Inhibition of lipopolysaccharide-induced nitric oxide production by
flavonoids in RAW264.7 macrophages involves heme oxygenase-1
Hui-Yi Lin
a, Shu-Hui Juan
b, Shing-Chuan Shen
c,d,
Feng-Lin Hsu
e, Yen-Chou Chen
e,*a
Graduate Institute of Pharmaceutical Sciences, School of Pharmacy, Taipei Medical University, Taipei, Taiwan, ROC
b
Department of Physiology, Taipei Medical University, Taipei, Taiwan, ROC
cDepartment of Dermatology, School of Medicine, Taipei Medical University, Taipei, Taiwan, ROC d
Department of Dermatology, Taipei Municipal Wan-Fang Hospital, Taipei, Taiwan, ROC
e
Graduate Institute of Pharmacognosy, School of Pharmacy, Taipei Medical University, Taipei, Taiwan, ROC Received 22 January 2003; accepted 12 May 2003
Abstract
The role of heme oxygenase-1 (HO-1) played in the inhibitory mechanism of flavonoids in lipopolysaccharide (LPS)-induced responses remained unresolved. In the present study, flavonoids, including 3-OH flavone, baicalein, kaempferol, and quercetin, induced HO-1 gene expression at the protein and mRNA levels in the presence or absence of LPS in RAW264.7 macrophages. This effect was associated with suppression of LPS-induced nitric oxide (NO) production and inducible nitric oxide synthase (iNOS) protein expression. Hemin induced HO-1 protein expression and this was associated with the suppression of LPS-induced NO production and iNOS protein expression in a dose-dependent manner. In addition, an increase in bilirubin production was found in flavonoid- and hemin-treated cells. Hemin, at the doses of 10, 20, and 50 mM, dose-dependently stimulated the flavonoid (50 mM)-induced HO-1 protein expression, and enhanced their inhibitory effects on LPS-induced NO production and iNOS protein expression. Pretreatment of the HO-1 inhibitor, tin protoporphyrin (10 mM), attenuated the inhibitory activities of the indicated flavonoids on LPS-induced NO production. Morphologic analysis showed that 3-OH flavone, baicalein, kaempferol, quercetin, hemin, and tin protoporphyrin did not cause any change in cell viability in the presence or absence of LPS. In contrast, only 3-OH flavone showed a significant inhibition of cell growth using the MTT assay. Transfection of an HO-1 vector in macrophages (HO-1/RAW264.7) resulted in a 3-fold increase in HO-1 protein compared with that the parental RAW264.7 cells. NO production mediated by LPS in HO-1 over-expressed RAW264.7 cells (HO-1/RAW264.7) was significant less than that in parental RAW264.7 cells. 3-OH Flavone, baicalein, kaempferol, and quercetin showed a more significant inhibition on LPS-induced NO production in HO-1/RAW264.7 cells than in parental RAW264.7 cells. These results provide evidence on the role of HO-1 in the inhibition of LPS-induced NO production by flavonoids. A combination of HO-1 inducers (i.e. hemin) and flavonoids might be an effective strategy for the suppression of LPS-induced NO production.
# 2003 Elsevier Inc. All rights reserved.
Keywords: Flavonoid; Lipopolysaccharides; Nitric oxide; Inducible nitric oxide; Heme oxygenase-1
1. Introduction
Heme oxygenase (HO) is the rate-limiting enzyme in the oxidative degradation of heme into bilirubin, iron, and CO, whereas HO-2 and HO-3 are constitutively expressed and HO-1 is the inducible form that provides protection against
oxidative stress[1,2]. HO-1-null mice and HO-1-deficient
humans showed that HO-1 is an important molecule in the host’s defense against oxidative stress and that it has potent anti-inflammatory properties because both HO-1-deficient
0006-2952/$ – see front matter # 2003 Elsevier Inc. All rights reserved. doi:10.1016/S0006-2952(03)00422-2
*Corresponding author. Tel.:þ886-2-27361661x6152;
fax:þ886-2-23787139.
E-mail address: [email protected] (Y.-C. Chen).
Abbreviations: HO-1, heme oxygenase-1; NO, nitric oxide; LPS, lipopolysaccharide; SnPP, tin protoporphyrin; iNOS, inducible nitric oxide synthase; CO, carbon monoxide; MTT, 3-(4,dimethylthiazol-2-yl)-2,diphenyl tetrazolium bromide; NBT, nitroblue tetrazolium; BCIP, 5-bromo-4-chloro-3-indolyl phosphate; RT–PCR, reverse transcriptase– polymerase chain reaction; ELISA, enzyme-linked immunosorbent assay; GAPDH, glutaldehyde-3-phosphate dehydrogenase.
mice and humans have a phenotype of an increased
inflammatory state [3,4]. Enhancement of HO-1 protein
through the use of agonists prevented the development of hypoxic pulmonary hypertension and indicated that CO might be involved in the vasodilating and antiproliferative
action[5–7]. Exogenous administration of HO-1 by gene
transfer protected lung cells from free radical-induced lethal effects and showed potent anti-inflammatory effects
in the lung[8,9]. Willis et al. reported that induction of HO
activity and HO-1 expression in macrophages inhibits a carragenin-induced pleural model of acute inflammation in
rats[10]. Inhibition of HO activity may result in increased
inflammatory responses, and prior induction of HO enzyme activity causes a dramatic decrease in
inflamma-tory parameters [10–12]. These previous data suggested
that induction of HO is beneficial in response to stressful situations, such as inflammation; however, the action of HO in the anti-inflammatory process remains unclear.
Production of NO is modulated by NOS, which converts
L-arginine toL-citrulline, accompanied by NO production.
