The Joint Effect of hOGG1 Genotype and Smoking Habit on Endometriosis in Taiwan

The Joint Effect of hOGG1 Genotype and Smoking Habit on

Endometriosis in Taiwan

Chia-Wen Tsai

_{, Chien-Yi Ho}

_{, Liang-Chun Shih}

_{, Tsung-Ho Ying}

_,

Yi-Hsien Hsieh

_{, Ya-Chien Chen}

_{, Wen-Shin Chang}

_{, Meng-Hsuan}

Lee

_{, Chung-Yu Huang}

_{, Sin-Bao Pan}

_{, Hao-Ai Shui}

_{and Da-Tian}

Bau

1

_{Department of Obstetrics and Gynecology, School of Medicine, College of}

Medicine, Chung Shan Medical University, Taichung, Taiwan

2

_{Institute of Biochemistry and Biotechnology, College of Medicine, Chung}

Shan Medical University, Taichung, Taiwan

3

_{Department of Otolaryngology and}

_{Terry Fox Cancer Research Laboratory,}

China Medical University Hospital, Taichung; and Graduate Institutes of

_{Clinical Medical Science and}

_{Basic Medical Science, China Medical}

University, Taichung, Taiwan, R.O.C.

7

_{Taichung Armed Forces General Hospital, Taichung, Taiwan, R.O.C.}

_{Graduate Institute of Medical Sciences, National Defense Medical Center,}

Taipei, Taiwan, R.O.C.

* These authors contribute equally to this study

Correspondence to: Da-Tian Bau, Terry Fox Cancer Research Lab, China

Medical University Hospital, 2 Yuh-Der Road, Taichung, 404 Taiwan, R.O.C.

Tel: +886- 4-22053366 Ext 1523, Fax: +886 422053366 Ext 1543, e-mail:

Running title: Tsai et al: hOGG1 genotypes in endometriosis

Key Words: hOGG1, single nucleotide polymorphism, endometriosis,

Abstract

This study has two aims 1) to evaluate the association between hOGG1 genotypic polymorphism and endometriosis risk 2) to investigate the joint effects of hOGG1 genotype and smoking habit on endometriosis susceptibility in Taiwan. For this purpose, the well-known polymorphic variants of hOGG1, codon 326, was genotyped and analyzed of its association with the risk of endometriosis. In total, 153 patients with endometriosis and 636 non-endometriosis healthy controls were recruited and genotyped. The results showed that the hOGG1 codon 326 genotypes were not differently distributed between the endometriosis and non-endometriosis control groups in both genetic (P=0.6212) and allelic (P=0.4006) frequency analysis. We have further analyzed the genetic-smoking joint effects on endometriosis risk and found an obvious interaction between hOGG1 codon 326 genotypes and smoking status. The hOGG1 codon 326 genotypes were increased in endometriosis risk only in the smoker groups (P=0.0061), but not in the non-chewer group (P=0.0648). Our results provide the evidence that the hOGG1 codon 326 genotype may have a joint effect with smoking on the development of endometriosis.

Endometriosis is a common polygenic/multifactorial tumor in women, defined as the growth of endometrial tissue outside the uterine cavity that often results in dyspaurenia, dysmenorrhea, pelvic pain, and/or infertility, but its etiology remains unclear. [C.P. Barbosa, A.M. Souza, B. Bianco, D. Christofolini, F.A. Bach, G.R. Lima. Frequency of endometriotic lesions in peritoneum samples from asymptomatic fertile women and correlation with CA125 values. Sao Paulo Med J, 127: 342-345, 2009; C.P. Barbosa, A.M. de Souza, B. Bianco, D.M. Christofolini, F.A. Mafra, G.R. de Lima. OC-125 immunostaining in endometriotic lesion samples. Arch Gynecol Obstet, 281: 43-47, 2010] The prevalence of endometriosis is around 3-20% in the general population and as high as 20-50% in infertile women [C.P. Barbosa, A.M. Souza, B. Bianco, D. Christofolini, F.A. Bach, G.R. Lima. Frequency of endometriotic lesions in peritoneum samples from asymptomatic fertile women and correlation with CA125 values. Sao Paulo Med J, 127: 342-345, 2009; C.P. Barbosa, A.M. de Souza, B. Bianco, D.M. Christofolini, F.A. Mafra, G.R. de Lima. OC-125 immunostaining in endometriotic lesion samples. Arch Gynecol Obstet, 281: 43-47, 2010; L. Gao, K. Li, F. Li, H. Li, L. Liu, L. Wang et al. Polymorphisms in the FOXP3 gene in Han Chinese psoriasis patients. J Dermatol Sci 57: 51-56, 2010]. Endometriosis, one type of metaplases of eutopic endometrial cells, displays some features of malignancy, including local invasion and aggressive spread to distant organs. Ectopic endometriosis constitutes the growth of endometrial tissue in a place other than the uterine cavity. It is well known that DNA repairing system is essential for the maintenance of genome stability against carcinogenesis. Then it is logical to suspect some genetic variants of DNA repair genes might contribute to endometriosis pathogenesis.

