Elsevier Editorial System(tm) for Journal of Plant Physiology Manuscript Draft
Manuscript Number: JPLPH-D-11-00273R1
Title: Expression of a cloned sweet potato catalase SPCAT1 alleviates ethephon-mediated leaf senescence and H2O2 elevation
Article Type: Research Paper
Section/Category: Molecular Biology
Keywords: Catalase, Ethephon, Glutathione, Leaf, Sweet potato Corresponding Author: Dr Yaw-Huei Lin, Ph.D
Corresponding Author's Institution: Institute of Plant and Microbial Biology First Author: Hsien-Jung Chen, Ph.D.
Order of Authors: Hsien-Jung Chen, Ph.D.; Sin-Dai Wu, M.S.; Guan-Jhong Huang, Ph.D.; Che-Yu Shen, M.S.; Mufidah Afiyanti, M.S.; Wei-Jhen Li, M.S.; Yaw-Huei Lin, Ph.D
Abstract: In this report a full-length cDNA, SPCAT1, was isolated from ethephon-treated mature L3 leaves of sweet potato. SPCAT1 contained 1479 nucleotides (492 amino acids) in its open reading frame, and exhibited high amino acid sequence identities (ca. 71.2% to 80.9%) with several plant catalases, including Arabidopsis, eggplant, grey mangrove, pea, potato, tobacco and tomato. Gene structural analysis showed that SPCAT1 encoded a catalase and contained a putative conserved internal peroxisomal targeting signal PTS1 motif and calmodulin binding domain around its C-terminus. RT-PCR showed that SPCAT1 gene expression was enhanced significantly in mature L3 and early senescent L4 leaves and was much reduced in immature L1, L2 and completely yellowing senescent L5 leaves. In dark- and ethephon-treated L3 leaves, SPCAT1 expression was significantly enhanced temporarily from 0 to 24 h, then decreased gradually until 72 h after treatment. SPCAT1 gene expression levels also exhibited approximately inverse correlation with the qualitative and quantitative H2O2 amounts. Effector treatment showed that ethephon-enhanced SPCAT1 expression was repressed by antioxidant reduced glutathione, NADPH oxidase inhibitor diphenylene iodonium (DPI), calcium ion chelator EGTA and de novo protein synthesis inhibitor cycloheximide. These data suggest that elevated reactive oxygen species H2O2, NADPH oxidase, external calcium influx and de novo synthesized proteins are required and associated with ethephon-mediated enhancement of sweet potato catalase SPCAT1 expression. Exogenous application of expressed catalase SPCAT1 fusion protein delayed or alleviated ethephon-mediated leaf senescence and H2O2 elevation. Based on these data we conclude that sweet potato SPCAT1 is an ethephon-inducible peroxisomal catalase, and its expression is regulated by reduced glutathione, DPI, EGTA and cycloheximide. Sweet potato catalase SPCAT1 may play a physiological role or function in cope with H2O2 homeostasis in leaves caused by developmental cues and environmental stimuli.
Institute of Plant and Microbial Biology
Academia Sinica
Nankang 115, Taipei, Taiwan
Tel: 886(2)27871172 Fax: 886(2)27827954 E-mail: [email protected]
August 4, 2011 Dear Editor-in-Chief:
We would like to submit a revised manuscript (Ms. Ref. No.: JPLPH-D-11-00273) originally entitled "Cloning and expression of a sweet potato catalase SPCAT1
alleviated ethephon-mediated leaf senescence and H2O2 elevation” co-authored by
Hsien-Jung Chen, Sin-Dai Wu, Guan-Jhong Huang, Che-Yu Shen, Mufidah Afiyanti, Wei-Jhen Li, and Yaw-Huei Lin to Journal of Plant Physiology for
publication. The original title has slightly modified as “Expression of a cloned sweet
potato catalase SPCAT1 alleviates ethephon-mediated leaf senescence and H2O2
elevation” as suggested by the Editorial office comments. All the materials are original,
no part has been submitted for publication elsewhere, and all authors have agreed for submission.
Thank you very much for your time and truly help. Anything else that I can help to speed the process, please feel free to inform me.
Sincerely yours,
Yaw-Huei Lin, Ph. D.
Retired Professor and Research Fellow Cover Letter
1
Response to the reviewers' comments
For comments of Reviewer #1
1. Fig.4D and page13 line51: "H2O2 amount was the highest in L1 leaves", how do you
explain this result? In Arabidopsis, Brassica raps and tobacco plant all showed low amount of H2O2 in young leaves.
Ans: We do not know why the young L1 leaves contained the highest amount of H2O2.
However, our data showed that the catalase was also lower at the L1 leaf stage. Therefore, these data may partly explain why the H2O2 amount was the highest
in L1 leaves. In addition, small antioxidant molecules (such as reduced glutathione and ascorbic acid) and scavenging enzymes (such as glutathione peroxidase, glutathione reductase, monoascorbate reductase and dehydroascorbate reductase) may also affect H2O2 amount via
glutathione-ascorbate cycle. The information about the change of these components during leaf development mostly remains unclear in sweet potato and should be addressed in the future in order to understand the changes of H2O2 amount in developing leaves.
In Arabidopsis, Brassica rape and tobacco plants all showed low amount of H2O2 in young leaves according to the reviewer’s comments. In sweet potato,
the L1 leaf is the stage with folding, unopened very young leaves. It just comes out from the apical shoot. In Figure 4A, it was forced to open without folding in order to take a picture. In Figure 4D, it remained folding, unopened. The L2 leaf is the stage with open, immature leaves. The H2O2 amount also dropped from
L1 to L2 and continued to L3 mature young leaves. Therefore, we do not know why the H2O2 amount was lower in young leaves of Arabidopsis, Brassica rape
and tobacco plants compared to that of sweet potato young leaves. One possibility may be due to the difference that the definition of so-called young leaves for experiments in different plant systems was not the same. For example: Are the young leaves of Arabidopsis, Brassica rape and tobacco plants used for experiments equal to the stage of L1 (folding, unopened very young leaves with the highest H2O2 amount), L2 (open, immature young leaves with
higher H2O2 amount) or L3 (young mature leaves with lower H2O2 amount)
leaves of sweet potato?
2
2. Fig.6 the results of semi-qRT-PCR are not so clearly showed the changing of transcript level. The quantitative RT-PCR is suggested.
Ans: We agree with the reviewer’s comment. Use of quantitative RT-PCR is a better
way to solve the question. In addition, the mature L3 leaf was the leaf stage used for ethephon induction and inhibitor experiments. At the stage, the catalase gene expression was higher compared to the other L1, L2 and L5 stages (Figure 4C). The induction of catalase by ethephon and the repression by inhibitors may not be so clear as raised by the reviewer’s comment likely due to the higher catalase gene expression level (basal line) for mature L3 leaves. Therefore, use of another leaf stage such as L2, which did not express significant catalase amount, may reduce the effect of high catalase level (basal line) of mature L3 leaves.
3. page 4 lane49, 58, page7 lane42, page16 lane55 "gene structure" should be "protein structure"
Ans: We agree with the reviewer’s comments and correct “gene structure” as
“protein structure” (lines 31 and 37, page 4; line 27, page 7; line 35, page 16 of revised manuscript).
For comments of Reviewer #2
Reviewer #2: This manuscript is acceptable for publication with minor grammatical revision as deemed necessary by the Editor. Otherwise the information presented is of high quality and presents new information to the scientific community.
