cell lines. Total RNA was isolated from HEK293, HEK293T, PLC-PRF-5, HuH-7, Hep3B, HA22T/VGH and NIH3T3 cells and complementary DNA was synthesized using reverse transcriptase. As a negative control, the same RNAs were incubated in the absence of enzyme in the reverse transcription reaction. Polymerase chain reaction was then done with specific primers. Actin was served as the RNA loading control. (B) Interaction of overexpressed GPC3 proteins with IGF-II. Wild-type GPC3 (WT-GPC3), RR / AA or P25-29A expression plasmid was transfected into HEK293T cells. After serum starvation for overnight, cells were harvested and subjected for GST pull-down assay with either GST-IGF-II or GST and then analyzed by western blot with 1G12. Lanes 1–4 represent 5% of cell extract used in the pull-down experiment (lysate). (C) Interaction between GPC3 and IGF-1R. HEK293T cells were transfected with either pcDNA-gpc3 or P25-29A. The cell lysates were then immunoprecipitated with anti-CC3 or IgG and blotted with anti-IGF-1R or 1G12. Five percent of cell extracts were analyzed in parallel (input). The bracket indicates glycanated GPC3.transfecting HEK293 cells (Figure 5E). In HuH-7 cells treated with
IGF-II siRNA, we could demonstrate that the level of phospho-ERK
decreased (Figure 5F) and those treated cells revealed a decreased
growth speed in serum-free medium (Figure 5G). Therefore, the
ac-tivation of intracellular mitogenic pathway requires the presence of
both IGF-II and GPC3.
Discussion
In this article, we demonstrate that GPC3 can bind to both IGF-II and
IGF-1R through its proline-rich region. GPC3 binding to IGF-II
acti-vates IGF-1R and then triggers a phosphorylation cascade including
IGF-1R itself and ERK. These processes confer oncogenecity to
NIH3T3 and hepatoma cells PLC-PRF-5, whereas the removal of
GPC3 decreases the oncogenecity of HuH-7 cell lines. The
pathogen-esis of HCC has been known to involve p53 (40), b-catenin (41),
TGF-b (42) and the retinoTGF-blastoma gene (43). p53 mutation occurs in
one-third of HCC (40,44); b-catenin mutation is found in 13.1% of
HCC (41) and the activation of canonical Wnt-signaling pathway
happens in 18% of HCC (45). The involvement of GPC3 in HCC is
more recently recognized that overexpression of GPC3 can be found
in 70% of HCC (4). And now in this study, we discover the
mecha-nisms that led to GPC3-mediated oncogenesis.
It is very interesting that GPC3 interacts with both IGF-II and its
receptor IGF-1R.This may suggests that GPC3 joins a multiprotein
complex, which is composed of the ligand, receptor, GPC3, and
prob-ably other proteins. The interaction between the proteins in the
com-plex probably involves heparan sulfate. However, here we showed that
specific protein–protein interaction through the proline-rich region of
the GPC3 protein is also required. Protein–protein interaction through
the multiproline residues has been shown for the histidine proline-rich
glycoprotein (46). Histidine proline-rich glycoprotein is an abundant
plasma protein. It binds with high affinity to FGF-2-stimulated human
umbilical vein endothelial cells and immobilizes tropomyosin via the
histidine proline-rich domain (46). Moreover, proper processing of
GPC3 is required for its function. In the current study, convertase
digestion is necessary for GPC3 to activate the IGF-signaling
pathway. In a previous study, convertase is required for
GPC3-medi-ated regulation of the Wnt-signaling pathway (34). All these data
suggest a specific protein–protein interaction for GPC3 function,
be-sides the non-specific interaction through heparan sulfate.