anion radicals and hydrogen peroxide, which may induce lots of DNA single and double strand breaks. Sustained oxidative stress, such as smoking related chemicals exposure, may induce oxidative DNA adducts in human genome, and 8-hydroxy-2-deoxyguanine (8-OH-dG) was found to be the major adduct [Chen L, Elahi A, Pow-Sang J, Lazarus P and Park J: Association between polymorphism of human oxoguanine glycosylase 1 and risk of prostate cancer. J Urol 170: 2471-2474, 2003; Xu J, Zheng SL, Turner A, Isaacs SD, Wiley KE, Hawkins GA, Chang BL, Bleecker ER, Walsh PC and Meyers DA: Associations between hOGG1 sequence variants and prostate cancer susceptibility. Cancer Res 62: 2253-2257, 2002]. The 8-OH-dG is mutagenic which if not repaired immediately after its formation, may cause severe GC to TA transversions on genes such as oncogenes and tumor suppressor genes, which may lead to carcinogenesis [Chen L, Elahi A, Pow-Sang J, Lazarus P and Park J: Association between polymorphism of human oxoguanine glycosylase 1 and risk of prostate cancer. J Urol 170: 2471-2474, 2003; Xu J, Zheng SL, Turner A, Isaacs SD, Wiley KE, Hawkins GA, Chang BL, Bleecker ER, Walsh PC and Meyers DA: Associations between hOGG1 sequence variants and prostate cancer susceptibility. Cancer Res 62: 2253-2257, 2002]. Among the DNA repair pathways, the base excision repair subpathway is in charge of the removal of 8-OH-dG and other oxidative DNA adducts from our genome [Goode EL, Ulrich CM and Potter JD: Polymorphisms in DNA repair genes and associations with cancer risk. Cancer Epidemiol Biomarkers Prev 11: 1513-1530, 2002]. The human OGG1 (hOGG1) gene encodes a DNA glycosylase which catalyzes the cleavage of the glycosylic bond between the oxidized base and the sugar moiety, leaving an abasic apurinic/apyrumidinic site in altered DNA [Dianov GL, Souza-Pinto N, Nyaga SG, Thybo T, Stevnsner T and Bohr VA: Base excision repair in nuclear and mitochondrial DNA. Prog Nucleic Acid Res Mol Biol 68: 285-297, 2001; Boiteux S, Radicella JP. The

human OGG1 gene: structure, functions, and its implication in the process of carcinogenesis. Arch Biochem Biophys 2000; 377:1–8]. The resulting apurinic/apyrumidinic site is then incised, and the repair is completed by successive actions of a phosphodiesterase, a DNA polymerase, and a DNA ligase [Dianov GL, Souza-Pinto N, Nyaga SG, Thybo T, Stevnsner T and Bohr VA: Base excision repair in nuclear and mitochondrial DNA. Prog Nucleic Acid Res Mol Biol 68: 285-297, 2001; Boiteux S, Radicella JP. The human OGG1 gene: structure, functions, and its implication in the process of carcinogenesis. Arch Biochem Biophys 2000; 377:1–8]. Among the single nucleotide polymorphisms (SNPs) identified within the hOGG1 gene, the one located in the exon 7, resulting in an amino acid substitution of serine (Ser) with cysteine (Cys) at codon 326 (Ser326Cys, rs1052133), has been demonstrated to affect the hOGG1 function [Kohno T, Shinmura K, Tosaka M, Tani M, Kim SR, Sugimura H, Nohmi T, Kasai H and Yokota J: Genetic polymorphisms and alternative splicing of the hOGG1 gene, that is involved in the repair of 8-hydroxyguanine in damaged DNA. Oncogene 16: 3219-3225, 1998]. Those cells with Cys genotype exhibited a reduced DNA repair activity [Kohno T, Shinmura K, Tosaka M, Tani M, Kim SR, Sugimura H, Nohmi T, Kasai H and Yokota J: Genetic polymorphisms and alternative splicing of the hOGG1 gene, that is involved in the repair of 8-hydroxyguanine in damaged DNA. Oncogene 16: 3219-3225, 1998], and has been reported to be associated with the risk of many types of cancers in recent years [Weiss JM, Goode EL, Ladiges WC and Ulrich CM: Polymorphic variation in hOGG1 and risk of cancer: a review of the functional and epidemiologic literature. Mol Carcinog 42: 127-141, 2005; Ni M, Qiu J, He W and Wang X. The functional Ser326Cys polymorphism in hOGG1 is associated with gastric cancer risk: evidence from 1180 cases and 2444 controls. Eur J Gastroenterol Hepatol 24: 683-687, 2012; Wang W, Wang M, Chen Y, Zhang Z, Wang S, Xu M, Wang B,

