In vivo immobilization of D-hydantoinase in Escherichia coli Shan-Yu Chen1*, Yi-Wen Chien1, and Yun-Peng Chao2,3,4* 1 Graduate School of Biotechnology and Bioengineering, Yuan Ze University,
Taouyan 32003, Taiwan
2Department of Chemical Engineering, Feng Chia University,
100 Wen-Hwa Road, Taichung 40724, Taiwan
3Department of Health and Nutrition Biotechnology, Asia University, Taichung
41354, Taiwan
4Department of Medical Research, China Medical University Hospital, Taichung
40447, Taiwan
_________________________________ *Correspondence addressed to:
Dr. Shan-Yu Chen
E-mail: [email protected] TEL: 886-3-4638800 Ext. 2188 FAX: 886-3-4334667
Keywords: In vivo immobilization; D-hydantoinase; polyhydroxyalkanoate Running title: In vivo immobilization of D-hydantoinase
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29
ABSTRACT
D-p-Hydroxyphenylglcine (D-HPG) is a precursor required for the synthesis of semi-synthetic antibiotics. This unnatural amino acid can be produced by a transformation reaction mediated by hydantoinase (HDT) and D-amidohydrolase. In this study, a method was developed to integrate production and immobilization of recombinant D-HDT in vivo. This was approached by first fusion of the gene encoding D-HDT with phaP (encoding phasin) of Ralstonia eutropha H16. The fusion gene was then expressed in the Escherichia coli strain that carried a heterologous synthetic pathway for polyhydroxyalkanoate (PHA). As a result, D-HDT was found to associate with isolated PHA granules. Further characterization illustrated that D-HDT immobilized on PHA exhibited the maximum activity at pH 9 and 60oC and had a half-life of 95 h at 40oC. Moreover, PHA-bound D-HDT could
be reused for 8 times with the conversion yield exceeding 90%. Overall, it illustrates the feasibility of this approach to facilitate in vivo immobilization of enzymes in heterologous E. coli strain, which may open a new avenue of enzyme application in industry.
INTRODUCTION
The yearly sale of antibiotics accounts for 15% of the medicine market worldwide. The -lactam antibiotics, such as cephalosporin, penicillin and amoxicillin, are the most widely used group of drugs for treatment of bacterial infections. In particular, amoxicillin exhibits a superior adsorption to other -lactam antibiotics and is the most commonly prescribed antibiotic for children. D-p-Hydroxyphenylglcine (D-HPG) is an unusual amino acid of the optical purity and the precursor required for the synthesis of amoxicillin (1).
HPG can be produced by a biotransformation reaction catalyzed by D-30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67
hydantoinase (D-HDT) and D-amidohydrolase (D-AHL). D-HDT (E.C. 3.5.2.2) catalyzes the ring opening of D,L-hydroxyphenly hydantoin (DL-HPH) to yield N-carbamoyl-p-hydroxy phenylglycine (CpHPG). CpHPG is then hydrolyzed to D-HPG by D-AHL (2). D-HDT can be found in a variety of microorganisms but its physiological function is unclear (3, 4). Many researches have focused on the immobilization of D-HDT to produce D-amino acids of commercial values. The major strength of immobilized enzymes is to facilitate reuse of enzymes, which greatly reduces the production cost. The method of enzyme immobilization is generally classified into two main categories, including entrapment and surface fixation. D-HDT has been successfully immobilized on various polymeric carriers, such as DEAE-cellulose resins (5), chitin beads (6), polystyrene anion exchange resins (7), and polyglutaraldehyde (PGL) particles (8). Each immobilization carrier has its own advantages and disadvantages, and the choice of an appealing carrier depends on the characteristic of enzymes to be immobilized (9).
Recently, a study has reported in vivo immobilization of the reporter enzyme -galactosidase on polyhydroxyalkanoate (PHA) in Pseudomonas putida GPo1 (10). Known as bioplastics, PHA is produced in many bacteria and accumulated as insoluble granules in cell cytoplasm when the environment is unfavorable for the bacterial growth (11). The core of the polymeric granules is composed of high-molecular weight PHA surrounded by a phospholipid membrane into which membrane proteins are embedded. Phasin is the predominant membrane-associated protein with low molecular weight and plays an important role in the PHA synthesis and the granule formation (12). In addition, it has a high affinity towards PHA granules and can stabilize PHA granules by generating a hydrophilic interphase between the cytoplasm and the hydrophobic core of polymers (13). These remarkable features seem to make phasin appealing as an anchor motif to confine passenger enzymes on PHA granules. However, this phasin-based immobilization
system has not been explored for practical applications of enzymes.