REQUESTS BY THE EDITORIAL OFFICE
Please have the English edited to conform to accepted standards of English style and usage.
Q: FOR EXAMPLE, the title:
Cloning and expression have to be separated, since the cloning did not contribute to the alleviation, only the expression did. You could say "Cloning and expression analysis.... revealed..." or similar. Write alleviates (instead alleviated), and much more.
3
Ans: We agree with the editorial comments and revise the title as below:
“Expression of a cloned sweet potato catalase SPCAT1 alleviates ethephon-mediated leaf senescence and H2O2 elevation”
Q: Check manuscript for compliance with "Instructions for Authors". EXAMPLES (NOT
a complete list) of formatting problems is given in the following. Especially the reference section is poorly formatted or formatted for a different journal.
Ans: We rechecked and revised the manuscript format again according to the
“Instruction for Authors” especially the “Reference section” (From line 1, page 20 to line 32, page 23 of revised manuscript).
Q: give authority (L.) Lam. in M&M only (not Summary etc.)
Ans: The “Ipomoea batatas (L) Lam.” (original Line 5, page3; line 56, page 5) was
deleted from any section of the text except the “Material and Methods”.
Q: add list of abbreviations
Ans: A list of abbreviations was added and showed as below:
Abbreviation: DAB, diaminobenzidine; DPI, diphenylene iodonium; EGTA, ethylene
glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid; MES, 2-(N-morpholino) ethanesulphonic acid; RACE, rapid amplification of cDNA ends; RT-PCR, reverse transcription-polymerase chain reaction (lines 32 to 35, page 3 of revised manuscript)
Q: write 2009; 2010a (no "and") also 1987a; b (no "and") Ans: The text was corrected as suggested and showed below:
(Chen et al., 2004; 2006; 2008a; 2009; 2010a) (line 3, page 6 of revised manuscript) (Sakajo et al., 1987a; b) (line 5, page 6 of revised manuscript)
Q: Reference Section (not formatted for this journal)
no periods after initials and journal abbreviations year in incorrect position
4
page numbers in short form (669-76)
Ans: We rechecked and corrected the format of the “Reference section” again
according to the “Instruction for Authors” (From line 1, page 20 to line 32, page 23 of revised manuscript).
Q: Chen YC 2008b, where is "a"?
Ans: There are two “Chen et al., 2008” cited in the “Introduction” section and
“Discussion” section, respectively. However, the two “Chen et al., 2008” are not the same author. One is for “Chen HJ” and the other is for “Chen YC”. In order to differentiate, we mark them as “Chen et al., 2008a” in the Introduction section for “Chen HJ” and “Chen et al., 2008b” in the Discussion section for “Chen YC”.
For reference “Chen et al., 2008a” (original line 3, page 6 of Introduction section):
“Chen HJ, Wen IC, Huang GJ, Hou WC, Lin YH. Expression of sweet potato asparaginyl endopeptidase caused altered phenotypic characteristics in transgenic Arabidopsis. Bot Stud 2008a; 49: 109-17.”
For reference “Chen et al., 2008b” (original line 20, page 19 of Discussion section):
“Chen YC, Lin HH, Jeng ST. Calcium influxes and mitogen-activated protein kinase kinase activation mediate ethylene inducing ipomoelin gene expression in sweet potato. Plant Cell Environ 2008b; 31: 62-72.”
Q: list alphabetically Gonzales - Guan - Gould ?
Ans: These references were re-scheduled as suggested and shown below (lines 11 to
18, page 21 of revised manuscript):
González E. The C-terminal domain of plant catalase: implications for a glyoxysomal targeting sequence. Eur J Biochem 1991; 199: 211-5.
Gould S, Keller G, Subramani S. Identification of a peroxisomal targeting signal at the carboxy terminus of firefly luciferase. J Cell Biol 1987; 105: 2923−31.
5
Gould SJ, Keller GA, Hosken N, Wilkinson J, Subramani S. A conserved tripeptide sorts proteins to peroxisomes. J Cell Biol 1989; 108:1657-664.
Guan L, Scandalios JG. Developmentally related responses of maize catalase genes to salicylic acid. Proc Natl Acad Sci USA 1995; 92: 5930-4.
Q: Niewiadomska all names incorrectly copied (with index letters)
Ans: The reference was corrected and list below (lines 15 to 18, page 22 of revised
manuscript):
Niewiadomska E, Polzien L, Desel C, Rozpadek P, Miszalski Z, Krupinska K. Spatial patterns of senescence and development-dependent distribution of reactive oxygen species in tobacco (Nicotiana tabacum) leaves. J Plant Physiol 2009; 166: 1057-68.
Q: book titles with upper-case word-beginnings (A Laboratory Manual); journal titles
NOT (see Wang et al.)
Ans: The reference was corrected as suggested and list below (lines 37 to 38, page 22
of revised manuscript):
Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning A laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press; 1989.
Q: Figures
4A leaf but 4D leaves (be consistent)
Ans: We revised and replaced the X-axis label (leaves) of Figure 4D with leaf (Figure 4
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Dr. Yaw-Huei Lin* 1
Institute of Plant and Microbial Biology, Academia Sinica, Nankang 115, Taipei, 2 Taiwan. 3 Phone: 886-2-27871172 4 Fax: 886-2-27827954 5 E-mail: [email protected] 6 7 or 8 9 Dr. Hsien-Jung Chen* 10
Department of Biological Sciences 11
National Sun Yat-sen University 12
No. 70, Lien-Hai Rd., 804 Kaohsiung, Taiwan. 13 Phone: 886-7-5252000 ext. 3630 14 Fax: 886-7-5253630 15 E-mail: [email protected] 16 17 18
Running title: Sweet potato catalase
19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 *Manuscript
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Expression of a cloned sweet potato catalase SPCAT1
1
alleviates ethephon-mediated leaf senescence and
2
H
2O
2elevation
3 4 5
Hsien-Jung Chen1*, Sin-Dai Wu1, Guan-Jhong Huang2#, Che-Yu Shen1#, 6
Mufidah Afiyanti1#, Wei-Jhen Li1, Yaw-Huei Lin3*
7 8
1. Department of Biological Sciences, National Sun Yat-sen University, 804 Kaohsiung,
9
Taiwan
10
2. School of Chinese Pharmaceutical Sciences and Chinese Medicine Resources, College of
11
Pharmacy, China Medical University, Taichung 404, Taiwan
12
3. Institute of Plant and Microbial Biology, Academia Sinica, Nankang, 115 Taipei, Taiwan
13 * For correspondence 14 # Equal contribution 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ABSTRACT
1 2In this report a full-length cDNA, SPCAT1, was isolated from ethephon-treated 3
mature L3 leaves of sweet potato. SPCAT1 contained 1479 nucleotides (492 amino 4
acids) in its open reading frame, and exhibited high amino acid sequence identities (ca. 5
71.2% to 80.9%) with several plant catalases, including Arabidopsis, eggplant, grey 6
mangrove, pea, potato, tobacco and tomato. Gene structural analysis showed that 7
SPCAT1 encoded a catalase and contained a putative conserved internal peroxisomal
8
targeting signal PTS1 motif and calmodulin binding domain around its C-terminus. 9
RT-PCR showed that SPCAT1 gene expression was enhanced significantly in mature 10
L3 and early senescent L4 leaves and was much reduced in immature L1, L2 and 11
completely yellowing senescent L5 leaves. In dark- and ethephon-treated L3 leaves, 12
SPCAT1 expression was significantly enhanced temporarily from 0 to 24 h, then
13
decreased gradually until 72 h after treatment. SPCAT1 gene expression levels also 14
exhibited approximately inverse correlation with the qualitative and quantitative H2O2
15
amounts. Effector treatment showed that ethephon-enhanced SPCAT1 expression was 16
repressed by antioxidant reduced glutathione, NADPH oxidase inhibitor diphenylene 17
iodonium (DPI), calcium ion chelator EGTA and de novo protein synthesis inhibitor 18
cycloheximide. These data suggest that elevated reactive oxygen species H2O2,
19
NADPH oxidase, external calcium influx and de novo synthesized proteins are 20
required and associated with ethephon-mediated enhancement of sweet potato catalase 21
SPCAT1 expression. Exogenous application of expressed catalase SPCAT1 fusion
22
protein delayed or alleviated ethephon-mediated leaf senescence and H2O2 elevation.