Zhao Q and Zhang Z. The hOGG1 Ser326Cys polymorphism contributes to cancer susceptibility: evidence from 83 case-control studies. Mutagenesis 27: 329-336, 2012; Xu B, Tong N, Chen SQ, Yang Y, Zhang XW, Liu J, Hu XN, Sha GZ and Chen M. Contribution of HOGG1 Ser(3)(2)(6)Cys polymorphism to the development of prostate cancer in smokers: meta-analysis of 2779 cases and 3484 controls. PLoS One 7: e30309, 2012]. However, few papers have investigating the role of genotype of hOGG1 in endometriosis and not to mention its interaction with smoking habit. In the present study, we aimed at analyzing the genetic polymorphisms of the hOGG1 Ser326Cys genotypes in a endometriosis population, and investigated the interaction of hOGG1 Ser326Cys genotypes and smoking habits in the Taiwanese endometriosis population.

Materials and Methods

Study population and sample collection. Six hundred and thirty six patients diagnosed

with endometriosis were recruited at the outpatient clinics of general surgery during 2000-2010 at Chung Shan Medical University Hospital in Taiwan. The non-endometriosis statuses were confirmed after detail ultrasonography. All operations were performed by experienced surgeon Dr. Yin and his colleagues. All women accepted to provide their peripheral blood sampling for genotype analyses with their informed consents. The experiment was approved by the Ethical Committee and Institutional Review Board of the Chung Shan Medical University Hospital. About four-fold amounts of non-endometriosis healthy volunteers as the controls were selected by matching for their age, gender and habits after initial random sampling from the Health Examination Cohort of China Medical University Hospital. The exclusion criteria of the control group included previous malignancy, metastasized cancer from other or unknown origin, and any familial diseases. Both groups completed a well-informed

questionnaire which included the individual habits. Smokers were defined as daily or almost daily smokers, who had smoked at least five packs of cigarettes in their lifetime. Smokers were asked for the age of initiation, whether they were currently smoking or had already quit, and if so, when they had quit, and on average, how many cigarettes they smoked or had smoked daily.

Genotyping assays. Genomic DNA was prepared from peripheral blood leukocytes

using a QIAamp Blood Mini Kit (Blossom, Taipei, Taiwan) and further processed according to previous studies [Wang HC, Liu CS, Wang CH, Tsai RY, Tsai CW, Wang RF, Chang CH, Chen YS, Chiu CF, Bau DT and Huang CY. Significant association of XPD Asp312Asn polymorphism with breast cancer in Taiwanese patients. Chin J Physiol 53: 130-135, 2010; Wang CH, Wu KH, Yang YL, Peng CT, Tsai FJ, Lin DT, Chiu CF, Lin CC and Bau DT. Association between Ataxia Telangiectasia Mutated gene polymorphisms and childhood leukemia in Taiwan. Chin J Physiol 54: 413-418, 2011; Lin HH, Ke HL, Hsiao KH, Tsai CW, Wu WJ, Bau DT and Chang LL. Potential role of CCND1 G870A genotype as a predictor for urothelial carcinoma susceptibility and muscle-invasiveness in Taiwan. Chin J Physiol 54: 196-202, 2011; Chang WS, Yang MD, Tsai CW, Cheng LH, Jeng LB, Lo WC, Lin CH, Huang CY and Bau DT. Association of cyclooxygenase 2 single-nucleotide polymorphisms and hepatocellular carcinoma in Taiwan. Chin J Physiol 55: 1-7, 2012; Bau DT, Wang HC, Liu CS, Chang CL, Chiang SY, Wang RF, Tsai CW, Lo YL, Hsiung CA, Lin CC and Huang CY. Single-nucleotide polymorphism of the Exo1 gene: association with gastric cancer susceptibility and interaction with smoking in Taiwan. Chin J Physiol 52: 411-418, 2009; Bau DT, Tsai MH, Huang CY, Lee CC, Tseng HC, Lo YL, Tsai Y and Tsai FJ. Relationship between polymorphisms of nucleotide excision repair genes and oral cancer risk in Taiwan: evidence for modification of smoking habit. Chin J Physiol 50:

294-300, 2007; Bau DT, Chang CH, Tsai RY, Wang HC, Wang RF, Tsai CW, Yao CH, Chen YS, Shyue SK and Huang CY. Significant association of caveolin-1 genotypes with bladder cancer susceptibility in Taiwan. Chin J Physiol 54: 153-160, 2011; sengT

HC, T sai MH, C hiu CF, W ang CH, C hang NW, H uang CY, sai CWT , L iang SY, Wang CL and Bau DT: Association of XRCC4 Codon 247 Polymorphism with Oral Cancer Susceptibility in Taiwan. Anticancer Res 28: 1687-1691, 2008; Chang CH, Chang CL, Tsai CW, Wu HC, Chiu CF, Wang RF, Liu CS, Lin CC and Bau DT: Significant association of an XRCC4 single nucleotide polymorphism with bladder cancer susceptibility in Taiwan. Anticancer Res 29: 1777-1782, 2009; Yang MD, Hsu YM, Kuo YS, Chen HS, Chang CL, Wu CN, Chang CH, Liao YM, Wang HC, Wang MF and Bau DT: Significant Association of Ku80 Single Nucleotide Polymorphisms with Colorectal Cancer Susceptibility in Central Taiwan. Anticancer Res 29: 2239-2242, 2009; Chang CH, Chiu CF, Liang SY, Wu HC, Chang CL, Tsai CW, Wang HC, Lee HZ and Bau DT: Significant association of Ku80 single nucleotide polymorphisms with bladder cancer susceptibility in Taiwan. Anticancer Res 29: 1275-1279, 2009; Bau DT, Tsai MH, Lo YL, Hsu CM, Tsai Y, Lee CC and Tsai FJ: Association of p53 and p21(CDKN1A/WAF1/CIP1) Polymorphisms with Oral Cancer in Taiwan Patients. Anticancer Res 27: 1559-1564, 2007]. The polymerase chain reaction (PCR) cycling conditions were: one cycle at 94o_{C for 5 min; 35 cycles of 94}o_{C for 30 sec, 55}o_{C for 30}

sec, and 72o_{C for 30 sec, and a final extension at 72}o_{C for 10 min. Pairs of PCR primer}

sequences and restriction enzyme for each DNA product are all listed in Table I.

Statistical analyses. Only those subjects with both genotypic and clinical results were

recruited in the final analysis. To ensure that the controls used were representative of the general population and to exclude the possibility of genotyping error, the deviation

of the genotype frequencies of hOGG1 codon 326 in the controls from those expected under the Hardy-Weinberg equilibrium was examined by the goodness-of-fit test. Pearson’s Chi-square test was performed to compare the distributions of the genotypes between case and control groups. Data were recognized as statistically significant when individual P-value was less than 0.05.

Results

The genotypic and allelic frequencies for hOGG1 codon 326 gene polymorphism in endometriosis patients and non-endometriosis controls are summarized and analyzed in Table II. The genotype distributions of hOGG1 codon 326 were not different between endometriosis and non-endometriosis groups (P=0.6012) (Table II). The data also showed that the C allele of the hOGG1 codon 326 polymorphism was not significantly associated with a slightly higher endometriosis risk (P=0.4006). It is more convincing to provide the results from multiple approaches so we have also performed the analysis of odds ratio for endometriosis risk among the variant genotypes. The odds ratio analysis showed that those who carry heterozygous CG and homozygous CC have 0.83- and 0.86-fold of endometriosis risk (95%CI=0.56-1.22 and 0.52-1.44), compared with those with homologous GG, respectively. A combination of CC+CG vs GG has a similar level of risk compared with those with homologous GG (odds ratio=0.84, 95%CI=0.59-1.20). The conclusive finding deduced from the data in Tables II is that the C allele of hOGG1 codon 326 seems not to be associated with higher risk for endometriosis in Taiwan.