The activation of IGF-1R and the downstream signaling pathway
well explains the role of GPC3 in oncogenesis. The IGF-signaling
pathway plays a pivotal role in cell growth. Overexpressions of
IGF-II, IGF-1R and insulin receptor substrate-1 have been described in
human cancers (30,47–50). ERK is known to mediate IGF-II-induced
gene expression, cell invasion and apoptosis protection (51,52). ERK
has also been shown to contribute to the multistep
hepatocarcinogen-esis (53). Although GPC3 knockout mice showed no significant
change of IGF-1R or insulin receptor substrate-1 in whole embryo
extracts (54), cell growth in GPC3-transgenic mice is promoted in the
liver (5). Therefore, GPC3 may have a more prominent role in liver
cancers like HCC.
In this study, we not only demonstrate the activation of the
IGF-signaling pathway by GPC3 but also more importantly give a direct
evidence for GPC3-mediated oncogenesis. GPC3 confers NIH3T3
cells a full cancer cell phenotype including the ability to grow in
serum-free medium and to form colonies in soft agar. It is also striking
Fig. 4. GPC3 enhances the IGF-II-triggered IGF-1R phosphorylation. (A) IGF-1R phosphorylation in GPC3-expressing NIH3T3 stable lines. Cells were serum starved and 600 lg of cell extracts were immunoprecipitated with anti-IGF-1Rb, followed by western blot with PY20. IGF-1R was phosphorylated. Twenty micrograms of total cell extracts were analyzed with anti-tubulin as an equal loading control. (B) IGF-1R phosphorylation in HuH-7 cells. Cells were transfected with control or gpc3 shRNA and serum starved. Whole-cell extracts were then subjected to immunoblot with phospho-IGF-1R and then reblotted with anti-IGF-1Rb. Phosphorylated IGF-IR was decreased by gpc3 shRNA in HuH-7 cells. (C) IGF-II-triggered IGF-1R phosphorylation in HEK293 cells. Either wild-type GPC3 (WT-GPC3), RR / AA or P25-29A was expressed in HEK293 cells. Transiently transfected cells were serum starved and then treated with IGF-II (20 ng/ ml) for 5, 15, 30 or 60 min at 37°C, followed by western blot probed with anti-phospho-IGF-1Rb and reprobed with anti-IGF-1R. GPC3 expression was shown in parallel.to see the loss of oncogenecity by knocking down GPC3 by shRNA in
HCC cells. Therefore, GPC3 could be a new target in cancer therapy
in the future.
Supplementary material
Supplementary Figure can be found at http://carcin.oxfordjournals.
org/
Funding
Academia Sinica and National Science Council of the Republic of
China, Taiwan (NSC-90-2311-B-001-199 to Y.M.L.,
NSC94-3112-B-002-018 to H.C.H.); National Health Research Institute
(NHRI-GT-270 EX89B701L) to H.C.H.; Department of Health, Taiwan (9001,
92101 and 93006) to W.C.
Acknowledgements
We thank Dr Wuh-Liang Hwu for critical reading of the manuscript and Mr Sui-Tsun Chen, Ken-Fen Lu and Ms Li-Ping Hsiao for valuable technical assistance.
Conflict of Interest Statement: None declared.
References
1. Befeler,A.S. et al. (2002) Hepatocellular carcinoma: diagnosis and treat-ment. Gastroenterology, 122, 1609–1619.
2. Lodato,F. et al. (2006) Hepatocellular carcinoma prevention: a worldwide emergence between the opulence of developed countries and the eco-nomic constraints of developing nations. World J. Gastroenterol., 12, 7239–7249.