23
Based on these data we conclude that sweet potato SPCAT1 is an ethephon-inducible 24
peroxisomal catalase, and its expression is regulated by reduced glutathione, DPI, 25
EGTA and cycloheximide. Sweet potato catalase SPCAT1 may play a physiological 26
role or function in cope with H2O2 homeostasis in leaves caused by developmental
27
cues and environmental stimuli. 28
29
Keywords: Catalase, Ethephon, Glutathione, Leaf, Sweet potato
30 31
Abbreviation: DAB, diaminobenzidine; DPI, diphenylene iodonium; EGTA, ethylene
32
glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid; MES, 2-(N-morpholino) 33
ethanesulphonic acid; RACE, rapid amplification of cDNA ends; RT-PCR, reverse 34
transcription-polymerase chain reaction 35
36 37 38
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Introduction
1 2Leaf is the main place of photosynthesis and serves as a source of carbohydrate for 3
sink nutrients in plants. Leaf senescence affects the efficiency of photosynthesis and is 4
influenced by endogenous and exogenous factors, including plant growth regulators, 5
starvation, wound, dark, ozone, UV, and other environmental stresses (Yoshida 2003; 6
Lim et al., 2007). Elevated oxidative stresses caused by environmental stimuli, 7
including ozone, UV-B, and wounding have been reported and enhanced ethylene 8
production via ACC synthase and ACC oxidase (Wang et al., 2002). In ozone 9
treatment, ethylene also enhances reactive oxygen species (ROS) generation, which in 10
turn leads to senescence and cell death (Wang et al., 2002). Examples concerning the 11
role of elevated oxidative stress have been reported in natural senescence of pea 12
leaves (Pastori and del Rίo, 1997), induced senescence by ethylene in sweet potato 13
leaves (Chen et al., 2010b), JA (Hung and Kao, 2004a) and ABA (Hung and Kao, 14
2004b) in rice leaves, and wounding in tomato leaves (Orozco-Cardenas and Ryan, 15
1999). 16
Catalase is one of the major H2O2-scavenging enzymes and functions mainly in
17
the removal of excessive H2O2 generated during developmental processes or by
18
environmental stimuli into water and oxygen in all aerobic organisms (Mhamdi et al., 19
2010). Plant catalases are composed of a multigene family and have been reported in 20
different species. There are 1 identified in sweet potato storage root (Sakajo and Asahi, 21
1986), castor bean (González, 1991) and tomato (Drory and Woodson, 1992), 2 in 22
cottonseed (Ni et al., 1990) and Hordeum vulgare (Skadsen et al., 1995), 3 in tobacco 23
(Willekens et al., 1994), maize (Guan andScandalios, 1995), Arabidopsis (Frugoli et 24
al., 1996) and pumpkin (Esaka et al., 1997). 25
Plant catalase is a tetrameric heme-containing enzyme, and is mainly localized in 26
peroxisomes that are bound by a single membrane and contain hydrogen peroxide-27
generating oxidases. Thus, catalase enzyme plays an important role in scavenging 28
hydrogen peroxide accumulated in peroxisomes (Gillham and Dodge, 1986). Plant 29
peroxisomal proteins including catalases require particular peroxisomal targeting 30
signal (PTS) for import into peroxisomes. Protein structure analysis showed that at 31
least two types of PTSs have been identified. The peroxisomal targeting signal type 1 32
(PTS1) is based on consensus tripeptides at the C-terminus. Gould et al. (1987 and 33
1989) first identified firefly luciferase C-terminal SKL as a PTS. Mullen et al. (1997) 34
analyzed the importance of cottonseed catalase into peroxisomes in tobacco BY-2 35
cells, and demonstrated the C-terminal tripeptides as the PTS1 of cottonseed catalase. 36
In addition, protein structure and transgenic analysis also demonstrated that an internal 37
consensus tripeptide PTS1-like motif (QKL) around or at the C-terminus of pumpkin 38
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Cat1 catalase was identified and directed pumpkin Cat1 catalase import into 1
peroxisome (Kamigaki et al., 2003). For type 2 peroxisomal targeting signal (PTS2), 2
the consensus amino acid sequence (RL/IX5H/QL) located within the N-terminal pre-3
sequence of a small subset of peroxisomal proteins was identified, proteolytically 4
processed and directed their import into peroxisomes (Gietl, 1996; De Hoop and Ab, 5
1992; Subramani, 1993). 6
Gene expression of various plant catalases is regulated temporally and spatially 7
and differentially responds to developmental and environmental stimuli (Guan and 8
Scandalios, 1995; Zimmermann et al., 2006; Du et al., 2008). In Arabidopsis, three 9
major catalase CAT1, CAT2 and CAT3, were identified and isolated (Frugoli et al., 10
1996). CAT2 is the predominant catalase in Arabidopsis, and its expression increased 11
and reached maximum at mature leaves. For CAT3 and CAT1, their expression levels 12
were much less than CAT2, and was enhanced in senescent leaves (Zimmermann et 13
al., 2006). In tobacco, there were three catalase genes isolated and named as CAT1, 14
CAT2, and CAT3. Gene expression patterns demonstrated that CAT1 and CAT2 were 15
detected in non-senescent leaves, however, the amount of CAT2, but not CAT1, was 16
significantly reduced in senescent leaves compared to non-senescent leaves. For 17
CAT3, it was detected in both non-senescent and senescing leaves (Niewiadomska et 18
al., 2009). 19
The catalase activity levels were inversely correlated with the cellular H2O2
20
amounts of plants (Zimermann et al., 2006). Therefore, a light-dependent source of 21
H2O2 via photorespiration in the peroxisomes is regulated by catalase (Queval et al.,
22
2007). Transgenic tobacco plants expressing antisense construct of peroxisomal CAT-23
1 displayed severely reduced catalase activity and developed chlorosis and necrosis on 24
some of the lower leaves due to the elevated H2O2 levels (Takahashi et al., 1997). In
25
Arabidopsis, the growth of a peroxisomal catalase 2 knock-out mutant (cat2), which
26
also contained higher H2O2 amounts, was severely decreased in rosette biomass under
27
ambient air (Queval et al., 2007). Calmodulin, a ubiquitous calcium-binding protein, 28
has been reported to bind and activate some plant catalases in the presence of calcium, 29
but calcium CaM does not have any effect on bacterial, fungal, bovine, or human 30
catalases. In Arabidopsis, the putative calmodulin binding domain of CAT3 catalase 31
was identified and confirmed (Yang and Poovaiah, 2002; 2003). These results 32
demonstrate that plant peroxisomal catalases contain calmodulin binding domain that 33
mediates the activation of catalase catalytic activity and down-regulation of H2O2
34
levels. 35
Sweet potato is an important food crop in the tropics and subtropics including 36
Taiwan. In our laboratory, ethephon, an ethylene-releasing compound, can promote 37
senescence in detached sweet potato leaves. Several ethephon-inducible senescence-38
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
associated genes have previously been cloned and characterized, including isocitrate 1
lyase (Chen et al., 2000), metallothionein (Chen et al., 2003), and cysteine proteases 2