At least three NOS have been identified, including endothelial NOS (eNOS), iNOS, and neural NOS (nNOS). The small amount of NO produced by constitutive NOS, including eNOS and nNOS, is an important regulator of physical homeostasis, whereas the large amount of NO produced by iNOS has been closely correlated with the pathophysiology in a variety of diseases and inflammation. After exposure to inducers, such as LPS from negative bacteria or lipoteichoic acid (LTA) from Gram-positive bacteria, iNOS can be induced quantitatively in various cells, such as macrophages, smooth muscle cells, and hepatocytes, to trigger several disadvantageous cellu-lar responses and caused responses simicellu-lar to
inflamma-tion, sepsis, and stroke[13,14]. Therefore, NO production
induced by LPS or LTA through iNOS induction may reflect the degree of inflammation and may provide a measure to assess the effect of drugs on the inflammatory process.
Flavonoids have been identified as either simple or complex glycosides in plants, and humans have been estimated to consume approximately 1 g of flavonoids/
day[15]. Several beneficial biological effects of flavonoids
have been identified, including antioxidant, free radical-scavenging, anticancer, and anti-inflammatory activities [16–20]. Although flavonoids with multiple beneficial biological functions, application of flavonoids in treatment of human diseases is not popular due to their poor absorp-tive efficacy and higher effecabsorp-tive doses. Therefore, trying to understand their action mechanism and interaction with other compounds is an important issue. Our recent studies have demonstrated that flavonoids, such as oroxylin A, quercetin, and wogonin, show potent inhibitory activities
on LPS-induced NO and PGE2 production through
sup-pression of iNOS and COX-2 protein exsup-pression[18–20].
In the present study, we show scientific evidences that 3-OH flavone, baicalein, kaempferol, and quercetin, are
potent HO-1 inducers in RAW264.7 macrophages, and the relationship of HO-1 and inhibitory activities of flavonoids on LPS-induced NO production will be demonstrated in the present study.
2. Materials and methods 2.1. Cells
RAW264.7, a mouse macrophage cell line, was obtained from the American Type Culture Collection. Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 2 mM glutamine, antibiotics (100 units/mL penicillin A and 100 units/mL streptomy-cin), and 10% heat-inactivated fetal bovine serum (FBS; Gibco/BRL) and maintained in a 378 humidified incubator
containing 5% CO2.
2.2. Agents
The four structurally related flavonoids, including 3-OH flavone, baicalein, kaempferol, and quercetin, were obtained from Sigma Chemical Co. LPS (Escherichia coli, serotype 055:B5),
3-(4,5-dimethylthiazol-2-yl)-2,5-diphe-nyl tetrazolium bromide (MTT), BaCl22H2O, hemin,
and tin protoporphyrin (SnPP) were purchased from Sigma. Benzene and Giemsa solution were purchased from Merck. The antibodies of HO-1, iNOS, anti-COX-2, and anti-a-tubulin were obtained from Santa Cruz Biotechnology.
2.3. Morphological assay
RAW264.7 cells were plated at a density of 5 105cells/
well into 24-well plates for 12 hr and treated with indicated compounds for a further 12 hr. The supernatant was removed and cells were washed twice with PBS. Giemsa solution was added into the cells, and extra-Giemsa solution was removed by PBS. The alternative morphology of cells was detected under microscopy observation.
2.4. Cell viability assay
MTT was used as an indicator of cell viability as determined by the mitochrondrial-dependent reduction to formazone. RAW264.7 cells were plated at a density
of 105cells/well into 96-well plates for 12 hr, followed by
treatment with different concentrations of each compound for a further 16 hr. Cells were washed with PBS three times and MTT (50 mg/mL) was added to the medium for 4 hr. Furthermore, the supernatant was removed, and the for-mazone crystals were dissolved using 0.04 N HCl in isopropanol. The absorbance was read at 600 nm with an ELISA analyzer (Dynatech MR-7000; Dynatech
2.5. Determination of bilirubin in culture medium
RAW264.7 cells were plated a density of 5 105cells/
well into 24-well plates for 12 hr and treated indicated compounds for 12 hr. The 0.5 mL supernatant was
collected and 250 mg BaCl22H2O was added. After
vortexing, 0.75 mL benzene was added and mixed well again. The benzene phase containing the bilirubin was separated by centrifugation for 30 min at 13,000 g. The extraction of bilirubin was determined as a difference in
absorbance between 450 and 600 nm (e450: 27.3 mM1,
cm1)[21,22]. 2.6. Nitrite assay
RAW264.7 cells were plated at a density of 5 105cells/
mL in 24-well plates for 12 hr, followed by treatment with LPS (50 ng/mL) and different concentrations of the indi-cated compounds, such as flavonoids, hemin, and SnPP, for a further 12 hr. The amount of NO production in the medium was detected with the Griess reaction. One hundred microliters of each supernatant was mixed with the same volume of Griess reagent (1% sulfanilamide in 5% phos-phoric acid and 0.1% naphthylethylenediamine dihy-drochloride in water). The absorbance of the mixture at 530 nm was determined with an ELISA plate reader (Dyna-tech MR-7000; Dyna(Dyna-tech Laboratories), and nitrite concen-tration was determined using a dilution of sodium nitrite as a standard[19].
2.7. Western blotting
Total cellular extracts were prepared according to our
previous papers[18–20], separated on 8–12%
SDS–acrylamide minigels, and transferred to immobilon poly-vinylidenedifluoride membranes (Millipore). Membranes were incubated with 1% BSA and then incubated with anti-iNOS, anti-COX-2, or anti-a-tubulin antibodies (Santa Cruz Biotechnology) overnight at 48. Expression of protein was detected by staining with NBT and BCIP
(Sigma)[18].