It may be that the genetic polymorphism of a low-penetrate gene, such as hOGG1, may not contribute to the susceptibility of endometriosis as much as the environmental factors, such as the individual smoking habit. Thus, we are interested in analyzing the interaction of genotype of hOGG1 codon 326 and the smoking habits. As show in Table

III, the genotype distribution of various genetic polymorphisms of hOGG1 codon 326 was significantly different between endometriosis and non-endometriosis control groups who have smoking habit (P=0.0061), which is not observed in the non-smokers (P=0.0648) (Table III).

Discussion

The role of hOGG1 in endometriosis was largely unknown. Thus in this study, we investigated the role of the most popular polymorphic genotype of the hOGG1 gene in the susceptibility for the endometriosis in a Taiwanese population. We found that none of the genotype of hOGG1 codon 326 was significantly associated with a higher susceptibility for oral cancer (Tables II). The data suggested that the effects of the

hOGG1 codon 326 genotype on endometriosis may not be as high-penetrate as other

polymorphic genotypes we have found previously [Ying TH, Tseng CJ, Tsai SJ, Hsieh SC, Lee HZ, Hsieh YH and Bau DT. Association of p53 and CDKN1A genotypes with endometriosis. Anticancer Res 31: 4301-4306, 2011; Bau DT, Hsieh YY, Wan L, Wang RF, Liao CC, Lee CC, Lin CC, Tsai CH and Tsai FJ. Polymorphism of XRCC1 codon arg 399 Gln is associated with higher susceptibility to endometriosis. Chin J Physiol 50: 326-329, 2007; Hsieh YY, Bau DT, Chang CC, Tsai CH, Chen CP and Tsai FJ. XRCC4 codon 247*A and XRCC4 promoter -1394*T related genotypes but not XRCC4 intron 3 gene polymorphism are associated with higher susceptibility for endometriosis. Mol Reprod Dev 75: 946-951, 2008].

The hOGG1 protein plays a central role in base excision repair. Kohno et al. had reported that 326Ser(C)-coding hOGG1 protein has a 7-fold higher 8-ox-dG repair activity than 326Cys(G)-coding hOGG1 [T. Kohno, K. Shinmura, M. Tosaka, M. Tani, S.R. Kim, H. Sugimura, T. Nohmi, H. Kasai, J. Yokota, Genetic polymorphisms and

alternative splicing of the hOGG1 gene, that is involved in the repair of 8-hydroxyguanine in damaged NA, Oncogene 16 (1998) 3219–3225]. This was further augmented by Yamane et al., whose findings suggested that 326Cys(G)-coding hOGG1 has a lower capacity to prevent 8-ox-dG-caused mutagenesis in vivo in human cells than 326Ser(C)-coding hOGG1 protein [A. Yamane, T. Kohno, K. Ito, et al., Differential ability of polymorphicOGG1 proteins to suppress mutagenesis induced by 8-hydroxyguanine in human cell in vivo, Carcinogenesis 25 (2004) 1689–1694]. In literature, the association of the OGG1 GG genotype with increased risk of various types of cancer has been reported [K. Arizono, Y. Osada, Y. Kuroda, DNA repair gene hOGG1 codon 326 and XRCC1 codon 399 polymorphisms and bladder cancer risk in a Japanese population, Jpn. J. Clin. Oncol. 38 (2008) 186–191; H. Li, X. Hao, W. Zhang, Q. Wei, K. Chen, The hOGG1 Ser326Cys polymorphism and lung cancer risk: a meta-analysis, Cancer Epidemiol. Biomarkers Prev. 17 (2008) 1739–1745; T. Sakamoto, Y. Higaki, M. Hara, M. Ichiba, M. Horita, T. Mizuta, Y. Eguchi, T. Yasutake, I. Ozaki, K. Yamamoto, S. Onohara, S. Kawazoe, H. Shigematsu, S. Koizumi, K. Tanaka,hOGG1Ser326Cys polymorphism and risk of hepatocellular carcinoma among Japanese, J. Epidemiol. 16 (2006) 233–239; Tsou YA, Hua CH, Tseng HC, Hsu CF, Tsai CW, Sun SS, Tsai RY, Tsai MH and Bau DT. The joint effect of hOGG1 single nucleotide polymorphism and betel quid chewing on oral cancer in Taiwan. Anticancer Res 30: 4205-4208, 2010; Liu CJ, Hsia TC, Tsai RY, Sun SS, Wang CH, Lin CC, Tsai CW, Huang CY Hsu CM and Bau DT. The joint effect of hOGG1 single nucleotide polymorphism and smoking habit on lung cancer in Taiwan. Anticancer Res 30: 4141-4145, 2010]. However, we did not find a significant association of any hOGG1 genotype with endometriosis risk in this study.