Fig. 5. GPC3 activates ERK phosphorylation. (A) ERK phosphorylation in GPC3-expressing NIH3T3 stable lines. Cells were serum starved for 24 h. Forty micrograms of cell extracts were analyzed by western blot with either anti-phospho-ERK or anti-ERK antibody. Whole-cell extracts from
12-O-tetradecanoylphorbol 13-acetate-treated HEK293 cells (lane 2) were used as a positive control. (B) ERK phosphorylation in GPC3-knocked-down HuH-7 cells. shRNA was transiently transfected into HuH-7 cells. After serum starvation, 35 lg cell extracts were subjected for western blot analysis with anti-phospho-ERK, anti-ERK, 1G12 or anti-actin. ERK phosphorylation decreased after GPC3 knockdown. (C) ERK phosphorylation in PLC-PRF-5 cells. Cells were stably transfected with p gpc3-GFP (GPC3) or control vector (vector) and serum starved for 24 h. Cell extracts were analyzed with either anti-phospho-ERK or anti-ERK. (D) ERK phosphorylation in HA22T/VGH cells. Cells were stably transfected with pcDNA-gpc3 [wild-type GPC3 (WT-GPC3)], RR / AA, P25-29A or control vector (vector) and serum starved at 0.5% fetal calf serum for 24 h. Cell extracts were immunobloted with either anti-phospho-ERK, anti-ERK or 1G12. (E) IGF-II knockdown by siRNA (siIGF-II). Chemically synthesized, double-stranded siRNAs for IGF-II and control were transfected into HEK293 cells. Total RNA was extracted and analyzed by reverse transcription–polymerase chain reaction. Specific primers for IGF-II were used in polymerase chain reaction and actin was served as the RNA loading control. (F) ERK phosphorylation was decreased by IGF-II knockdown. HuH-7 cells were transfected with either control or IGF-II siRNA and serum starved. Cell extracts were analyzed with either anti-phospho-ERK or anti-ERK. (G) Growth rate of HuH-7 cells after IGF-II knockdown. Cells were seeded in 12-well plates in triplicate, transfected with either control or IGF-II siRNA and were serum starved. Cells were harvested at 48 h intervals.
3. Thorgeirsson,S.S. et al. (2002) Molecular pathogenesis of human hepato-cellular carcinoma. Nat. Genet., 31, 339–346.
4. Hsu,H.C. et al. (1997) Cloning and expression of a developmentally regu-lated transcript MXR7 in hepatocellular carcinoma: biological significance and temporospatial distribution. Cancer Res., 57, 5179–5184.
5. Capurro,M.I. et al. (2005) Glypican-3 promotes the growth of hepatocel-lular carcinoma by stimulating canonical Wnt signaling. Cancer Res., 65, 6245–6254.
6. Lage,H. et al. (1998) Expression of the novel mitoxantrone resistance associated gene MXR7 in colorectal malignancies. Int. J. Clin. Pharmacol. Ther., 36, 58–60.
7. Hishinuma,M. et al. (2006) Hepatocellular oncofetal protein, glypican 3 is a sensitive marker for alpha-fetoprotein-producing gastric carcinoma. His-topathology, 49, 479–486.
8. Toretsky,J.A. et al. (2001) Glypican-3 expression in Wilms tumor and hepatoblastoma. J. Pediatr. Hematol. Oncol., 23, 496–499.
9. Nakatsura,T. et al. (2004) Identification of glypican-3 as a novel tumor marker for melanoma. Clin. Cancer Res., 10, 6612–6621.
10. Zynger,D.L. et al. (2006) Glypican 3: a novel marker in testicular germ cell tumors. Am. J. Surg. Pathol., 30, 1570–1575.
11. Stadlmann,S. et al. (2007) Glypican-3 expression in primary and recurrent ovarian carcinomas. Int. J. Gynecol. Pathol., 26, 341–344.
12. Xiang,Y.Y. et al. (2001) Glypican-3 expression is silenced in human breast cancer. Oncogene, 20, 7408–7412.
13. Lin,H. et al. (1999) Frequent silencing of the GPC3 gene in ovarian cancer cell lines. Cancer Res., 59, 807–810.
14. Filmus,J. et al. (1995) Identification of a new membrane-bound heparan sulphate proteoglycan. Biochem. J., 311, 561–565(Pt 2).
15. Jackson,R.L. et al. (1991) Glycosaminoglycans: molecular properties, protein interactions, and role in physiological processes. Physiol. Rev., 71, 481–539. 16. Lander,A.D. (1994) Targeting the glycosaminoglycan-binding sites on
pro-teins. Chem. Biol., 1, 73–78.