2.8. Reverse transcriptase–polymerase chain reaction (RT–PCR)
RAW264.7 cells were treated with each of the flavonoid compounds (100 mM) for 6 hr and then washed with ice-cold PBS. Total RNA was isolated by RNAzol B (Amer-sham), and the total RNA concentration was detected using a spectrophotometer. Total RNA (2 mg) was converted to cDNA with oligo d(T). PCR was performed on the cDNA using the following sense and antisense primers, respec-tively, for HO-1: CTGTGTAACCTCTGCTGTTCC and
CCACACTACCTGAGTCTACC; and
glutaldehyde-3-phosphate dehydrogenase (GAPDH): TGAAGGTCGGT-GTGAACGGATTTGGC and
CATGTAGGCCATGAGG-TCCACCAC. PCR of the cDNA was performed in a final volume of 50 mL containing PCR primers, oligo d(T), total
RNA, and DEPCH2O. The amplification sequence
proto-col was 958 for 30 s, 548 for 30 s, 728 for 45 s for 35 cycles. The PCR products were separated by electrophoresis on 1.2% agarose gels and visualized by ethidium bromide staining[21].
2.9. Establishment of HO-1 transfectants
The pCMV-HO-1, a constitutive expression vector, car-ries full-length human HO-1 cDNA under control of the
CMV promoter/enhancer sequence. We transfected
pCMV-HO-1 or pCMV into RAW264.7 cells using the
TransfastTM transfection reagent (Promega Co). After
48 hr, cells were trypsinized and replated in DMEM with 10% FBS and 400 mg/mL G418. G418 resistant cells were selected and expanded. The level of HO-1 was analyzed by Western blotting.
2.10. Statistical analysis
Values are expressed as the mean SE. The significance
of the difference from the respective controls for each experimental test condition was assayed by using Student’s t-test for each paired experiment. A P value <0.05, or 0.01, was regarded as indicating a significant difference.
3. Results
3.1. Induction of HO-1 gene expression and bilirubin production by 3-OH flavone, baicalein, kaempferol, and quercetin in RAW264.7 macrophages
The chemical structures of 3-OH flavone, baicalein, kaempferol, and quercetin used in the present study are
shown in Fig. 1. In 3-OH flavone-, baicalein-,
kaemp-ferol-, and quercetin- (100 mM) treated RAW264.7 cells, HO-1 protein was induced in a time-dependent manner, and the largest induction of HO-1 protein by the indicated
flavonoids appeared at 12 hr (Fig. 2A). In the same part of
the experiment, RAW264.7 cells were treated with dif-ferent doses (50, 100, and 200 mM) of the indicated flavonoids for 12 hr, and the expression of HO-1 protein
was analyzed by Western blotting. Results in Fig. 2B
show that a dose-dependent induction of HO-1 protein was detected in 3-OH flavone-, baicalein-, kaempferol-, and quercetin-treated macrophages. In order to determine if induction of HO-1 gene expression by 3-OH flavone, baicalein, kaempferol, and quercetin appeared at the transcriptional level, RT–PCR using specific primers for HO-1 and GAPDH was performed. Results in Fig. 2C show that 3-OH flavone, baicalein, kaempferol, and quercetin (100 mM) induced HO-1 gene expression at the mRNA level. The mRNA level of GAPDH in
O O OH O O OH OH OH OH O O OH OH OH O O OH OH OH OH OH 3-OH flavone Baicalein Kaempferol Quercetin
Fig. 1. Chemical structures of 3-OH flavone, baicalein, kaempferol, and quercetin.
Fig. 2. Induction of HO-1 gene expression by 3-OH flavone, baicalein, kaempferol, and quercetin in RAW264.7 macrophage cells. (A) Time-dependent induction of HO-1 protein by flavonoids. RAW264.7 cells were treated with 3-OH flavone, baicalein, kaempferol, and quercetin (100 mM) for 4, 8, 12, and 24 hr and expression of HO-1 protein in cells was analyzed by Western blotting. (B) Dose-dependent induction of HO-1 protein by flavonoids. Cells were treated with different concentrations (50, 100, and 200 mM) of the indicated compounds for 12 hr, and the expression of HO-1 protein was analyzed. a-Tubulin was used as an internal control. C: control. (C) Induction of HO-1 mRNA levels by flavonoids. RAW264.7 cells were treated with 3-OH flavone, baicalein, kaempferol, and quercetin (100 mM) for 6 hr and total cellular RNA was extracted. Expression of HO-1 mRNA was examined by RT–PCR using specific primers for the HO-1 gene; and GAPDH was used as an internal control.
cells under different treatments remained unchanged in the RT–PCR assay as an internal control. Furthermore, MTT assay and morphological observation were per-formed to examine the direct effects of flavonoids on RAW264.7 cells. Results of morphological study showed that 3-OH flavone, baicalein, kaempferol, and quercetin did not cause morphological change in cells under micro-scopic observation. In the MTT assay, 3-OH flavone but not others showed the significant growth inhibition in
cells, compared with control (Fig. 3A and B). Activation
of HO-1 enzyme converts heme to bilirubin, an indicative of HO activity. In order to identify if activation of HO-1 enzyme activity in flavonoid-treated cells, production of
bilirubin in medium was measured by a BaCl2extraction
method as described in Section 2. Results of Fig. 3C
showed that 3-OH flavone, baicalein, kaempferol, and quercetin significantly induced bilirubin production in RAW264.7 cells. HO-1 inducer hemin induction of bilir-ubin production was described as a positive control. These results demonstrate that 3-OH flavone, baicalein, kaempferol, and quercetin are potent HO-1 inducers, and induction of HO-1 gene expression by these flavonoids
were examined at both the transcriptional and transla-tional levels.
