1. Latchman, D.S., Eukaryotic Transcription Factors. 1995.
2. Evan, G.I., et al., Induction of apoptosis in fibroblasts by c-myc protein.
Cell, 1992. 69(1): p. 119-28.
3. Little, C.D., et al., Amplification and expression of the c-myc oncogene in human lung cancer cell lines. Nature, 1983. 306(5939): p. 194-6.
4. Pandolfi, P.P., Transcription therapy for cancer. Oncogene, 2001. 20(24):
p. 3116-27.
5. Shen, Z., et al., Multiple transcription factor profiling by enzyme-linked immunoassay. Biotechniques, 2002. 32(5): p. 1168, 1170-2, 1174 passim.
6. Liu, P.Q., et al., Isogenic human cell lines for drug discovery: regulation of target gene expression by engineered zinc-finger protein transcription factors. J Biomol Screen, 2005. 10(4): p. 304-13.
7. Fried, M. and D.M. Crothers, Equilibria and kinetics of lac
repressor-operator interactions by polyacrylamide gel electrophoresis.
Nucleic Acids Res, 1981. 9(23): p. 6505-25.
8. Delage, V., et al., Microtiter plate immunoenzymometric assay for estrogen receptor. Clin Chem, 1996. 42(12): p. 1955-60.
9. Nordeen, S.K., Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques, 1988. 6(5): p. 454-8.
10. Nolan, J.P. and F. Mandy, Multiplexed and microparticle-based analyses:
quantitative tools for the large-scale analysis of biological systems.
Cytometry A, 2006. 69(5): p. 318-25.
11. Matsui, T., et al., Multiple factors required for accurate initiation of
transcription by purified RNA polymerase II. J Biol Chem, 1980. 255(24):
p. 11992-6.
12. Mitchell, P.J. and R. Tjian, Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science, 1989. 245(4916): p.
371-8.
13. Buratowski, S., et al., Five intermediate complexes in transcription initiation by RNA polymerase II. Cell, 1989. 56(4): p. 549-61.
14. Lewin, B., Genes VIII. 2004: Pearson Education International.
15. Karin, M. and E. Gallagher, From JNK to pay dirt: jun kinases, their biochemistry, physiology and clinical importance. IUBMB Life, 2005.
57(4-5): p. 283-95.
16. Pulverer, B.J., et al., Phosphorylation of c-jun mediated by MAP kinases.
Nature, 1991. 353(6345): p. 670-4.
17. O'Hagan, R.C., et al., The activity of the Ets transcription factor PEA3 is regulated by two distinct MAPK cascades. Oncogene, 1996. 13(6): p.
1323-33.
18. Davis, R.J., Transcriptional regulation by MAP kinases. Mol Reprod Dev, 1995. 42(4): p. 459-67.
19. Aliaga, J.C., et al., Requirement of the MAP kinase cascade for cell cycle progression and differentiation of human intestinal cells. Am J Physiol, 1999. 277(3 Pt 1): p. G631-41.
20. Dunn, K.L., et al., The Ras-MAPK signal transduction pathway, cancer and chromatin remodeling. Biochem Cell Biol, 2005. 83(1): p. 1-14.
21. Khazaie, K., et al., EGF promotes in vivo tumorigenic growth of primary chicken embryo fibroblasts expressing v-myc and enhances in vitro transformation by the v-erbA oncogene. Oncogene, 1991. 6(1): p. 21-8.
22. Rimokh, R., et al., A chromosome 12 coding region is juxtaposed to the MYC protooncogene locus in a t(8;12)(q24;q22) translocation in a case of B-cell chronic lymphocytic leukemia. Genes Chromosomes Cancer, 1991. 3(1): p. 24-36.
23. Semenza, G., Signal transduction to hypoxia-inducible factor 1. Biochem Pharmacol, 2002. 64(5-6): p. 993-8.
24. Wang, G.L., et al., Hypoxia-inducible factor 1 is a
basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension.
Proc Natl Acad Sci U S A, 1995. 92(12): p. 5510-4.
25. Thrash-Bingham, C.A. and K.D. Tartof, aHIF: a natural antisense transcript overexpressed in human renal cancer and during hypoxia. J Natl Cancer Inst, 1999. 91(2): p. 143-51.
26. Sen, R. and D. Baltimore, Inducibility of kappa immunoglobulin
enhancer-binding protein Nf-kappa B by a posttranslational mechanism.
Cell, 1986. 47(6): p. 921-8.
27. Escarcega, R.O., et al., The transcription factor nuclear factor-kappa B and cancer. Clin Oncol (R Coll Radiol), 2007. 19(2): p. 154-61.
28. Luo, J.L., H. Kamata, and M. Karin, IKK/NF-kappaB signaling:
balancing life and death--a new approach to cancer therapy. J Clin Invest, 2005. 115(10): p. 2625-32.
29. Luo, J.L., H. Kamata, and M. Karin, The anti-death machinery in IKK/NF-kappaB signaling. J Clin Immunol, 2005. 25(6): p. 541-50.