(Chen et al., 2004; 2006; 2008a; 2009; 2010a). Research about sweet potato catalase, 3
however, was limited. A full-length cDNA encoding putative catalase had been cloned 4
previously from sweet potato storage root (Sakajo et al., 1987a; b), however, its 5
physiological role and function remained unclear. In our laboratory, a major leaf-type 6
catalase was identified and characterized with in-gel activity assay in sweet potato. Its 7
enzymatic activity was enhanced in mature leaves, and was induced by dark and 8
ethephon. The leaf-type catalase expression level exhibited negative correlation with 9
cellular H2O2 level (Chen et al., 2011). In this report, an ethephon-inducible catalase
10
cDNA SPCAT1 was also cloned and characterized for the first time from sweet potato 11
leaves. A possible role of sweet potato catalase SPCAT1 in cope with H2O2
12
homeostasis in natural and induced senescent leaves was also addressed. 13
14 15
Materials and methods
16 17
Plant materials
18 19
The storage roots of sweet potato (Ipomoea batatas (L.) Lam.) were grown in the 20
growth chamber at 280C/16 h day and 230C/8 h night cycle. Plantlets sprouted from 21
the storage roots provided detached mature leaves for dark and ethephon treatments at 22
280C/16 h and 230C/8 h cycle in the dark, and different developmental stages of leaves 23
for temporal and spatial expression experiments. Leaves were arbitrary divided into 24
L1 to L5 according to their size and different developmental stages. L1 was the stage 25
with folding, unopened immature leaves. L2 was the stage with unfolding but not 26
fully-expanded immature leaves. L3 was the stage with fully-expanded mature leaves. 27
L4 and L5 were the stages with partial and completely yellowing senescent leaves, 28
respectively. Samples collected were used for leaf morphology, photochemical Fv/Fm, 29
chlorophyll content, diaminobenzidine (DAB) staining, H2O2 determination, and gene
30
expression with RT-PCR as described below. Detached L3 mature leaves treated with 31
1 mM ethephon and dark control were used for PCR-selective subtractive 32
hybridization and rapid amplification of cDNA ends (RACE) experiments as 33
described below. 34
35
PCR-selective subtractive hybridization and RACE PCR
36 37
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Sweet potato L3 mature leaves were detached and treated with 1 mM ethephon for 1
6 and 24 hours according to the report of Chen et al. (2003), then the two samples 2
were combined together for PCR-selective subtractive hybridization and RACE PCR 3
for full-length catalase cDNA cloning. The dark-treated leaves were used as control. 4
Total RNAs were isolated separately from the samples of dark control and 1 mM 5
ethephon-treated L3 mature leaves as described above according to the method of 6
Sambrook et al. (1989). The mRNAs were purified with a purification kit (Promega) 7
and used for the differentially-expressed first strand cDNA synthesis with a PCR-8
selective subtractive hybridization kit (Clontech) following the protocols supplied by 9
the manufacturer. The differentially expressed cDNAs of 1 mM ethephon-treated 10
leaves after subtraction by that of dark control mature leaves were ligated to pGEM-T 11
easy vector for E. coli DH5 competent cell transformation. Recombinant plasmids 12
were isolated for DNA sequencing using an ABI PRIZM 337 DNA Sequencer. 13
Nucleotide sequence data were analyzed using the NCBI Blast program. The RACE 14
PCR method with the Marathon cDNA amplification kit (Clontech) was used to 15
isolate the 5' and 3' ends of the target catalase cDNAs according to the protocols 16
provided by the manufacturer. Finally, a primer pair (5’ primer: CATTATTCTCTCT 17
GTCCCCTCATCTCCATG; 3’ primer: TGCCTTTAATTCCACCTCTCTTACATCG 18
TC) was used to amplify the full-length cDNA encoding the putative sweet potato 19
catalase. The amplified cDNA products were purified from agarose gel after 20
electrophoresis with QIAquick Gel Extraction kit (QIAGEN), then cloned directly into 21
pGEM-T easy vector (Promega). Recombinant plasmids were isolated and the insert 22
DNAs were used for DNA sequencing with an ABI PRIZM 337 DNA Sequencer. The 23
catalase cDNA was renamed as SPCAT1 and its nucleotide and amino acid sequence 24
was submitted to NCBI GenBank for registration. 25
26
Protein
structure analysis and phylogenetic tree construction
27 28
After NCBI/blast comparison, the amino acid sequence of sweet potato catalase 29
SPCAT1 (accession no. GU230147) was aligned with published plant catalases,
30
including Arabidopsis CAT1 (accession no. Q96528), Arabidopsis CAT2 (accession 31
no. P25819), Arabidopsis CAT3 (accession no. Q42547), eggplant CAT (accession no. 32
X71653), grey mangrove CAT1 (accession no. Q53ZT2), pea CAT (accession no. 33
P25890), potato CAT1 (accession no. U27082), tobacco CAT1 (accession no. 34
Z36975), tobacco CAT2 (accession no. Z36976), tobacco CAT3 (accession no. 35
Z36977), and tomato CAT1 (accession no. M93719), for (a) phylogenetic tree 36
construction, (b) identification of conserved internal peroxisomal targeting signal 37
(PTS1) around the C-terminus, and (c) putative consensus calmodulin binding domain. 38
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
For phylogenetic tree construction, the distances among entries were calculated with 1
neighbor-joining method (Thompson et al. 1994), and the BLOSUM series matrix (80, 2
62, 45, 30) of software ClustalW2 was used as parameters in the alignment with 3
default setting for gap penalty. The phylogenetic tree was drawn using NJ plot. 4
5
Temporal and spatial expression of sweet potato catalase SPCAT1
6 7
In order to analyze the temporal and spatial expression of sweet potato catalase 8
SPCAT1, samples were collected from stem, root, skin and flesh of storage root, and
9
different leaf developmental stages (L1 to L5) as described above. These samples 10
were analyzed for catalase SPCAT1 expression with RT-PCR as described below for 11
temporal and spatial expression patterns. For different developmental stages of leaf 12
samples (L1 to L5), additional assays were also performed, including leaf morphology, 13
chlorophyll content, photochemical Fv/Fm, DAB staining and determination of H2O2
14
amount as described below. 15
16
Ethephon and dark treatments
17 18
For dark treatment, detached L3 mature leaves were placed on a wet paper towel 19
containing 3 mM 2-(N-morpholino)ethanesulphonic acid (MES) buffer pH 5.8, and 20
kept at 280C/16 h and 230C/8 h cycle in the dark. Samples were collected individually 21
at 0, 6, 24, 48 and 72 h after treatment. For ethephon treatment, detached mature 22
leaves (L3) were also placed on a wet paper towel containing 3 mM MES buffer pH 23
5.8 plus 1 mM ethephon, and kept at 280C/16 h and 230C/8 h cycle in the dark. 24
Samples were also collected individually at 0, 6, 24, 48 and 72 h after treatment. Both 25
samples from dark and ethephon treatments were analyzed for leaf morphology, 26
chlorophyll content, photochemical Fv/Fm, catalase SPCAT1 expression with RT-27
PCR, DAB staining and determination of H2O2 amount as describes below.