In this study, the phasin-based immobilization platform was developed to confine D-HDT on PHA granules in Escherichia coli, a workhorse of biotechnology. This approach is attractive since production and immobilization of recombinant D-HDT could be achieved in one step in vivo, which simplifies the protein immobilization procedure. To do so, the gene encoding D-HDT was first fused with phaP (encoding phasin) of Ralstonia eutropha H16. Meanwhile, the heterologous PHA synthetic pathway from R. eutropha H16 was reconstructed in E.
coli. The fusion gene was then expressed in the strain carrying the PHA synthetic
pathway. As a result, D-HDT was found to associate with PHA granules that were 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105
isolated from the producer strain. Further characterization illustrated that D-HDT immobilized on PHA exhibited thermal stability and could be used repeatedly for
the DL-HPH conversion reaction.
MATERIALS AND METHODS
Strains and gene cloning Enzymes used for gene cloning were obtained from Fermentas Co. (MA, USA) while chemicals were mainly purchased from Sigma Co. (MO, USA). Plasmid pTrc15 was derived from plasmid pTrc99A (14) with the pMB1 origin replaced by p15A origin. The phaP gene of R. eutropha H16 was amplified by polymerase chain reaction (PCR) with primers P1 (TTCCATGGTCCTCACCCCGGAACAAG) and P2 (TTCAGGGTACCGGCAG-CCGTCGTCTTCTTTG). After digestion with NcoI-KpnI, the PCR product was subcloned into plasmid pTrc15 to obtain plasmid pTrc-PhaP. Meanwhile, the gene encoding D-HDT from plasmid pChHDT (6) was amplified by PCR with primers P3
(GCATCTCTAGAATGGATATCATCATCAAGAACG) and P4
(GCTGCAAGCTT- ATTGCTTGTATTTGCGGCGCTTC). The PCR DNA was cleaved by XbaI-HindIII and then incorporated into plasmid pTrc-PhaP to give plasmid pTrc-PhaP-Hdt. Finally, the gene encoding D-HDT was amplified by PCR with primers P5 (TCTACCATGGATATCATCATCAAGAACG) and P6 (CTGCGGTACCTTGC- TTGTATTTGCGGCGCTTC). The resulting PCR DNA was used to replace the phaP gene of plasmid PhaP, resulting in plasmid
pTrc-HDT.
Bacterial culturing The plasmid-bearing strains were pre-cultured in shake flasks containing LB medium at 37oC and 200 rpm overnight. The overnight cultures
were seeded into Erlenmyer flasks (500 mL) containing 50 mL LB (15) medium with 20 g/L glucose. The seeded cultures were grown at 30oC and bacterial growth
was monitored by measuring the optical density at 600 nm (OD600) with a
spectrophotometer (Hitachi model U-2001, Japan). Unless stated otherwise, 0.1 mM IPTG and 1 g/L L-arabinose were added to induce production of PHA and recombinant D-HDT upon OD600 reaching 0.5. Bacterial cells were harvested by
centrifugation after 48-h cultivation. Harvested cells were resuspended in 50 mM Tris–HCl buffer (pH 8.0) and then disrupted by French press at 12000 lb/in2.
Followed by centrifugation, the supernatant fraction was collected as cell-free extract (CFX). To provide the selective pressure, antibiotics were added with the following concentrations: chloramphenicol (25 g/mL) and/or ampicillin (50
g/mL). 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143
D-HDT activity assay The D-HDT activity was determined essentially following our reported method (6). In brief, the enzyme reaction was carried out by adding CFX (2 mg/mL) to the 5-mL reaction solution that contained 10 g/L DL -HPH, 0.5 mM MnCl2, and 0.1M Tris-HCl buffer (pH 8.0). The reaction was
conducted at 40oC for 20 min and quenched by heating at 85oC for 10 min. The
product (CpHPG) concentration was then measured by high performance liquid chromatography (HPLC) equipped with a UV detector (Hitachi Model L2490, Japan). The HPLC analysis was carried out using a LiChrospher RP-18e column (Merck, Germany) at 280 nm. The mobile phase consisted of methanol and 2 mM ammonium acetate at a volumetric ratio of 9:91. The flow rate of mobile phase was 0.7 mL/min at 30oC. The unit (U) of enzyme activity was defined as mole of
CpHPG produced per min.