30. DiDonato, J., et al., Mapping of the inducible IkappaB phosphorylation sites that signal its ubiquitination and degradation. Mol Cell Biol, 1996.
16(4): p. 1295-304.
31. Beg, A.A. and A.S. Baldwin, Jr., The I kappa B proteins: multifunctional regulators of Rel/NF-kappa B transcription factors. Genes Dev, 1993.
7(11): p. 2064-70.
32. Osborn, L., S. Kunkel, and G.J. Nabel, Tumor necrosis factor alpha and interleukin 1 stimulate the human immunodeficiency virus enhancer by activation of the nuclear factor kappa B. Proc Natl Acad Sci U S A, 1989.
86(7): p. 2336-40.
33. Karin, M., The beginning of the end: IkappaB kinase (IKK) and NF-kappaB activation. J Biol Chem, 1999. 274(39): p. 27339-42.
34. Lewis J, K., Principles of Cancer Biology. 2006.
35. Garg, A. and B.B. Aggarwal, Nuclear transcription factor-kappaB as a target for cancer drug development. Leukemia, 2002. 16(6): p. 1053-68.
36. Burnette, W.N., "Western blotting": electrophoretic transfer of proteins from sodium dodecyl sulfate--polyacrylamide gels to unmodified
nitrocellulose and radiographic detection with antibody and
radioiodinated protein A. Anal Biochem, 1981. 112(2): p. 195-203.
37. Ludwig, L.B., B.J. Hughes, and S.A. Schwartz, Biotinylated probes in the electrophoretic mobility shift assay to examine specific dsDNA, ssDNA or RNA-protein interactions. Nucleic Acids Res, 1995. 23(18): p. 3792-3.
38. Engvall, E. and P. Perlman, Enzyme-linked immunosorbent assay (ELISA).
Quantitative assay of immunoglobulin G. Immunochemistry, 1971. 8(9): p.
871-4.
39. Jagelska, E., et al., New ELISA technique for analysis of p53 protein/DNA binding properties. J Immunol Methods, 2002. 267(2): p. 227-35.
40. Wang, J.K., et al., Assay of DNA-binding proteins with a dsDNA-coupled plate. Clin Biochem, 2006. 39(2): p. 167-75.
41. Wang, J., et al., Exonuclease-mediated ELISA-like assay for detecting DNA-binding activity of transcription factors: measurement of activated NF-kappaB. Biotechniques, 2006. 41(1): p. 79-88, 90.
42. Brasier, A.R., J.E. Tate, and J.F. Habener, Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines.
Biotechniques, 1989. 7(10): p. 1116-22.
43. Drouet, C., A.N. Shakhov, and C.V. Jongeneel, Enhancers and
transcription factors controlling the inducibility of the tumor necrosis factor-alpha promoter in primary macrophages. J Immunol, 1991. 147(5):
p. 1694-700.
44. Smith, D.L. and B.J. Morris, Transient expression analyses of DNA
extending 2.4 kb upstream of the human renin gene. Mol Cell Endocrinol,
1991. 80(1-3): p. 139-46.
45. Hertweck, M. and R. Baumeister, Automated assays to study longevity in C. elegans. Mech Ageing Dev, 2005. 126(1): p. 139-45.
46. Vignali, D.A., Multiplexed particle-based flow cytometric assays. J Immunol Methods, 2000. 243(1-2): p. 243-55.
47. Horan, P.K. and L.L. Wheeless, Jr., Quantitative single cell analysis and sorting. Science, 1977. 198(4313): p. 149-57.
48. Dunn, P.A. and H.W. Tyrer, Quantitation of neutrophil phagocytosis, using fluorescent latex beads. Correlation of microscopy and flow cytometry. J Lab Clin Med, 1981. 98(3): p. 374-81.
49. Lisi, P.J., et al., A fluorescence immunoassay for soluble antigens employing flow cytometric detection. Clin Chim Acta, 1982. 120(2): p.
171-9.
50. Best, L.M., et al., Serological detection of Helicobacter pylori by a flow microsphere immunofluorescence assay. J Clin Microbiol, 1992. 30(9): p.
2311-7.
51. McHugh, T.M., et al., The sensitive detection and quantitation of antibody to HCV by using a microsphere-based immunoassay and flow cytometry.
Cytometry, 1997. 29(2): p. 106-12.
52. McHugh, T.M., et al., Flow cytometric detection and quantitation of immune complexes using human C1q-coated microspheres. J Immunol Methods, 1986. 95(1): p. 57-61.
53. Yang, L., D.K. Tran, and X. Wang, BADGE, Beads Array for the Detection of Gene Expression, a high-throughput diagnostic bioassay.
Genome Res, 2001. 11(11): p. 1888-98.
54. Fuja, T., S. Hou, and P. Bryant, A multiplex microsphere bead assay for comparative RNA expression analysis using flow cytometry. J Biotechnol, 2004. 108(3): p. 193-205.