3.2. Inhibition of LPS-induced NO production and iNOS protein by 3-OH flavone, baicalein, kaempferol, and quercetin associated with an increase of HO-1 protein in RAW264.7 cells
In the present study, effects of 3-OH flavone, baicalein, kaempferol, and quercetin on LPS-induced NO produc-tion in RAW264.7 macrophages were investigated. Nitrite, which had accumulated in the culture medium, was estimated using the Griess reaction as an index for NO synthesis from cells. None of the compounds, at a concentration of 200 mM, interfered with the reaction between nitrite and the Griess reagents (data not shown). After a 12 hr incubation, unstimulated macrophages pro-duced a background level of nitrite of about 2 mM in the culture medium. When cells were incubated with 3-OH flavone, baicalein, kaempferol, or quercetin alone, the amount of nitrite in the medium was maintained at a background level similar to that in the unstimulated
Fig. 3. Effects of flavonoids in RAW264.7 cells by morphological observation, MTT assay, and bilirubin production assay. (A) RAW264.7 cells were treated indicated compounds (100 mM) or SnPP (10 mM) for 12 hr in the presence or absence of LPS, and the morphology of cells was detected by Giemsa staining, followed by a microscopic observation. (B) RAW264.7 cells were treated indicated compounds (100 mM) and SnPP (10 mM) with or without LPS (50 ng/mL) for 12 hr, and the growth condition of cells was determined by MTT assay. (C) RAW264.7 cells were treated indicated compounds (100 mM) for 12 hr, and the amount of bilirubin in the medium was measured as described inSection 2. Data were obtained from six independent experiments, and expressed as the mean SE.P< 0:05,P< 0:01 indicate significant difference from the control-treated group, and#
P< 0:05 indicates significant difference from the LPS-treated group as analyzed by Student’s t-test.
samples (data not shown). After treatment with LPS (50 ng/mL) for 12 hr, nitrite concentration in the medium increased remarkably by about 40 mM. When RAW264.7 macrophages were treated with different concentrations of indicated compounds together with LPS (50 ng/mL) for 12 hr, a concentration-dependent inhibition of nitrite pro-duction was detected in the presence of 3-OH flavone,
baicalein, kaempferol, and quercetin (Fig. 4B). TheIC50
values for 3-OH flavone, baicalein, kaempferol, and quercetin on LPS-induced NO production were 32.37, 55.75, 37.84, and 16.52 mM, respectively. Furthermore, the effects of the indicated flavonoids on LPS-induced iNOS and COX-2 protein expression were examined by Western blotting. HO-1 protein was increased slightly in LPS-treated cells, and 3-OH flavone, baicalein, kaemp-ferol, and quercetin all inhibited LPS-induced iNOS protein and induced HO-1 protein in dose-dependent manners; however, the expression of COX-2 protein induced by LPS did not change under treatment with
the indicated flavonoids (Fig. 4A).
3.3. The HO-1 inducer, hemin, inhibited LPS-induced NO production and iNOS protein, associated with increasing HO-1 protein
In order to study the relationship between HO-1 protein and LPS-induced NO production, a well-known HO-1 inducer hemin was used in the study. In the absence of LPS, hemin showed a concentration-dependent induction of
HO-1 protein in RAW264.7 macrophages (Fig. 5A). In the
presence of LPS (50 ng/mL), HO-1 inducer hemin exhibited concentration-dependent inhibition of LPS-induced NO production, accompanied by a concentration-dependent
induction of HO-1 protein (Fig. 5B and C). Analysis of
iNOS protein expression by Western blotting showed that hemin concentration-dependently inhibited LPS-induced
iNOS protein expression (Fig. 5B). MTT assays indicated
that hemin at the highest test dose showed no significant
cytotoxicity in RAW264.7 macrophages (Fig. 3A and B). It
is suggested that induction of HO-1 gene expression was able to inhibit LPS-induced NO production.
Fig. 4. 3-OH Flavone, baicalein, kaempferol, and quercetin inhibition of LPS-induced iNOS and NO production, associated with increasing HO-1 protein expression. (A) Cells were treated with LPS (50 ng/mL) in the presence of different concentrations (50, 100, and 200 mM) of 3-OH flavone, baicalein, kaempferol, and quercetin for 12 hr, and expressions of iNOS, COX-2, HO-1, and a-tubulin protein were detected by Western blotting. C: control. L1: LPS.
(B) NO production in the medium under different treatments was measured by the Griess reaction. The amount of NO production was quantitatively assessed using NaNO2as a standard. Data were obtained from three independent experiments and are expressed as the mean SE.P< 0:01 indicates a significant
3.4. Pretreatment of macrophages with the flavonoids or hemin inhibits following LPS-induced NO production and iNOS gene expression
Previous data indicated the simultaneous treatments of compounds with LPS suppress NO production and iNOS gene expression, accompanied by inducing HO-1 protein. It is interesting to identify if HO-1present induced by flavo-noids or hemin prior to LPS treatment also showed the inhibitory effect on LPS-induced NO production. Results in Fig. 3indicated that flavonoids time-dependently induced HO-1 protein expression. Therefore, macrophages were pretreated with indicated flavonoids or hemin for 8 hr prior to LPS treatment, and NO production and iNOS gene
expression were analyzed. Results of Fig. 6showed that
pretreatment of cells with 3-OH flavone, baicalein, kaemp-ferol, and quercetin (50 and 100 mM) for 8 hr inhibits
LPS-induced iNOS gene expression and NO production (Fig. 6).
Similarly, hemin (50 and 100 mM) pretreatment inhibits LPS-induced iNOS gene expression and NO production in
RAW264.7 cells (Fig. 6). These data suggested that HO-1
induced by flavonoids or hemin prior to LPS treatment inhibits NO production and iNOS gene expression.