28 29
Effector treatment
30 31
Influence of effectors such as antioxidant reduced glutathione, NADPH oxidase 32
inhibitor DPI, calcium ion chelator EGTA, and de novo protein synthesis inhibitor 33
cycloheximide on ethephon-enhanced sweet potato catalase SPCAT1 gene expression 34
were studied. Detached L3 mature leaves were pretreated with (+) or without (-) 1 35
mM reduced glutathione, 100 M DPI, 5 mM EGTA, or 20 g/mL cycloheximide for 36
ca. 15 to 30 min prior to 1 mM ethephon treatment on a wet paper towel containing 3 37
mM 2-(N-morpholino)ethanesulphonic acid (MES) buffer pH 5.8. Leaves were kept at 38
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
280C/16 h and 230C/8 h cycle in the dark for 24 h and 72 h, respectively, then were 1
individually collected and analyzed using RT-PCR with the primer pair (5’ primer: 2
CATTATTCTCTCTGTCCCCTCATCTCCATG; 3’ primer: TGCCTTTAATTCCAC 3
CTCTCTTACATCGTC) to amplify the full-length cDNA for sweet potato catalase 4
SPCAT1 expression.
5 6
Construction, overexpression, and purification of SPCAT1 fusion protein
7
from E. coli
8 9
The full-length catalase SPCAT1 cDNA in the recombinant pGEM-T easy vector 10
was used as templates to amplify the PCR products encoding the putative SPCAT1 11
protein (from the 1st to 492nd amino acid residues) with the 5’ (Catalase A: 12
ATGCCCATGGATCCTTCAAAGTATCGTCCA) and 3’ (Catalase B: ATGCCCAT 13
GGTTACATCGTCGGTCTTATGT) primers. The ATG and TTA underlined 14
indicated the initiation codon and stop codon, respectively. A NcoI cutting site 15
(CCATGG printed in black on gray) was also introduced into the 5’ and 3’ primer pair. 16
The amplified PCR products were purified first from agarose gel after electrophoresis 17
with QIAguick Gel Extraction kit (QIAGEN), then ligated with NcoI digested 18
PET30a vector (Novagen) for E. coli DH5 competent cell transformation according 19
to the protocols provided by the supplier. The recombinant PET-30a vector containing 20
the correct catalase SPCAT1 construction was isolated and transferred into BL21 21
(DE3) competent cell again. The transformants were isolated and used for catalase 22
SPCAT1 fusion protein induction, detection, and purification according to the 23
protocols provided by the supplier. 24
For SDS-PAGE of catalase SPCAT1 fusion protein, the cells were induced by 1 25
mM IPTG and harvested individually at the time intervals (0, 1, 2, 3, 4 and 5 h, 26
respectively) after treatment. The cell pellet from 1.5 ml culture after centrifugation at 27
10,000 xg for 10 min was re-suspended in phosphate buffer saline, then sonicated, and 28
finally mixed with 5x SDS sample buffer (60 mM Tris-HCl pH 6.8, 50% glycerol, 2% 29
SDS, 28.8 mM -mercaptoethanol, 0.1% bromophenol blue) and boiled at 950C for 5 30
min. Then, equal volume of samples was loaded into 12.5% SDS-PAGE for analysis. 31
For catalase SPCAT1 fusion protein purification, cells after induction with 1 mM 32
IPTG for 5 h were collected and centrifuged at 10,000 xg for 10 min and re-suspended 33
in phosphate buffer saline. The expressed fusion proteins were extracted from cell 34
pellet with 8 M urea in binding buffer B (8 M urea; 0.1 M NaH2PO4; 0.01 M Tris-Cl,
35
pH 8.0), and then applied to His-tag affinity column for purification according to the 36
protocols from Novagen. The column was washed with denaturing wash buffer 37
(Buffer C: 8 M urea; 0.1 M NaH2PO4; 0.01 M Tris-Cl pH 6.3), and then eluted the
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
catalase SPCAT1 fusion protein with denaturing elution buffer (buffer D: 8 M urea; 1
0.1 M NaH2PO4; 0.01 M Tris-Cl pH 5.9) for the first time and denaturing elution
2
buffer (buffer E: 8 M urea; 0.1 M NaH2PO4; 0.01 M Tris-Cl pH 4.5) for the second 3
and third time. The different portions collected during purification procedure were 4
used for SDS-PAGE as described above. The eluted proteins in buffer D and buffer E 5
were combined together and used for exogenous application of purified catalase 6
SPCAT1 fusion protein to ethephon-treated sweet potato leaves. 7
For exogenous application of catalase SPCAT1 fusion protein, the purified fusion 8
protein (0.2 and 2.0 mg, respectively) was mixed together with 1 mM ethephon in 3 9
mM MES buffer pH 5.8 (final volume of 50 mL), and used for exogenous application 10
to detached L3 mature leaves in order to study its influence on ethephon-mediated 11
effects of leaf senescence, including leaf morphology, chlorophyll content, 12
photochemical Fv/Fm, and quantitative determination of H2O2 amount as described
13
below. 14
15
Treatment of catalase SPCAT1 fusion protein
16 17
For influence of exogenous catalase SPCAT1 fusion protein on ethephon-18
mediated effects, detached L3 mature leaves were placed on a wet paper towel 19
containing 3 mM MES buffer pH 5.8, 1 mM ethephon and different amount of 20
purified catalase SPCAT1 fusion protein (0, 0.2 and 2.0 mg, respectively), then kept at 21
280C/16 h and 230C/8 h cycle in the dark. Samples were collected individually at 0 22
and 72 h after treatment, and analyzed for leaf morphology, chlorophyll content, 23
photochemical Fv/Fm, DAB staining and determination of H2O2 amount as describes
24 below. 25 26
Leaf morphology
27 28Leaves from treatments mentioned above were scanned with a scanner for 29
morphological record and comparison. Each experiment was repeated at least three 30
times and a representative one was shown (Chen et al., 2010b). 31
32
Measurement of chlorophyll content
33 34
Leaves from treatments mentioned above were measured and recorded directly 35
with non-invasive CCM-200 Chlorophyll Content Meter. Each leaf sample was 36
measured at least five different leaf areas, and each treatment was repeated at least 37
three times. The data were expressed as mean S.E. (Chen et al., 2010b). 38
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 1
Measurement of photochemical Fv/Fm
2 3Leaves from treatments mentioned above were measured and recorded with non-4
invasive Chlorophyll Fluorometer (WALZ JUNIOR-PAN). The photochemical Fv/Fm 5
is used to determine the maximal quantum efficiency of photosystem II primary 6
photochemistry. In healthy leaves, this value is close to 0.8 and independently of the 7
plant species. Therefore, the photochemical Fv/Fm was measured, recorded and 8
compared among control and treated samples. Each leaf sample was measured at least 9
five different leaf areas, and each treatment was repeated at least three times. The data 10
were expressed as mean S.E. (Chen et al., 2010b). 11
12
DAB staining
13 14
DAB staining method was used to qualitatively detect the H2O2 generation in
15
leaves after treatments, and was basically according to the method described by Hu et 16
al. (2005) with minor modification. Leaves from treatments mentioned above were 17
collected separately and stained with 1 mg/ml DAB solution pH 3.8 at 370C for 2 18
hours. After DAB staining, leaves were boiled in ethanol for 10 minutes, then cooled 19