for smoking- and/or alcohol-related cancer in USA [Elahi A, Zheng Z, Park J, Eyring K, McCaffrey T and Lazarus P: The human OGG1 DNA repair enzyme and its association with orolaryngeal cancer risk. Carcinogenesis 23: 1229-1234, 2002]. In their results, the homozygous G/G genotype was associated with increased orolaryngeal cancer risk in the Caucasian population. In addition, the risky G allele had obvious joint effects with both smoking and alcohol drinking on orolaryngeal carcinogenesis [Elahi A, Zheng Z, Park J, Eyring K, McCaffrey T and Lazarus P: The human OGG1 DNA repair enzyme and its association with orolaryngeal cancer risk. Carcinogenesis 23: 1229-1234, 2002]. To compare the difference between Caucasian and oriental populations, we have also analyzed the association between hOGG1 codon 326 genotypes and endometriosis risk in patients and controls who have a smoking habit in Taiwan, an oriental population. Interestingly, the interaction between hOGG1 codon 326 and smoking habit is obvious, and the C allele, not G allele as in the Caucasian population, had joint effect with smoking habit on endometriosis risk (Table III). This ethnic difference is commonly happened in genomic study and needs to be verified in larger populations in the future.

In conclusion, we have found that smoking is an environmental factor for endometriosis in Taiwan, and genotype of hOGG1 had joint effects with smoking habit on endometriosis risk. Our results indicate that the C allele of hOGG1 codon 326 may interact with smoking habits, affecting the whole progress of endometriosis. In the future, more comprehensive genotyping and haplotyping are warranted in revealing novel clinically applicable predictive markers. Also, more functional studies are also required to evaluate genotype and phenotype correlation in endometriosis.

Acknowledgements

Ting Chang, Huang-Ting Chiang and the Tissue Bank at the China Medical University for their technical assistance. This study was partially supported by research grants from the Terry Fox Cancer Research Foundation, and Taichung Armed Forces General Hospital (grant number 101-25).

Table I. The sequences of the forward and reverse primers, polymerase chain reaction and restriction fragment

length polymorphism (PCR-RFLP) conditions for hOGG1 genotyping work.

Polymorphism (location)

Primers sequences (5’->3’) Restriction enzyme SNP sequence DNA fragment size (bp) Codon 326 (rs1052133) F: ACTGTCACTAGTCTCACCAG R: GGAAGGTGGGAAGGTG Fnu4HI 37 o_{C for 2 h} C (Ser) G (Cys) 200 100 + 100 *F and R indicate forward and reverse primers, respectively.

Table II. Genotypic and allelic frequencies for hOGG1 codon 326 gene polymorphism in endometriosis

patients and non-endometriosis controls.

Codon 326 rs1052133 Controls % Patients % P-valuea _{OR (95% CI)}

Genetic frequency 0.6212 GG 276 43.4% 73 47.7% 1.00 (ref) CG 255 40.1% 56 36.6% 0.83 (0.56-1.22) CC 105 16.5% 24 15.7% 0.86 (0.52-1.44) CG+CC 360 56.6% 80 52.3% 0.84 (0.59-1.20) Allele frequency 0. 4006 Allele G 807 63.4% 202 66.0% 1.00 (ref) Allele C 465 36.6% 104 34.0% 0.89 (0.68-1.16)

Table III. Distribution of hOGG1 codon 326 genotypes in endometriosis patients after

stratification by individual smoking habits.

Variable _{hOGG1 codon 326 genotype}

GG (%) CG (%) CC (%) P-value Non-Smokers 0.0648 Controls 206 (45.8%) 174 (38.7%) 70 (15.5%) Patients 58 (51.3%) 47 (41.6%) 8 (7.1%) Smokers 0.0061 Controls 70 (37.6%) 81 (43.5%) 35 (18.8%) Patients 15 (38.3%) 9 (22.5%) 16 (40.0%)