3.5. Co-inhibitory effects of hemin and indicated flavonoids on LPS-induced NO production and iNOS protein expression
Results described above indicated that induction of the HO-1 protein might be involved in the inhibition by flavonoids of LPS-induced NO production. In order to provide evidence to identify if induction of HO-1 participated in flavonoid-inhibited NO production, macro-phages were treated with the indicated flavonoids (50 mM) with or without low doses of hemin (10, 20, and 50 mM) in the presence of LPS (50 ng/mL) for 12 hr, and NO production, iNOS and HO-1 proteins expression were analyzed by Griess reaction and Western blotting, respec-tively. Hemin at the doses of 10, 20, and 50 mM showed a slight inductive effect on HO-1 protein expression and exhibited a slight inhibition on LPS-induced NO
production as shown in Fig. 5B and C. Results in Fig. 7
show that hemin dose-dependently enhanced the inhibitory activities of 3-OH flavone, baicalein, kaempferol, and quercetin on LPS-induced NO production and iNOS protein expression, associated with stimulating 3-OH flavone-, baicalein-, kaempferol-, and quercetin-induced
Fig. 5. HO-1 inducer hemin inhibition of LPS-induced iNOS protein and NO production, with increasing HO-1 protein. (A) Dose-dependent induction of HO-1 protein by the HO-1 inducer, hemin. Cells were treated with hemin (10, 20, 50, and 100 mM) for 12 hr, and expressions of HO-1 and a-tubulin protein were analyzed as described inFig. 2. (B) Dose-dependent inhibition of iNOS protein expression by hemin. Cells were treated with different concentrations of hemin in the presence of LPS (50 ng/mL) for 12 hr; expressions of iNOS, HO-1, and a-tubulin protein were examined by Western blotting. a-Tubulin was used as an internal control. C: control. L: LPS. (C) The amount of NO produced in the medium under different treatments as measured by the Griess reaction, with NaNO2used as a standard. Data were obtained from three independent experiments and are expressed as the mean SE.P< 0:05,P< 0:01 indicate
HO-1 protein expression. These data demonstrate that induction of HO-1 protein expression by the HO-1 inducer hemin was able to potentiate the inhibitory effects of the indicated flavonoids on LPS-induced NO production, and an additive effect of hemin and the indicated flavonoids on LPS-induced NO production was observed.
3.6. The HO inhibitor, SnPP, attenuated the inhibitory activities of 3-OH flavone, baicalein, kaempferol, and quercetin on LPS-induced NO production
SnPP has been described as an inhibitor of HO activity [23,24]. Therefore, co-treatment of macrophages with 3-OH flavone, baicalein, kaempferol, and quercetin (50 mM) with or without SnPP in the presence of LPS (50 ng/mL) was performed, and the amount of NO production was measured with the Griess reaction. The amount of NO in the medium increased in LPS-treated cells, while 3-OH
flavone, baicalein, kaempferol, and quercetin inhibited its induction. Co-treatment of cells with SnPP and the indi-cated flavonoids in the presence of LPS significantly attenuated their inhibitory activities of flavonoids on
LPS-induced NO production (Fig. 8). These data suggest
that activation of HO-1 participated in the inhibitory mechanism of flavonoids 3-OH flavone, baicalein, kaemp-ferol, and quercetin on LPS-induced NO production. 3.7. Over-expression of HO-1 protein potentiated the inhibitory activity of flavonoids on LPS-induced NO production
In order to provide more direct evidence to support HO-1 could be involved in flavonoid-inhibited NO production, HO-1 over-expressed RAW264.7 cells were established in our study. RAW264.7 macrophages cells were transfected with HO-1 expression vector, and a stable clone of HO-1
Fig. 6. Pretreatment of 3-OH flavone, baicalein, kaempferol, quercetin, or hemin inhibits LPS-induced iNOS gene expression and NO production. Macrophages pretreated with 3-OH flavone, baicalein, kaempferol, quercetin or hemin (50 and 100 mM) for 8 hr followed by LPS treatment (50 ng/mL) for a further 12 hr. The expression of iNOS protein expression (A) and NO production (B) were examined by Western blotting and Griess reaction, respectively. Data were obtained from three independent experiments and are expressed as the mean SE.P< 0:01 indicates significant difference from the LPS-treated group, as analyzed by Student’s t-test.
over-expressed RAW264.7 macrophages was established by G418 selection method (HO-1/RAW264.7). The control vector (pCMV) transfected RAW264.7 cells show the same HO-1 protein expression and NO production induced by LPS as in parental RAW264.7 cells (data not shown). Western blotting analysis was performed to identify the
inductive level of HO-1 protein in HO-1/RAW264.7 cells.
Results ofFig. 9Ashowed that expression of HO-1 protein
was increased about 3-fold in HO-1/RAW264.7 cells, compared with parental RAW264.7 macrophages. In the presence of different doses of LPS, NO production induced by LPS in HO-1/RAW264.7 is significant less than that in
Fig. 7. Stimulation by low doses of hemin of the inhibitory activities of flavonoids on LPS-induced NO production. Cells were treated with low doses of hemin (10, 20, and 50 mM) and the indicated flavonoids, including 3-OH flavone, baicalein, kaempferol, and quercetin (50 mM), in the presence of LPS (50 ng/mL) for 12 hr. (A) Expressions of iNOS, HO-1, and a-tubulin protein were examined by Western blotting using specific antibodies. Band intensities of iNOS and HO-1 were quantified by densitometry analysis, and the data were expressed as mean ratio of iNOS/a-tubulin and HO-1/a-tubulin derived from three independent experiments. (B) The amount of NO produced in the medium under different treatments was measured by the Griess reaction. Data were obtained from three independent experiments and are expressed as the mean SE.P< 0:05,P< 0:01 indicate significant differences from the indicated
parental RAW264.7 cells (Fig. 9B). It is indicated that HO-1 over-expression attenuated the responses of cells to LPS. Accordingly, 3-OH flavone, baicalein, kaempferol, and quercetin showed more significant inhibition on LPS-induced NO production in HO-1/RAW264.7 cells than
that in parental RAW264.7 cells (Fig. 9C). These data
show that HO-1 may participate in flavonoids inhibition of LPS-induced NO production, and increasing intracellular HO-1 protein potentiates the inhibitory activity of flavo-noids on LPS-induced NO production.