Isolation of PHA granules Harvested cells (40 mg dry cell weight) were placed in a screwcapped tube containing 2 mL 1,2-dichloromethane and 2 mL acidified propanol (20% (v/v) HCl) and incubated at 100oC for 4 h. After cooling
down, 2 mL demineralized water was added into the tube. The organic phase containing CFX was removed for further analysis. CFX (5 mL) was loaded onto a glycerol gradient (90% and 60% (v/v)) and subjected to centrifugation for 4 h at 20000 × g and 4oC. PHA granules were then recovered from the white layer between
90% and 60% glycerol zones. Finally, PHA granules were washed twice with Tris-HCl buffer (pH 8.0) and centrifuged at 20000 × g for 30 min at 4oC. Isolated PHA
granules were stored in Tris-HCl buffer until use.
Repeated conversion reaction by immobilized D-HDT The reaction solution consisted of 10 g/L DL-HPH, 0.5 mM MnCl2, and 0.1 M Tris-HCl buffer (pH 8.0).
The conversion reaction was conducted by adding 10 g/L immobilized D-HDT to the reaction solution (5 mL) at 40oC for 20 min. The reaction was then quenched by
heating at 85oC for 10 min. Followed by centrifugation, immobilized D-HDT was
recovered and the CpHPG concentration in the solution was determined by HPLC. Recovered D-HDT was subsequently implemented to start another reaction cycle. The reaction cycle was repeated following the above procedure.
Analytical methods CFX and cell pellets were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) as reported previously (16). In brief, isolated PHA granules (0.1 g) were pretreated with 0.15% (v/v) triton X-100 overnight at room temperature. After centrifugation, the soluble fraction was 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181
collected and the protein concentration was determined by Bradford assay using bovine serum albumin as the protein standard. The protein samples of 20 g were used for the SDS-PAGE analysis. Meanwhile, the PHA content was analyzed by gas chromatography equipped with a flame ionization detector (Thermo Model L2130, USA). He was used as the carrier gas and the column (0.53 mm in inner diameter and 15 m in height) was packed with Porapak Q. The temperature of the capillary column was initially set at 80oC and increased to 200oC at a rate of 30oC/min. The
injection temperature was set at 160oC. Benzoic acid was used as an internal
standard to calculate the amount of PHA.
RESUTLS AND DISCUSSION
In vivo immobilization of D-HDT on PHA granules The approach to
immobilize D-HDT on PHA granules in vivo was carried out as follows. Plasmid pTrc-PhaP-Hdt was first constructed to carry the C-terminal fusion of phaP (encoding phasin) with the D-HDT-encoded gene. E. coli DH5 strain harboring plasmid pTrc-PhaP-Hdt (DH5/pTrc-PhaP-Hdt) was then grown and induced by IPTG for production of the fusion protein (PhaP-HDT). The functional expression of the fusion protein in the strain was confirmed by the D-HDT activity assay. The apparent molecular mass of PhaP-HDT was estimated as 77 kDa by the SDS-PAGE analysis. This is consistent with the molecular weight of PhaP (25 kDa) plus D-HDT
(52 kDa).