down to room temperature and photographed (Chen et al., 2010b). 20
21
Measurement of H
2O
2amount
22 23
For quantitative measurement of H2O2 amount, leaves from treatments mentioned
24
above were analyzed basically according to the method reported by Kuzniak et al. 25
(1999). There were about ten leaf discs (1 cm in diameter) incubated in 2 mL reagent 26
mixture (50 mM phosphate buffer pH 7.0, 0.05% guaiacol and horseradish peroxidase 27
(2.5 U mL−1)) for 2 h at room temperature in the dark. Four moles of H2O2 are
28
required in order to form 1 M of tetraguaiacol, which has an extinction coefficient of ε 29
= 26.6 cm−1 mM−1 at 470 nm. The absorbance in the reaction mixture was measured 30
immediately at 470 nm and expressed as mole H2O2 g−1 leaf fresh weight. Each
31
treatment was repeated at least three times. The data were expressed as mean S.E. 32
33
RT-PCR analysis
34 35
Total RNA was isolated from (a) different developmental stages of leaves (L1 to 36
L5), (b) different organs including roots, stems, L3 mature leaves, skin and flesh of 37
storage roots, (c) time course of dark-treated or 1 mM ethephon-treated L3 mature 38
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
leaves, and (d) dark-treated, 1 mM ethephon-treated, and effector plus 1 mM 1
ethephon-treated L3 mature leaves for 24 h and 72 h, respectively, as described above. 2
The SPCAT1 5’ primer (CATTATTCTCTCTGTCCCCTCATCTCCATG) and 3’ 3
primer (TGCCTTTAATTCCACCTCTCTTACATCGTC) were used to amplify the 4
full-length catalase PCR products for analysis with agarose gel electrophoresis. In 5
addition, a primer pairs (5’ primer: ATGTCGGACAAGTGCGGAAACTGCG; 3’ 6
primer: TTAGTGGCCACAGGTGCGGTCGGTA) for G14, which encoded a 7
constitutively-expressed metallothionein-like protein, was used as an endogenous 8
control (Chen et al., 2003). The RT-PCR condition was 940C 3 min for 1 cycle; 940C 9
1 min, 550C 45 sec, 720C 90 sec for 25 cycle; then, 720C 7 min for 1 cycle. 10 11 12
Results
13 14Nucleotide and amino acid sequences of catalase SPCAT1
15 16
In order to clone ethephon-inducible genes, sweet potato L3 mature leaves were 17
treated with 1 mM ethephon for 6 and 24 h and used for differentially-expressed gene 18
isolation. With PCR-selective subtractive hybridization and RACE PCR techniques, a 19
full-length cDNA (accession no. GU230147) was cloned and named as SPCAT1. 20
There were 1479 nucleotides (492 amino acids) in its open reading frame (Fig. 1). 21
NCBI/Blast comparison showed that SPCAT1 exhibited high amino acid sequence 22
identities (ca. 71.2% to 80.9%) with several plant catalases, including Arabidopsis, 23
eggplant, grey mangrove, pea, potato, tobacco and tomato. The 65th His (H), 104th Ser 24
(S) and 138th Asn (N) printed in white on black represent the conserved catalytic 25
amino acid residues. The C-terminal 480th Gln (Q), 481st Lys (K) and 482nd Val (V) 26
amino acid residues printed in white on black represent the putative consensus internal 27
peroxisomal targeting signal PTS1 (Figs. 1 and 2A). Amino acid residues from the 28
415th Gly (G) to 451st Val (V) printed in black on gray represent the putative 29
calmodulin binding domain (Figs. 1 and 2B). These data suggest that sweet potato 30
SPCAT1 encodes a putative peroxisomal catalase, which is likely regulated and
31
activated by calmodulin and calcium. 32
Amino acid sequence alignment and phylogenetic relationship of SPCAT1 with 33
several plant catalases, including Arabidopsis CAT1 (accession no. Q96528), 34
Arabidopsis CAT2 (accession no. P25819), Arabidopsis CAT3 (accession no.
35
Q42547), eggplant CAT (accession no. X71653), grey mangrove CAT1 (accession no. 36
Q53ZT2), pea CAT (accession no. P25890), potato CAT1 (accession no. U27082), 37
sweet potato SPCAT1 (accession no. GU230147), tobacco CAT1 (accession no. 38
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Z36975), tobacco CAT2 (accession no. Z36976), tobacco CAT3 (accession no. 1
Z36977) and tomato CAT1 (accession no. M93719) were shown in Figure 3. Sweet 2
potato SPCAT1 exhibited close association with a group of plant catalase, including 3
grey mangrove CAT1, tobacco CAT1 and CAT3, pea CAT, and Arabidopsis CAT1 4
and CAT2. However, SPCAT1 displayed a more distantly-related association with 5
another group of plant catalases, including Arabidopsis CAT3, eggplant CAT, potato 6
CAT1, tobacco CAT2, and tomato CAT1. These data suggest that sweet potato 7
catalase SPCAT1 may have physiological role or function more related to grey 8
mangrove CAT1, tobacco CAT1, and Arabidopsis CAT2. 9
10
Temporal expression of catalase SPCAT1 in leaves
11 12
There were 5 leaf stages (L1 to L5) divided according to leaf size and different 13
developmental stages as described in “Materials and Methods” section (Fig. 4A). The 14
chlorophyll content increased gradually from L1 (ca. 13.24%) and L2 (ca. 74.80%) 15
leaves, and reached maximum at L3 leaves (100%), then decreased gradually from 16
early L4 senescent leaves (ca. 38.86%) until completely yellowing L5 senescent leaves 17
(ca. 6.93%) (Fig. 4A). The photochemical Fv/Fm was not much different among L1, 18
L2, L3 and L4 leaves, and was significantly decreased in completely yellowing L5 19
senescent leaves (ca. 59%) (Fig. 4B). These data demonstrate that L3 leaves are the 20
fully-expanded mature leaves, therefore, contain the highest chlorophyll content and 21
photochemical Fv/Fm. 22
The temporal expression patterns of SPCAT1 were studied with RT-PCT 23
according to Chen et al. (2003). SPCAT1 gene expression was remarkably enhanced at 24
L3 mature and early L4 senescent leaves compared to immature L1 and L2 leaves and 25
completely yellowing L5 senescent leaves (Fig. 4C). However, a metallothionein-like 26
protein gene, G14, which was isolated previously from sweet potato leaves, exhibited 27
constitutive expression pattern in all tissues assayed and was used as an endogenous 28
control (Chen et al., 2003). No significant variation of G14 expression level was 29
found among different leaf developmental stages analyzed (Fig. 4C). Qualitative DAB 30
staining and quantitative determination of H2O2 amounts in leaves of different
31
developmental stages were also measured. The results showed that H2O2 amount was
32
the highest in L1 leaves, and decreased gradually from L2 leaves to the lowest in L3 33
and L4 leaves, then increased again in completely yellowing L5 senescent leaves (Fig. 34
4D). An inverse correlation between catalase SPCAT1 expression level and H2O2
35
amount in different developmental leaf stages of sweet potato was observed. These 36
data suggest a possible role of sweet potato catalase SPCAT1 in association with the 37
H2O2 homeostasis during leaf development.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 1
Dark and ethephon enhance catalase SPCAT1 expression
2 3
Effects of dark and ethephon on leaf senescence, chlorophyll content, 4
photochemical Fv/Fm, H2O2 amount, and catalase SPCAT1 expression were studied.