4. Discussion
Flavonoids exist extensively in the plants and multiple
biological functions in several previous studies [25–27].
However, the role that HO-1 plays in the inhibitory effects of flavonoids on LPS-induced NO production has remained unclear. In the present study, we demonstrate that 3-OH flavone, baicalein, kaempferol, and quercetin were able to inhibit LPS-induced NO production, accompanied by the induction of HO-1 gene expression. The inhibitory effects of 3-OH flavone, baicalein, kaempferol, and quercetin on LPS-induced NO production were attenuated by the HO inhibitor, SnPP, and potentiated by the HO-1 inducer, hemin. In addition, HO-1 over-expressed RAW264.7 cells exhibited less sensitive to NO production induced by LPS than parental RAW264.7 cells, and flavonoids showed the more potent inhibitory activity to LPS-induced NO production in HO-1/RAW264.7 cells than those in parental RAW264.7 cells. Results of the present study provide the first evidence demonstrating that HO-1 involves in the anti-inflammatory effects of flavonoids, and a combination of an HO-1 inducer,
such as hemin and flavonoids, might be a promising strategy for the inhibition of LPS-induced NO production.
HO-1 (HSP32) is one member of the heat shock protein (HSP) group which responds to a number of cellular injuries, including thermal or oxidant stress, and also plays an essential role in the cell’s adaptive responses to protect cells
against thermal and oxidative stresses [28]. Hemin is an
effective inducer of HO-1 mRNA expression and activated HO-1 enzyme activity in human hepatoma cells. Previous studies demonstrated that HO-1 activity increased following treatment with hemin, and the metabolites heme to biliver-din and bilirubin that have been shown to possess potent
antioxidant properties [29,30]. Scapagnini et al.
demon-strated that plant-derived phenolic compounds of caffeic acid phenethyl ester (CAPE) and curcumin increased heme oxygenase activity and HO-1 protein in astrocytes with
elevating intracellular GSH level[31]. These data suggested
that induction of HO-1 involved in the antioxidative process. In this study, hemin significantly induced HO-1 gene expres-sion associated with inhibition of LPS-induced NO produc-tion. The inhibitory effects of flavonoids on LPS-induced NO production were potentiated significantly by lower doses of hemin. These data suggest that the inhibition of flavonoids on LPS-induced NO production parallels the inhibitory action of hemin, and the increase in HO-1 protein was able to potentiate the inhibitory effects of flavonoids on NO production induced by LPS. SnPP is a common HO inhibitor, and the inhibition of HO activity by SnPP has been
suggested in several previous studies[23,24]. In this study,
SnPP attenuated the inhibitory activities of the indicated flavonoids on LPS-induced NO production. These data suggest that activation of HO activity is involved in flavo-noid inhibition of LPS-induced NO production. Two other HO inhibitors, ZnPP and CoPP, were also used in the present study; however, attenuation of flavonoid-inhibited NO pro-duction by ZnPP and CoPP was not observed because ZnPP and CoPP showed potent inductive effects on HO-1 gene expression in cells (data not shown). Similar results of HO-1 induction by ZnPP and CoPP have been reported in previous
studies[32–34].
In order to examine if the inhibitory effects of flavonoids on LPS-induced NO production through their cytotoxic effect, microscopic observation and MTT assay were per-formed in the present study. Baicalein, kaempferol, and quercetin showed no significant cytotoxic effect in cells. However, only 3-OH flavone decreases the number of viable cells by MTT assay. 3-OH Flavone is an interesting compound, and a decrease in the number of viable cells was found by MTT and trypan blue exclusion assays. However, neither morphological change by microscopic observation nor DNA fragmentation by agarose electro-phoresis was found (data not shown). Our unpublished data showed that 3-OH flavone was able to suppress cell growth through modulation of cell cycle progression, and more detailed action of 3-OH flavone in cell cycle regulation is under investigating.
Control LPS 3-OH flavoneBaicalein Kaemp
ferol Quercetin Nitrite ( µ M) 0 10 20 30 40 compound compound+SnPP ** ** ** ** ## ## ## ##
Fig. 8. Tin protoporphyrin (SnPP) attenuation the inhibitory effects of flavonoids on LPS-induced NO production in RAW264.7 cells. Cells were treated with the indicated flavonoids (50 mM) and LPS (50 ng/mL) in the presence or absence of SnPP (10 mM) for 12 hr, and the amount of NO produced in the medium was determined by the Griess reaction. Data were obtained from six independent experiments and are expressed as the mean SE.P< 0:01 indicates significant differences from the indicated flavonoid-treated group;##P< 0:01 indicates significant difference from respective group, as analyzed by Student’s t-test.
The relationship between HO-1 induction and NO inhi-bition by flavonoids was first suggested in the present study. Results of direct and indirect NOS activity assays showed that flavonoids and the HO-1 inducer, hemin, caused slight but significant inhibition of NO production in an indirect NOS enzyme activity assay; however, decreasing NO production by these compounds was not examined in a direct NOS activity assay (data not shown). In the indirect NOS activity, HO-1 protein increased in cells which were pretreated with LPS for 12 hr followed by indicated HO-1 inductive compounds treatment. It is indi-cated that differential inhibitory effects of flavonoids and hemin on NO production between indirect and direct NOS activity assays might be due to HO-1 protein expression in the indirect NOS activity assay.