Next, the heterologous synthetic pathway for PHA was introduced into strain DH5/pTrc-PhaP-Hdt by transformation with plasmid pSY11 (provided by Dr. P. C. Soo). Plasmid pSY11 carries the phaBAC operon from R. eutropha H16 under the control of the araBAD promoter. The resulting strain (DH5/pSY11/pTrc-PhaP-Hdt) was cultured and induced by IPTG and L-arabinose. After culturing for 48 h, the strain was harvested and processed for isolation of PHA granules. In parallel, strain with plasmid pSY11 (DH5/pSY11) was used as a control. As shown in Fig. 1, a protein (77 kDa) was identified to associate with PHA granules that were isolated from strain DH5/pSY11/pTrc-PhaP-Hdt (lane 2). After treating PHA granules with Triton X-100, the associated protein was released to the solution (lane 4). The released protein exhibited the D-HDT activity as determined. In contrast, this associated protein was absent in PHA granules that were recovered from control strain DH5/pSY11 (lanes 1 and 3). Taken together, the result indicates that D-HDT fused with PhaP is confined on PHA granules in vivo.
In vivo immobilization of a fusion passenger protein via phasin on PHA
granules is first illustrated in the nature PHA producer strain P. putida GPo1 (10). This study identifies the N-terminal domain of the PhaF phasin from P. putida GPo1 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219
as a binding tag to anchor the fusion -galactosidase to PHA granules. A later study reports that either green fluorescent protein or -galactosidase fused with R.
eutropha H16 phasin can intracellularly target to triacylglycerol (TAG) in
actinomycetes Rhodococcus opacus PD630 and Mycobacterium smegmatis mc2 155
(17). Unlike the PhaF phasin, R. eutropha H16 phasin lacks the binding motif. It suggests that R. eutropha H16 phasin targets to its cognate PHA inclusions via the interaction with the interphase between the membrane and the inclusions or/and the hydrophobic patch of the core (17). Nevertheless, these studies present a poof-of-concept approach using reporter proteins and the usefulness of the phasin-based immobilization system remains illusive. In the current study, we show that in vivo immobilization of D-HDT fused with R. eutropha H16 phasin on PHA inclusions is feasible in the heterologous strain E. coli. This result implies that the in vivo enzyme immobilization system based on phasin is not strain-dependent and has a practical application.
Optimal condition for production of immobilized D-HDT The production of PHA and PhaP-HDT is individually regulated in response to L-arabinose and IPTG levels in strain DH5/pSY11/pTrc-PhaP-Hdt. It would be intriguing to investigate the optimal condition for production of immobilized D-HDT in vivo. Therefore, the strain was cultured in a similar fashion and induced at various levels of L-arabinose and IPTG. As summarized in Table 1, immobilized D-HDT in terms of the enzyme activity reached the optimum at the PHA content ranging 6-37%. D-HDT expressed in E. coli is known to be prone to aggregates (18). The soluble level of the PhaP-HDT fusion protein was found low as well. Therefore, the amount of PhaP-HDT confined on PHA granules likely saturates and, consequently, is not increased with the increasing PHA content. Moreover, the activity of immobilized D-HDT began to decrease when the PHA content in the bacterial strain exceeded 37% (Table 1). This can be reasoned that more resources are driven to the PHA
synthesis, thus restricting the production of PhaP-HDT.
Effect of pH and temperatures on immobilized D-HDT It was informative to investigate the effect of physical conditions on immobilized D-HDT. Therefore, the activity of D-HDT immobilized on PHA granules was determined at various pH and temperatures. The pH ranging between 6 and10 was chosen for study due to the limited substrate (DL-HPH) solubility. As depicted in Fig. 2A, both immobilized and free D-HDT exhibited a similar response to the change in pH and obtained a maximum activity at pH 9. The activity of D-HDT in both forms decreased drastically when pH deviated away from the optimal pH. In addition, the activity of 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257
immobilized D-HDT increased with increasing temperatures and reached the maximum at 60oC (Fig. 2B). In contrast, the activity of free D-HDT decreased
gradually from 40oC to 55oC and dropped sharply when the temperature exceeded
55oC. The result suggests that D-HDT immobilized on PHA granules is resistant to
high temperatures.