17. Lin,X. et al. (1999) Heparan sulfate proteoglycans are essential for FGF receptor signaling during Drosophila embryonic development. Develop-ment, 126, 3715–3723.
18. LaRochelle,W.J. et al. (1999) Heparan sulfate proteoglycan modulates ker-atinocyte growth factor signaling through interaction with both ligand and receptor. Biochemistry, 38, 1765–1771.
19. Pilia,G. et al. (1996) Mutations in GPC3, a glypican gene, cause the Simpson-Golabi-Behmel overgrowth syndrome. Nat. Genet., 12, 241–247. 20. Xu,Y. et al. (1998) Developmental regulation of the soluble form of insulin-like growth factor-II/mannose 6-phosphate receptor in human serum and amniotic fluid. J. Clin. Endocrinol. Metab., 83, 437–442.
21. Pietrzkowski,Z. et al. (1993) Inhibition of growth of prostatic cancer cell lines by peptide analogues of insulin-like growth factor 1. Cancer Res., 53, 1102–1106.
22. Baserga,R. (1994) Oncogenes and the strategy of growth factors. Cell, 79, 927–930.
23. Resnicoff,M. et al. (1995) The insulin-like growth factor I receptor protects tumor cells from apoptosis in vivo. Cancer Res., 55, 2463–2469. 24. Kaleko,M. et al. (1990) Overexpression of the human insulinlike growth
factor I receptor promotes ligand-dependent neoplastic transformation. Mol. Cell. Biol., 10, 464–473.
25. Resnicoff,M. et al. (1994) Rat glioblastoma cells expressing an antisense RNA to the insulin-like growth factor-1 (IGF-1) receptor are nontumorigenic and induce regression of wild-type tumors. Cancer Res., 54, 2218–2222. 26. Scharf,J.G. et al. (2001) The IGF axis and hepatocarcinogenesis. Mol.
Pathol., 54, 138–144.
27. Cariani,E. et al. (1988) Differential expression of insulin-like growth factor II mRNA in human primary liver cancers, benign liver tumors, and liver cirrhosis. Cancer Res., 48, 6844–6849.
28. Nardone,G. et al. (1996) Activation of fetal promoters of insulinlike growth factors II gene in hepatitis C virus-related chronic hepatitis, cirrhosis, and hepatocellular carcinoma. Hepatology, 23, 1304–1312.
29. Scharf,J.G. et al. (2000) Analysis of the IGF axis in preneoplastic hepatic foci and hepatocellular neoplasms developing after low-number pancreatic islet transplantation into the livers of streptozotocin diabetic rats. Lab. In-vest., 80, 1399–1411.
30. Tanaka,S. et al. (1997) Biological effects of human insulin receptor sub-strate-1 overexpression in hepatocytes. Hepatology, 26, 598–604.
31. Nishiyama,M. et al. (1992) Cloning and increased expression of an insulin receptor substrate-1-like gene in human hepatocellular carcinoma. Bio-chem. Biophys. Res. Commun., 183, 280–285.
32. Lin,Y.M. et al. (1982) [A new human hepatoma cell line: establishment and characterization]. Zhonghua Min Guo Wei Sheng Wu Ji Mian Yi Xue Za Zhi, 15, 193–201.
33. Nakabayashi,H. et al. (1982) Growth of human hepatoma cells lines with differentiated functions in chemically defined medium. Cancer Res., 42, 3858–3863.
34. De Cat,B. et al. (2003) Processing by proprotein convertases is required for glypican-3 modulation of cell survival, Wnt signaling, and gastrulation movements. J. Cell Biol., 163, 625–635.
35. Vecchione,A. et al. (2003) The Grb10/Nedd4 complex regulates ligand-induced ubiquitination and stability of the insulin-like growth factor I re-ceptor. Mol. Cell. Biol., 23, 3363–3372.