55. Carson, R.T. and D.A. Vignali, Simultaneous quantitation of 15 cytokines using a multiplexed flow cytometric assay. J Immunol Methods, 1999.
227(1-2): p. 41-52.
56. Kettman, J.R., et al., Classification and properties of 64 multiplexed microsphere sets. Cytometry, 1998. 33(2): p. 234-43.
57. Li, J.L., et al., An optimized assay for transcription factor NF-kappaB with dsDNA-coupled microplate. Colloids Surf B Biointerfaces, 2007.
55(1): p. 31-7.
58. de Jager, W. and G.T. Rijkers, Solid-phase and bead-based cytokine immunoassay: a comparison. Methods, 2006. 38(4): p. 294-303.
59. Winblade, N.D., et al., Sterically blocking adhesion of cells to biological surfaces with a surface-active copolymer containing poly(ethylene glycol) and phenylboronic acid. J Biomed Mater Res, 2002. 59(4): p. 618-31.
60. Wang, J., et al., DNA microarrays with unimolecular hairpin double-stranded DNA probes: fabrication and exploration of
sequence-specific DNA/protein interactions. J Biochem Biophys Methods, 2003. 55(3): p. 215-32.
附錄一、常見轉錄因子之結合序列
Transcription factor Core binding sequence
AP-1 TGAGTCA AP-2 Binding Element GCCCCAGGC
CRE-ATF1 TGACGTCA CREB binding Element TTACGTAA
EGR GCGTGGGCG GATA TCAGATAAGA HIF TACGTG
MEF-2 CTAAAAATAGCA Myc-Max ACCACGTGGT
NF-1 TGGNNNNNNGCCAA NFAT ATTGGAAA
NFkB Gene Family GGGACTTTCC
Octamer CATTTGCATA PPAR AGGAAACTGGA SRE CCATATATGG YY1 GGCCATCTTG
附錄二、實驗內使用之核酸片段序列
*HBS
Biotin-gcatcaagcttggtaccgagctcggatccactagtaacggccgccagtgtgctggaattcggcttgttgg agtgtacgtgtgtgctcccccaggcattggttgttggagtgtacgtgtgtgctcccccaggcatggttgttggagtg tacgtgtgtgctccccaggcatggttgttggagtgtacgtgtgtgctccccaggcatggttgttggagtgtacgtgt gtgctcccccaggcatggttgttggagtgtacgtgtgtgctccccaggcatggttgttggagtgtacgtgtgtgctc ccccagacgtatatacgtatataagccgaattctgcagatatcgatagct
cHBS
atttaggtgacactatagaatactcaagctatgcatcaagcttggtaccgagctcggatccactagtaacggccgcc agtgtgctggaattcggcttgttggagtgtacgtgtgtgctcccccaggcattggttgttggagtgtacgtgtgtgct cccccaggcatggttgttggagtgtacgtgtgtgctccccaggcatggttgttggagtgtacgtgtgtgctccccag gcatggttgttggagtgtacgtgtgtgctcccccaggcatggttgttggagtgtacgtgtgtgctccccaggcatgg ttgttggagtgtacgtgtgtgctcccccagacgtatatacgtatataagccgaattctgcagatatcgatagct
*NFκB
Biotin-tcatgtctggatccaagctaggggactttccgcttggggactttccgctggggactttccgctggggact ttccgctggggactttccgcggagactctagagggtatataatggatccccgg
cNFκB
aaatacgcgttccaagctaggggactttccgcttggggactttccgctggggactttccgctggggactttccgct ggggactttccgcggagactctagagggtatataatggatccccgggtaccgagctcgaattcaccatggtgagc aagcagatcc
VP16
tatcctgcagtccgcgtacagccgcgcgcgtacgaaaaacaattacgggtctaccatcgagggcctgctcgatctc ccggacgacgacgcccccgaagaggcggggctggcggctccgcgcctgtcctttctccccgcgggacacacg cgcagactgtcgacggcccccccgaccgatgtcagcctgggggacgagctccacttagacggcgaggacgtgg cgatggcgcatgccgacgcgctagacgatttcgatctggacatgttgggggacggggattccccgggtccggga tttaccccccacgactccgccccctacggcgctctggatatggccgacttcgagtttgagcagatgtttaccgatgc ccttggaattgacgagtacggtgggtagctcgaggtca
附錄三、質體圖示
1. pCRII-C2-9
Sp6 promoter
pCRII-C2-9
4229 bp
Kanamycin resistance ORF Ampicillin resistance ORF
7X HBS pUC origin
XbaI (645) BamHI (295)
2. pNF-kB-hrGFP
3.CMV-ampR-linker-VP16
CMV-ampR-linker-VP16
6762 bp
SV40 origin and promote SV40 pA
pUC origin
AmpR
ampR
VP16
Linker
CMV promoter
ARE-hrGFP
5983 bp
pUC origin
AmpR
hrGFP ARE
4. ARE-hrGFP