The thermal stability of immobilized D-HDT was further investigated by constantly incubating the enzyme at 40oC. The enzyme activity was determined at
the indicated time interval time. As shown in Fig. 3, immobilized D-HDT remained substantially stable within 60-h incubation and its half-life was estimated to reach 95 h. In sharp contrast, free D-HDT decreased its activity along the incubation time and had a half-life around 37 h. This result clearly indicates that D-HDT immobilized on PHA granules displays a higher thermal stability than its free counterpart. Indeed, the enzyme immobilization method based on PHA inclusions is a reminiscence of that by artificial oil bodies (19). AOBs and PHA share a similar structure but the former constitutes of the TAG core instead of the polyester core. As reported, endoglucanase CelA of Clostridium thermocellum fused with oleosin is immobilized on AOBs and also exhibits higher thermal stability (20). The reason is ascribed to the likely interaction of the anchored protein with the lipid membrane of AOBs, thus leading to an increase in the protein integrity (20). A similar effect may also contribute to thermal stability of the PHA-bound D-HDT.
Repeated use of immobilized D-HDT Enzyme reuse is known to be one advantage of immobilized enzymes. Therefore, D-HDT immobilized on PHA granules was investigated for its usefulness for the repeated reaction. The conversion reaction was initiated by adding immobilized D-HDT to the reaction solution containing DL-HPH. At the end of each reaction cycle, immobilized D-HDT was recovered and re-introduced to start a new reaction cycle. Consequently, a conversion yield exceeding 90% could be obtained by immobilized D-HDT that was recycled for 8 times (Fig. 4). At the 12th cycle, the conversion yield dropped to below 50%. The decrease in the conversion yield might be attributed to protein deactivation, protein damage, and/or physical loss of the PHA-bound protein.
In summary, the approach by enzyme immobilization appears to be the most common practice in industry. Many useful strategies have been developed so far (9). Most of applications generally require the production of and purification of proteins prior to protein immobilization, which is a labor-intensive task. In this study, a method based on PHA granules was proposed to integrate the production and immobilization of enzymes in one step. As illustrated here, a heterologous E. coli strain could be engineered to couple production of PHA and the phasin-fused D-258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295
HDT. This approach enables one-step immobilization of D-HDT on PHA inclusion and is facile to operate without the need for protein processing. Moreover, PHA severing as the immobilization matrix displays fluid flexibility and can be recovered in a simple way. Overall, this study indicates that this approach may open a new avenue for enzyme immobilization in industry.
ACKNOWLEDGMENTS
The authors like to acknowledge Dr. Po-Chi Soo at Tzu Chi University for provision of plasmid pSY11. This work is supported by Taiwan National Science Council (grant no. NSC 98-2221-E-155-024-).
References
1. Syldatk, C., Läufer, A., Müller, R., and Höke, H.: Production of optically pure d- and l-α-amino acids by Bioconversion of d,l-5-monosubstituted hydantoin derivatives, p 29-75. In Fiechter, A. (ed.), Advances in Biochemical Engineering/Biotechnology, vol. 41, Springer, Berlin (1990).
2. Olivieri, R., Fasctti, E., Angelini, L., and Degen, L.: Microbial transformation of racemic hydantoins to D-amino acids. Biotechnol Bioeng, 23,
2173-2183 (1981).
3. Chao, Y. P., Chiang, C. J., Chern, J. T., and Tzen, J. T. C.: Hydantoinase, p 599-606. In Polaina, J. and MacCabe, A. P. (ed.), Industrial Enzymes, Springer,
Dordrecht, The Netherlands (2007).
4. Mei, Y., He, B., Liu, N., and Ouyang, P.: Screening and distributing features of bacteria with hydantoinase and carbamoylase. Microbiol Res, 164, 322-329 (2009).
5. Lee, D. C., Lee, S. G., and Kim, H. S.: Production of d-p-hydroxyphenylglycine from d,l-5-(4-hydroxyphenyl)hydantoin using immobilized thermostable d-hydantoinase from Bacillus stearothermophilus
SD-1. Enzyme Microb Technol, 18, 35-40 (1996).
6. Chern, J. T. and Chao, Y. P.: Chitin-binding domain based immobilization of D-hydantoinase. J Biotechnol, 117, 267-275 (2005).
7. Jia, H. H., Ni, F., Chen, M. J., Zhou, H., Wei, P., and Ouyang, P. K.: The immobilization of d-hydantoinase and characterization under classic condition and microwave irradiation. J. Mol. Catal. B: Enzyme, 43, 74-79 (2006).