36. Ruddon,R.W. (1995) Cancer Biology. Oxford University Press, Inc. 37. Liu,H.S. et al. (1999) Is green fluorescent protein toxic to the living cells?
Biochem. Biophys. Res. Commun., 260, 712–717.
38. Arbuthnot,P.B. et al. (1996) In vitro and in vivo hepatoma cell-specific expression of a gene transferred with an adenoviral vector. Hum. Gene Ther., 7, 1503–1514.
39. Abdallah,B.M. (2006) Osteoblast differentiation of NIH3T3 fibroblasts is associated with changes in the IGF-I/IGFBP expression pattern. Cell. Mol. Biol. Lett., 11, 461–474.
40. Hsu,H.C. et al. (1993) Expression of p53 gene in 184 unifocal hepatocel-lular carcinomas: association with tumor growth and invasiveness. Cancer Res., 53, 4691–4694.
41. Hsu,H.C. et al. (2000) Beta-catenin mutations are associated with a subset of low-stage hepatocellular carcinoma negative for hepatitis B virus and with favorable prognosis. Am. J. Pathol., 157, 763–770.
42. Kitisin,K. et al. (2007) Disruption of transforming growth factor-beta sig-naling through beta-spectrin ELF leads to hepatocellular cancer through cyclin D1 activation. Oncogene, 26, 7103–7110.
43. Zhang,X. et al. (1994) Deletions of chromosome 13q, mutations in Reti-noblastoma 1, and retiReti-noblastoma protein state in human hepatocellular carcinoma. Cancer Res., 54, 4177–4182.
44. Hsu,H.C. et al. (1994) Mutations of p53 gene in hepatocellular carcinoma (HCC) correlate with tumor progression and patient prog-nosis: a study of 138 patients with unifocal HCC. Int. J. Oncol., 4, 1341– 1347.
45. Giles,R.H. et al. (2003) Caught up in a Wnt storm: Wnt signaling in cancer. Biochim. Biophys. Acta, 1653, 1–24.
46. Guan,X. et al. (2004) Histidine-proline rich glycoprotein (HPRG) binds and transduces anti-angiogenic signals through cell surface tropomyosin on endothelial cells. Thromb. Haemost., 92, 403–412.
47. Caro,J.F. et al. (1988) Insulin-like growth factor I binding in hepatocytes from human liver, human hepatoma, and normal, regenerating, and fetal rat liver. J. Clin. Invest., 81, 976–981.
48. Scharf,J.G. et al. (1998) Characterization of the insulin-like growth factor axis in a human hepatoma cell line (PLC). Carcinogenesis, 19, 2121–2128.
49. Su,Q. et al. (1994) Expression of insulin-like growth factor II in hepatitis B, cirrhosis and hepatocellular carcinoma: its relationship with hepatitis B virus antigen expression. Hepatology, 20, 788–799.
50. Werner,H. et al. (1996) The role of the insulin-like growth factor system in human cancer. Adv. Cancer Res., 68, 183–223.
51. Kim,H.J. et al. (2004) IGF-II-mediated COX-2 gene expression in human keratinocytes through extracellular signal-regulated kinase pathway. J. In-vest. Dermatol., 123, 547–555.
52. Sciacca,L. et al. (2002) In IGF-I receptor-deficient leiomyo-sarcoma cells autocrine IGF-II induces cell invasion and protection from apoptosis via the insulin receptor isoform A. Oncogene, 21, 8240– 8250.
53. Ito,Y. et al. (1998) Activation of mitogen-activated protein kinases/extra-cellular signal-regulated kinases in human hepatokinases/extra-cellular carcinoma. Hep-atology, 27, 951–958.
54. Song,H.H. et al. (2005) The loss of glypican-3 induces alterations in Wnt signaling. J. Biol. Chem., 280, 2116–2125.
Received October 1, 2007; revised March 24, 2008; accepted March 26, 2008 W.Cheng et al.