In conclusion, results of our present study demonstrate that induction of HO-1 gene expression is involved in the inhibitory effects of flavonoids on LPS-induced NO pro-duction, and increases in HO-1 protein potentiate their
inhibitory activities. We suggest that a combination of HO-1 inducers, such as hemin, and functional flavonoids, such as 3-OH flavone, baicalein, kaempferol, and querce-tin, would be very effective in preventing the NO produc-tion induced by LPS in cells. In the study, inhibiproduc-tion of NO production occurred simultaneously with a decrease of iNOS protein in flavonoid- and/or HO-1 inducer hemin-treated macrophages under LPS treatment. This suggests that induction of HO-1 is able to inhibit NO production through suppression of iNOS gene expression. Otterbein and et al. reported that metabolites of hemin, including biliverdin and bilirubin, were able to inhibit NOS activity
through their antioxidant activities[35]. It is suggested that
induction of HO-1 was able to decrease NO production induced by LPS through directly inhibited NOS activity or suppressed iNOS gene expression. The relationship between HO-1 induction and iNOS protein inhibition is still unde-fined, and more necessary evidence will be provided in further studies.
Fig. 9. 3-OH Flavone, baicalein, kaempferol, and quercetin showed more significant NO inhibition in HO-1/RAW264.7 cells than that in parental RAW264.7 cells. (A) The different amount of total protein (30 and 60 mg) extracted from RAW264.7 cells and HO-1/RAW264.7 cells were applied to SDS–PAGE electrophoresis, and the level of HO-1 protein expression was detected by Western blotting. a-Tubulin was described as an internal control. Right panel: Band intensity of HO-1 protein was quantified by a densitometry analysis, and expressed as a mean value derived from three independent experiments. (B) The amount of NO production induced by LPS in RAW264.7 cells and HO-1/RAW264.7 was measured by Griess reaction. Both cells were treated with different doses of LPS (5, 10, 20, 40, 80, and 160 ng/mL), and the amount of nitrite in the medium was measured as described previously. (C) 3-OH Flavone, baicalein, kaempferol, and quercetin showed the more significant inhibition in HO-1/RAW264.7 cells than that in parental RAW264.7 cells. Both RAW264.7 cells and HO-1/RAW264.7 cells were treated with 3-OH flavone, baicalein, kaempferol, and quercetin (50 and 100 mM) in the presence of LPS (50 ng/mL) for 12 hr, and NO produced in medium was detected by Griess reaction. NO production was determined using dilution of NaNO2as a standard and the absorbance at O:D:¼ 530 nm. Data were
obtained from six independent experiments and expressed as mean SE.##
Acknowledgments
This study was supported by the National Science Council of Taiwan (NSC 89-2320-B-038-054, NSC 90-2320-B-038-027, and NSC 91-2320-B-038-040).
References
[1] Bornman L, Baladi S, Richard M-J, Tyrell RM, Polla B. Differential regulation and expression of stress protein and ferritin in human monocytes. J Cell Physiol 1999;178:1–8.
[2] Hayashi S, Takamiya R, Yamaguchi T, Matsumoto K, Tojo SJ, Tamatani T, Kitajima M, Makino N, Ishimura Y, Suematsu M. Induction of heme oxygenase-1 suppresses venular leukocyte adhe-sion elicited by oxidative stress: role of bilirubin generated by the enzyme. Circ Res 1999;85:663–71.
[3] Poss KD, Tonegawa S. Reduced stress defense in heme oxygenase 1-deficient cells. Proc Natl Acad Sci USA 1997;94:10925–30. [4] Yachie A, Niida Y, Wada T, Igarashi N, Kaneda H, Toma T, Ohta K,
Kasahara Y, Koizumi S. Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiency. J Clin Invest 1999; 103:129–35.
[5] Colville-Nash PR, Qureshi SS, Willis D, Willoushby DA. Inhibition of inducible nitric oxide synthase by peroxisome proliferator-activated receptor agonists: correlation with induction of heme oxygenase-1. J Immunol 1998;161:978–84.
[6] Minamino T, Christou H, Hsieh CM, Liu Y, Dhawan V, Abraham NG, Perrella MA, Mitsialis SA, Kourembanas S. Targeted expression of heme oxygenase-1 prevents the pulmonary inflammatory and vascular responses to hypoxia. Proc Natl Acad Sci USA 2001;98:8798–803. [7] Schwartz SM. A protective player in the vascular response to injury.
Nat Med 2001;1:656–7.
[8] Chen YC, Shen SC, Lee WR, Lin HY, Ko CH, Lee TJF. Nitric oxide and prostaglandin E2participate in
lipopolysaccharide/interferon-g-induced heme oxygenase 1 and prevent RAW264.7 macrophages from UV-irradiation-induced cell death. J Cell Biochem 2002;86:331–9. [9] Otterbein LE, Kolls JK, Mantell LL, Cook JL, Alam J, Choi AM.
Exogenous administration of heme oxygenase-1 by gene transfer provides protection against hyperoxia-induced lung injury. J Clin Invest 1999;103:1047–54.
[10] Willis D, Moore AR, Willoughby DA. Heme oxygenase isoform expression in cellular and antibody-mediated models of acute inflam-mation in the rat. J Pathol 2000;190:627–34.
[11] Vera MEDE, Kim Y, Wang HR, Wang QI, Billiar TR, Geller DA. Heat shock response inhibits cytokine-inducible nitric oxide synthase ex-pression in rat hepatocytes. Hepatology 1996;24:1238–45. [12] Alcaraz MJ, Habib A, Marilyne L, Creminon C, Toledano SL,
Maclouf J. Enhanced expression of heme oxygenase-1 by nitric oxide and anti-inflammatory drugs in NIH 3T3 fibroblasts. Br J Pharmacol 2000;130:57–64.
[13] Marletta MA. Nitric oxide synthase structure and mechanism. J Biol Chem 1993;268:12231–4.