8. Fan, C. H. and Lee, C. K.: Purification of d-hydantoinase from adzuki bean and its immobilization for N-carbamoyl- d-phenylglycine production. Biochem
Engi J, 8, 157-164 (2001). 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333
9. Cao, L.: Carrier-bound immobilized enzymes: principles, application and design. Wiley-VCH Verlag GmbJ & Co. KGaA, Weinheim (2006).
10. Moldes, C., García, P., García, J. L., and Prieto, M. A.: In vivo immobilization of fusion proteins on bioplastics by the novel tag bioF. Appl Environ Microbial, 70, 3205-3212 (2004).
11. Poirier, Y., Nawrath, C., and Somerville, C.: Production of polyhydroxyalkanoates, a family of biodegradable plastics and elastomers, in
bacteria and plants. Biotechnol (N Y), 13, 142-150 (1995).
12. Pötter, M., Madkour, M. H., Mayer, F., and Steinbüchel, A.: Regulation of phasin expression and polyhydroxyalkanoate (PHA) granule formation in
Ralstonia eutropha H16. Microbiol, 148, 2413-2426 (2002).
13. Jurasek, L. and Marchessault, R. H.: The role of phasins in the morphogenesis of poly(3-hydroxybutyrate) granules. Biomacromolecules, 3, 256-261 (2002).
14. Amann, E., Ochs, B., and Abel, K. J.: Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli.
Gene, 69, 301-315 (1988).
15. Miller, J. H.: Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1972).
16. Chiang, C. J., Lin, S. C., Lin, L. J., and Chao, Y. P.: Caleosin-assembled oil bodies as a potential delivery nanocarrier. Appl Microbiol Biotechnol, 93, 1905-1915 (2012).
17. Hänisch, J., Wältermann, M., Robenek, H., and Steinbüchel, A.: The
Ralstonia eutropha H16 phasin PhaP1 is targeted to intracellular triacylgcerol
inclusions in Rhodococcus opacus PD630 and Mycobacterium smegmatis mc2155, and provides an anchor to target other proteins. Microbiol, 152,
3271-3280 (2006).
18. Chao, Y. P., Chiang, C. J., Lo, T. E., and Fu, H.: Overproduction of D-hydantoinase and carbamoylase in a soluble form in Escherichia coli. Appl Biochem Biotechnol, 54, 348-353 (2000).
19. Chiang, C. J., Chen, P. T., Yeh, C. Y., Wang, Z. W., and Chao, Y. P.: A useful method integrating production and immobilization of recombinant cellulase. Appl Microbiol Biotechnol, 97, 9185-9192 (2013).
20. Chiang, C. J., Chen, P. T., Yeh, C. Y., and Chao, Y. P.: Statistical optimization of one-step immobilization process for recombinant endoglucanase from Clostridium thermocellum. Proc Biochem, 47, 2246-2254 (2013). 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371
Figure legends
FIG. 1. SDS-PAGE analysis of PHA granules before and after treatment with Triton X-100 (0.15%, w/v). Keys: M, protein marker; lane 1, PHA granules from strain DH5α/pSY11; lane 2, PHA granules from strain DH5α/pSY11/pTrc-phaP-hdt ; lane 3, PHA granules from strain DH5α/pSY11 treated with Triton X-100; lane 4, PHA granules from strain DH5α/pSY11/pTrc-phaP-hdt treated with Triton X-100. The position of the released PhaA-HDT fusion protein is indicated by an arrow.
FIG. 2. (A) Effect of pH on D-HDT. The activity of D-HDT was determined at indicated pH and 40oC. Free D-HDT was obtained following our previous report. (B)
Effect of temperatures on D-HDT. The activity of D-HDT was determined at indicated temperatures and pH 9. The relative enzyme activity was calculated by dividing each enzyme activity by the maximum.
FIG. 3. Thermal stability of D-HDT. Both free and immobilized D-HDT were incubated in the reaction buffer solution at 40oC. The D-HDT activity was measured
during the time intervals. The relative enzyme activity was calculated by dividing each enzyme activity by the initial activity.
FIG. 4. Repeated conversion of DL-HPH by immobilized D-HDT. Each cycle of the DL-HPH conversion reaction was conducted for 20 min. At the end of the reaction, immobilized D-HDT was recovered and re-used for another reaction.
372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394