5
Dark did not promote significant leaf senescence (Fig. 5A), decrease of chlorophyll 6
content (Fig. 5B), and reduction of photochemical Fv/Fm (Fig. 5C) within 72 h 7
treatment. These data suggest that dark may not be a key regulator in promotion of 8
leaf senescence. However, dark did affect the catalase SPCAT1 expression and H2O2
9
amount in treated detached leaves. Catalase SPCAT1 expression was remarkably 10
enhanced from 0 to 24 h, and then decreased gradually until 72 h after dark treatment 11
in detached L3 mature leaves. However, the metallothionein-like protein gene, G14, 12
exhibited constitutive expression pattern and no significant variation was found in all 13
tissues assayed (Fig. 5D). Qualitative DAB staining and quantitative determination of 14
H2O2 amounts in dark-treated detached leaves showed that the H2O2 amount was the
15
lowest from 0 to 24 h, and then increased gradually and reached a maximum at 72 h 16
after dark treatment in detached L3 mature leaves (Figs. 5E and 5F). An inverse 17
correlation between catalase SPCAT1 expression level and H2O2 amount in
dark-18
treated detached L3 mature leaves was observed. These data suggest a possible role of 19
sweet potato catalase SPCAT1 in association with the H2O2 homeostasis in
dark-20
stressed leaves. 21
Effects of ethephon on leaf senescence, chlorophyll content, photochemical Fv/Fm, 22
H2O2 amount, and catalase activity were also studied. Ethephon did cause significant
23
promotion on leaf senescence (Fig. 5A), decrease of chlorophyll content (Fig. 5B), 24
and reduction of photochemical Fv/Fm (Fig. 5C) at 72 h after treatment. These data 25
also consistent with the key role of ethylene in promotion of leaf senescence. 26
Ethephon also affected catalase SPCAT1 expression and the H2O2 amount in treated
27
detached L3 mature leaves. Catalase SPCAT1 expression was significantly enhanced 28
from 0 to 24 h, and then decreased gradually until 72 h after ethephon treatment in 29
detached L3 mature leaves. The enhancement of SPCAT1 expression by ethephon was 30
greater than that by dark from 0 to 24 h after treatment (Fig. 5D). However, the 31
metallothionein-like protein gene, G14, exhibited constitutive expression pattern and 32
no significant variation was found in all tissues assayed (Fig. 5D). Qualitative DAB 33
staining and quantitative determination of H2O2 amounts in ethephon-treated detached
34
leaves showed that the H2O2 amount was also the lowest from 0 to 24 h, and then
35
increased gradually and reached maximum at 72 h after ethephon treatment in 36
detached L3 mature leaves (Figs. 5E and 5F). The increase of H2O2 amount by
37
ethephon was also greater than that by dark from 0 to 72 h after treatment (Figs. 5E 38
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
and 5F). An inverse correlation between catalase SPCAT1 expression level and H2O2
1
amount in ethephon-treated detached L3 mature leaves was also observed. These data 2
suggest a possible role of sweet potato catalase SPCAT1 in association with the H2O2
3
homeostasis in ethephon-treated leaves. 4
5
Ethephon-enhanced catalase SPCAT1 expression was repressed by
6
reduced glutathione, DPI, EGTA and cycloheximide
7 8
Factors involved in the enhancement of catalase SPCAT1 expression by ethephon 9
in L3 mature leaves was also studied with different effectors at 24 h and 72 h after 10
treatment. Ethephon-mediated enhancement of catalase SPCAT1 expression was 11
repressed by pretreatment with antioxidant reduced glutathione (Fig. 6A), NADPH 12
oxidase inhibitor DPI (Fig. 6B), calcium ion chelator EGTA (Fig. 6C), and de novo 13
protein synthesis inhibitor cycloheximide (Fig. 6D) to a level similar to that of dark 14
control (Fig. 6). These data suggest the association of elevated H2O2 level, NADPH
15
oxidase, external calcium influx, and de novo synthesized proteins with ethephon-16
mediated enhancement of catalase SPCAT1 gene expression. 17
18
Ethephon-mediated leaf senescence and elevated H
2O
2level were
19
delayed or attenuated by exogenous catalase SPCAT1 fusion protein
20 21
Sweet potato catalase SPCAT1 full-length cDNA was constructed with PET30a 22
expression vector and induced to express the corresponding SPCAT1 fusion protein 23
by 1 mM IPTG within 5 hours after treatment (Fig. 7A). The expressed catalase 24
SPCAT1 fusion protein was purified (Fig. 7B) and used for exogenous application 25
with ethephon together. Influence of exogenous catalase SPCAT1 fusion protein on 26
ethephon-mediated effects on leaf senescence, chlorophyll content, photochemical 27
Fv/Fm, and H2O2 level was shown. Ethephon significantly promoted leaf senescence
28
(Fig. 7C), decrease of chlorophyll content (Fig. 7D), reduction of photochemical 29
Fv/Fm (Fig. 7E), and elevation of H2O2 levels (Fig. 7F) in leaves at 72 h after
30
treatment. These ethephon-mediated effects were all significantly delayed or alleviated 31
by exogenous catalase SPCAT1 fusion proteins (Fig. 7). Ethephon-mediated leaf 32
senescence were significantly delayed or alleviated by exogenously applied purified 33
catalase SPCAT1 fusion protein at both doses, 0.2 mg and 2.0 mg, respectively (Fig. 34
7C). For chlorophyll content, it was assigned as 100% for D3 control sample. The 35
chlorophyll content decreased significantly to about 14.4% for ethephon-treated E3 36
sample, and the reduction was remarkably alleviated by exogenous application of 37
purified catalase SPCAT1 fusion protein at doses of 0.2 mg (ca. 24.4%) and 2.0 mg 38
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
(32.3%), respectively (Fig. 7D). For photochemical Fv/Fm, the value of D3 control 1
sample was assigned as 100%. The photochemical Fv/Fm value decreased 2
significantly to about 54.4% for ethephon-treated E3 sample, and the reduction was 3
remarkably delayed by exogenous application of purified catalase SPCAT1 fusion 4
protein at doses of 0.2 mg (ca. 81.3%) and 2.0 mg (74.5%), respectively (Fig. 7E). For 5
H2O2 level, the amount of D3 control sample was assigned as 100%. The H2O2
6
amount increased significantly to about 216.9% for ethephon-treated E3 sample, and 7
the increase was remarkably attenuated by exogenous application of purified catalase 8
SPCAT1 fusion protein at doses of 0.2 mg (ca. 126.3%) and 2.0 mg (ca. 136.2%), 9
respectively (Fig. 7F). These data clearly demonstrate that sweet potato catalase 10
SPCAT1 can alleviate ethephon-mediated leaf senescence and H2O2 elevation in vitro.