[14] Nathan C. Nitric oxide as a secretory product of mammalian cells. FASEB J 1992;6:3051–64.
[15] Williamson G, Plumb GW, Uda Y, Price KR, Rhodes MJ. Dietary quercetin glycosides: antioxidant activity and induction of the antic-arcinogenic phase II marker enzyme quinone reductase in Hepalclc7 cells. Carcinogenesis 1996;17:2385–7.
[16] Afanas’ev IB, Ostrakhovitch EA, Mikhal-chik EV, Ibragimova GA, Korkina LG. Enhancement of antioxidant and anti-inflammatory activities of biflavonoid rutin by complexation with transition metals. Biochem Pharmacol 2001;61:677–84.
[17] Shen SC, Lee WR, Lin HY, Huang HC, Ko CH, Yang LL, Chen YC. In vitro and in vivo inhibitory activities of rutin, wogonin, and quercetin
on lipopolysaccharide-induced nitric oxide and prostaglandin E2
production. Eur J Pharmacol 2002;446:187–94.
[18] Chen YC, Yang LL, Lee TJF. Oroxylin A inhibition of lipopolysac-charide-induced iNOS and COX-2 gene expression via suppression of nuclear factor-kB activation. Biochem Pharmacol 2000;59:1445–57. [19] Chen YC, Shen SC, Chen LG, Lee TJF, Yang LL. Wogonin, baicalin, and baicalein inhibition of inducible nitric oxide synthase and cycloox-ygenase-2 gene expression induced by nitric oxide synthase inhibitors and lipopolysaccharide. Biochem Pharmacol 2001;61:1417–27. [20] Chen YC, Shen SC, Lee WR, Hou WC, Yang LL, Lee TJF. Inhibition
of nitric oxide synthase inhibitors and lipopolysaccharide induced inducible NOS and cyclooxygenase-2 gene expression by rutin, quercetin, and quercetin pentaacetate in RAW 264.7 macrophages. J Cell Biochem 2001;82:537–48.
[21] Turcanu V, Dhouib M, Poindron P. Determination of heme oxygenase activity in murine macrophages for studying oxidative stress inhibitor. Anal Biochem 1998;263:251–3.
[22] Clark JE, Foresti R, Green CJ, Motterlini R. Dynamics of heme oxygenase-1 expression and bilirubin production in cellular protection against oxidative stress. Biochem J 2000;348:615–9.
[23] Sato K, Balla J, Otterbein L, Smith RN, Brouard S, Lin Y, Csizmadia E, Sevigny J, Robson SC, Vercellotti G, Choi AM, Bach FH, Soares MP. Carbon monoxide generated by heme oxygenase-1 suppresses the rejec-tion of mouse-to-rat cardiac transplants. J Immunol 2001;166:4185–94. [24] Ryter SW, Tyrrell RM. The heme synthesis and degradation pathway:
role in oxidant sensitivity. Free Radic Biol Med 2000;8:289–348. [25] Wadsworth TL, Koop DR. Effects of the wine polyphenolics quercetin
and resveratrol on pro-inflammatory cytokine expression in RAW 264.7 macrophages. Biochem Pharmacol 1999;57:941–9.
[26] Lee WR, Shen SC, Lin HY, Hou WC, Yang LL, Chen YC. Wogonin and fisetin induce apoptosis in human promyeloleukemic cells, accompanied by a decrease of reactive oxygen sepsis, and activation of caspase 3 and Ca2þ-dependent endonuclease. Biochem Pharmacol 2002;63:225–36. [27] Ko CH, Shen SC, Lin HY, Hou WC, Lee WR, Yang LL, Chen YC.
Flavanones structure related inhibition on TPA-induced tumor promo-tion through suppression of extracellular signal-regulated protein kinases: involvement of prostaglandin E2in anti-promotive process.
J Cell Physiol 2002;193:93–102.
[28] Hoetzel A, Vagts DA, Loop T, Humar M, Bauer M, Pahl HL, Geiger KK, Pannen BHJ. Effect of nitric oxide on shock-induced hepatic heme oxygenase-1 expression in the rat. Hepatology 2001;33:925–37. [29] Mitani K, Fujita H, Fukuda Y, Kappas A, Sassa S. The role of inorganic metals and metalloporphyrins in the induction of heme oxygenase and heat-shock protein 70 in human hepatoma cells. Biochem J 1993;290:819–25.
[30] Schwartzman ML, Abraham NG, Conners M, Dunn MW, Levere RD, Kappas A. Heme oxygenase induction with attenuation of experimen-tally induced corneal inflammation. Biochem Pharmacol 1997;53: 1069–75.
[31] Scapagnini G, Foresti R, Calabrese V, Giuffrida Stella AM, Green CJ, Motterlini R. Caffeic acid phenethyl ester and curcumin: a novel class of heme oxygenase-1 inducers. Mol Pharmacol 2002;61:554–61. [32] Taille C, Foresti R, Lanone S, Zedda C, Green C, Aubier M, Motterlini
R, Boczkowski J. Protective role of heme oxygenases against en-dotoxin-induced diaphragmatic dysfunction in rats. Am J Respir Crit Care Med 2001;163:753–61.
[33] Yang G, Nguyen X, Ou J, Rekulapelli P, Stevenson DK, Dennery PA. Unique effects of zinc protoporphyrin on HO-1 induction and apop-tosis. Blood 2001;97:1306–14.
[34] Ye J, Laychock SG. A protective role for heme oxygenase expression in pancreatic islets exposed to interleukin-1 beta. Endocrinology 1998; 139:4155–63.
[35] Otterbein L, Chin B-Y, Otterbein SL, Lowe VC, Fessler HE, Choi AMK. Mechanism of hemoglobin-induced protection against endo-toxemia in rat: a ferritin-independent pathway. Am J Physiol 1997; 272:L268–75.