11
A role of sweet potato catalase SPCAT1 in association with the regulation of H2O2
12
homeostasis and attenuation of leaf senescence caused by ethephon in sweet potato 13
leaves is also suggested. 14 15 16
Discussion
17 18Plant catalases have been intensively studied and function mainly in the removal 19
of excessive H2O2 generated during developmental processes or by environmental
20
stimuli into water and oxygen in all aerobic organisms (Mhamdi et al., 2010). 21
Catalases are generally composed of a multigene family and various plant catalase 22
isoforms are temporally and spatially regulated and may respond differentially to 23
developmental and environmental stimuli (Zimmermann et al., 2006). Sweet potato 24
catalase SPCAT1 exhibited high amino acid sequence homologies (71.2% to 80.9%) 25
with several plant catalases, including Arabidopsis, eggplant, grey mangrove, pea, 26
potato, tobacco and tomato (Fig. 1). From RT-PCR, SPCAT1-encoded products could 27
be detected at mRNA levels (Figs. 4 and 5). The open reading frame of SPCAT1 was 28
also constructed in recombinant PET30a vector and expressed in E. coli BL21 (DE3) 29
cells. A fusion protein with molecular mass near 55 kDa was detected (Fig. 7A). 30
Exogenous application of expressed catalase SPCAT1 fusion protein delayed or 31
alleviated ethephon-mediated H2O2 elevation and leaf senescence (Fig. 7). These data,
32
therefore, provide evidence to support sweet potato catalase SPCAT1 as a functional 33
gene. 34
Protein structural analysis showed that sweet potato catalase SPCAT1 contained 35
the putative consensus internal PTS1 motif (QKV) around the C-terminus (Figs. 1 and 36
2A). In pumpkin, the CAT1 catalase C-terminal portion was fused with green 37
fluorescence protein (GFP) and expressed in tobacco BY-2 cells in order to identify 38
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
the possible peroxisomal targeting signal. The results showed that removal of the 1
tripeptides at the C-terminus did not affect pumpkin CAT1 targeting to peroxisome. 2
However, the amino acid region (QKL) from 13 to 11 around or at the C-terminal 3
portion functions as an internal PTS1 sequence. Deletion of the tripeptides affects 4
CAT1 import into peroxisome. Analysis of the binding of CAT1 to PTS1 receptor 5
(Pex5p) by the yeast two-hybrid system revealed that CAT1 can bind with the PTS1 6
receptor (Pex5p) (Kamigaki et al., 2003). These data indicates that pumpkin CAT1 is 7
imported into peroxisomes by the PTS1 system. Comparison of several plant catalases 8
showed that the internal PTS1 sequence around the C-terminal region from the 9
positions 13 to 11 were also found in catalases of castor bean, cotton, maize, sweet 10
potato, Arabidopsis, sunflower, barley, pea, tobacco and tomato as mentioned in 11
Figure 2A. The amino acid sequences of catalases from Arabidopsis (QKL), barley 12
(QKL), pea (QKL), sunflower (QKI), tobacco (QKL) and tomato (QKV) showed that 13
QKL/I/V was conserved in the positions 13–11 (González, 1991; Kamigaki et al., 14
2003). Our data agree with these reports and suggest the consensus QKV tripeptide 15
may function as an internal PTS1 for sweet potato catalase SPCAT1 import into 16
peroxisome similar to PTS1 (QKL) for pumpkin CAT1. Further experiments are 17
required in order to prove the role of QKV in peroxisomal targeting in sweet potato. 18
In Arabidopsis, two C-terminal deletion mutants of CAT3 was used to identify the 19
possible cambodulin binding domain with 35S-CaM-binding assays. In the presence 20
of calcium, the calmodulin binding region was restricted to the 415th to 451st amino 21
acid region of CAT3. Synthetic peptide according to the consensus sequence also 22
binds to the expressed calmodulin, and the binding was repressed in the presence of 23
EGTA (Yang and Poovaiah, 2002). Sweet potato SPCAT1 also contained the putative 24
consensus calmodulin binding domain within the C-terminal portion similar to 25
Arabidopsis CAT3 (Figs. 1 and 2B). These data suggest that the enzymatic activity of
26
sweet potato SPCAT1 may also be regulated and activated by calmodulin similar to 27
the report of Arabidopsis CAT3. 28
Mhamdi et al. (2010) described that plant catalases were probably divided into 29
three classes in Arabidopsis, maize, pumpkin, rice and tobacco based on the report of 30
Willekens et al. (1995). Class I contains Arabidopsis CAT2, maize CAT2, pumpkin 31
CAT2, rice CATC and tobacco CAT1. Class II contains Arabidopsis CAT3, maize 32
CAT3, pumpkin CAT3, rice CATA and tobacco CAT2. Class III contains 33
Arabidopsis CAT1, maize CAT1, pumpkin CAT1, rice CATB and tobacco CAT3.
34
Phylogenetic tree analysis showed that SPCAT1 exhibited more closely-related 35
association with class I plant catalases including Arabidopsis CAT2 and tobacco 36
CAT1 than class III plant catalases such as Arabidopsis CAT1 and tobacco CAT3. 37
Sweet potato SPCAT1 exhibited more distantly-related association with class II plant 38
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
catalases including Arabidopsis CAT3 and tobacco CAT2 (Fig. 2). In sweet potato, 1
SPCAT1 expression level was higher in L3 mature and early L4 senescent leaves,
2
however, was lower in immature L1, L2 and completely yellowing L5 leaves (Fig. 4). 3
In tobacco, the CAT1 was the predominant one and present earlier 8 days post-4
germination and continuously increased and reached maximum 21 days post-5
germination, then decreased gradually (Havir and McHale, 1987). In Arabidopsis 6
leaves, the CAT2 is the major catalase isoform. Its activity increased and reached 7
maximum at mature leaves, then, decreased gradually after transition from vegetative 8
to reproductive phases and senescence of plant (Zimmermann et al., 2006). Our data 9
agree with these reports and suggest that sweet potato SPCAT1 likely belongs to class 10
I catalase and exhibits expression pattern similar to Arabidopsis CAT2 and tobacco 11
CAT1 during leaf development. 12
In sweet potato, SPCAT1 gene expression level was enhanced temporarily by dark 13
and ethephon treatments (Fig. 5). These data agree with our previous enzymatic 14
catalase activity assay (Chen et al., 2011). Similar results were observed for grey 15
mangrove CAT1 gene expression, which was also temporarily enhanced by salt 16
treatment (Jithesh et al., 2006). Sweet potato SPCAT1 gene expression level also 17
exhibited negative correlation with H2O2 amount in dark-treated, ethephon-treated and
18
different developmental stages of leaves (Figs. 4 and 5). Exogenous application of 19
purified catalase SPCAT1 fusion protein (0.2 mg and 2.0 mg, respectively) delayed or 20
alleviated ethephon-mediated leaf senescence and elevation of H2O2 amount in sweet
21
potato leaves (Fig. 7). In Arabidopsis, the growth of a peroxisomal catalase 2 knock-22
out mutant (cat2) was severely decreased in rosette biomass under ambient air, and 23
significant increase of intracellular H2O2 level was also observed (Queval et al., 2007;
24
Mhamdi et al., 2010). Transgenic tobacco plants expressing antisense construct of 25
peroxisomal CAT1 displayed severely reduced catalase activity and developed 26
chlorosis and necrosis on some of the lower leaves due to the remarkable elevation of 27
H2O2 amount (Takahashi et al., 1997). In transgenic tobacco plant Cat1AS expressing
28
tobacco CAT1 antisense construct, the catalase activity was significantly reduced to ca. 29
10% that of wild type control. The CAT1 deficiency plant also exhibited reduced 30
H2O2-removing capacity and, consequently, led to higher steady-state levels of H2O2
31
inside leaves, chlorophyll bleaching and glossary necrotic spots on leaves under 32
stresses such as high light, paraquat, H2O2 and ozone treatments. Exogenous
33
application of commercial bovine catalase complemented the bleaching effects caused 34
by high light exposure in CAT1 deficiency plant leaves (Willekens et al., 1997). Our 35
results agree with these reports and support a role of sweet potato catalase SPCAT1 36
similar to Arabidopsis CAT2 and tobacco CAT1 in the regulation of plant cellular 37
